Tumor-associated antigenic pattern in squamous cell carcinomas of the head and neck – Analysed by SEREX

EUROPEAN JOURNAL OF CANCER

4 9 ( 2 0 1 3 ) e 1 –e 7

available at www.sciencedirect.com

journal homepage: www.ejconline.com

Tumor-associated antigenic pattern in squamous cell carcinomas of the head and neck – Analysed by SEREX Bernd Heubecka,*, Olaf Wendlera, Klaus Bumma, Renate Scha¨fera, Uwe Mu¨ller-Vogta, Marcus Ha¨uslera, Eckart Meeseb, Heinrich Iroa, Helmut Steinharta a

Department of Otorhinolaryngology Head and Neck Surgery, University of Erlangen-Nuremberg, Waldstrasse 1, 91054 Erlangen, Germany Institute of Human Genetics, University of Saarland, Geba¨ude 60, 66421 Homburg, Germany

b

A R T I C L E I N F O

A B S T R A C T

Article history:

Most immuno-therapeutic approaches are based on tumor-associated antigens and many

Received 21 July 2005

newly identified proteins have led to trials exploiting their possible therapeutic applicabil-

Accepted 6 September 2005

ity. So far only limited information on the antigenic profile of head and neck squamous cell

Available online 11 July 2006

carcinomas (HNSCC) exists. Serological analysis of tumor antigens by recombinant cDNA expression cloning (SEREX) was used to identify the immunogenic patterns in our HNSCC

Keywords:

patient collective. A cDNA expression library derived from a pharynx HNSCC case was

HNSCC

screened with autologous and heterologous sera. Thirty-seven positive clones coding for

Head and neck

17 immunoreactive gene products, which elicited an in vivo tumor response, were found.

SEREX

Results were confirmed and extended by expression analysis using RT-PCR and in situ-

Antigen

hybridisation. The protein-sequence of five clones exists so far only hypothetically. Of all identified proteins only KIAA0530 has previously been associated with a HNSCC related immune response. All other proteins have not yet been described in a context with HNSCC antigenic patterns. Antibodies against a heat shock transcription factor 2 (HSF2) were found in 2 out of 10 sera from HNSCC patients. In summary, using the SEREX technique, we isolated 17 immunogenic antigens in HNSCC’s and confirmed the clinical relevance of KIAA0530. Further analysis concerning their feasibility as target structures for an immunotherapy approach is currently conducted.  2006 Published by Elsevier Ltd.

1.

Introduction

HNSCC is a malignant, epithelial tumor which accounts for approximately 8–10% of all malignant tumors and affects up to 70,000 people every year in the United States. With approximately 60% of all malignant tumors and 18,000 new cases per year it is the most frequent tumor in the field of Otorhinolaryngology in Germany. Treatment often involves surgical resection of the affected area followed by combined radiochemo-therapy. The overall 5-year-survival-rate is less than 25% and up to 35% of the treated patients with advanced tumors develop disease recurrences within 2 years.

In HNSCC’s, squamous cells derive from totipotent stem cells; therefore the diseased cells are seldom homogeneous or limited to a cell type. Undifferentiated HNSCC‘s may consist of basis cells, gland cells or even nerve cells. Many factors have been linked as risk factors for the emergence of this cancer, such as: alcohol, nicotine, ionizing radiation, asbestos, hardwood dust, heavy metals, bad mouth hygiene and different viral infections. Even though the exact progression from normal to malignant cells is still unknown, many localizations in the human genome were already explored. Recent findings have indicated, that the short and the long arm of the chromosome 31 are most frequently involved in disease

* Corresponding author: Tel.: +49 9131 853 315 6; fax: +49 9131 853 383 3. E-mail address: [email protected] (B. Heubeck). 0959-8049/$ - see front matter  2006 Published by Elsevier Ltd. doi:10.1016/j.ejca.2005.09.036

e2

EUROPEAN JOURNAL OF CANCER

progression. On chromosome 3p a loss of the heterozygosity was frequently found, pointing towards the presence of a putative tumor suppressor gene in this area.2 Already numerous suppressor genes (i.e.: p53, p16, APC)3 and some oncogenes (Cyclin D1, EGFR)4 have shown to be involved in the development and progression of HNSCC’s. So far many solid tumors have been reported to elicit an immune response directed against cancer associated autoimmunogenic structures. Proteins known to have antigenic potential in solid tumors are among the cancer/testis-antigens, i.e. the MAGE-family in melanoma5 or several transcription-factors in lung- carcinomas.6 The immunogenic potential of these often ubiquitously expressed antigens was recently related to a disease specific overexpression. From a clinical point of view, target antigens are intriguing in terms of innovative therapeutic strategies such as dendritic cell vaccination7 or treatment with specific tumor-peptides.8 The first results in approaching HNSCC’s were reported in tissue-culture experiments with bispecific and trifunctional antibodies against the Ep-CAM antigen, which is overexpressed in many HNSCC‘s.9 Ep-CAM activates different pathways of the immune response and induces TNFa production. Compared with other solid tumors, there is only little knowledge on antigenic proteins in HNSCC’s.10 Research on possible target proteins has mostly been carried out by screening HNSCC expression levels with already known antigens, such as MAGE1- and MAGE3-gene,11 the RAGE- and GAGE-gene12 or the E1A-gene,13 but no antigen was found suitable for a clinical trial. In order to identify tumor related antigenic structures, two different techniques have so far been used: A restricted cytotoxic t-cell reaction or by an autologous antibody reaction.14 In order to identify antigenic structures in our HNSCC population, we applied the SEREX technique, a variation of the autologous antibody reaction, on a total of 11 patients. Main advantage of the SEREX technique is, that reflects the patients momentary immunogenic situation and therefore detects antigenic structures against which the patient had an immuno-reaction. Technical interference factors that alter an immuno-response, such as reactions in tissue cultures are not a factor in this technique.

2.

Materials and methods

2.1.

Patients

4 9 ( 2 0 1 3 ) e 1 –e 7

quantity of mRNA was 4 lg. The cDNA-expression-library was constructed with the Gigapack Gold Express kit (Stratagene Europe, Amsterdam, Netherlands) using the k-Zap Express-Vector. cDNA was cloned in sense direction. For infection the XL1 Blue MRF’ cells (Stratagene Europe, Amsterdam, Netherlands) were used. The titer of the library was 1.26 · 106. Amplified phages were frozen with DMSO in 70 C until screening.

2.3.

Sera

The blood samples from the patients and the healthy control persons were centrifuged in sera-collection-tubes for 15 min with 3000 rpm and the sera were frozen at 80 C. About 1 ml of serum sample was diluted 1:10 with TBS that containing 0.5% powdered milk and 0.01% Thimerosal. This solution was then preabsorbed alternately five times in a mechanical and five times in a lytical column. In the mechanical column ultrasound-damaged E. coli cells were coupled to Affinity Absorbent (Glutaraldehyde-activated) (Roche Diagnostics GmbH, Mannheim, Germany), while in the lytical column non-recombinant k-phages were used in place of the bacteria. The preabsorbed sera were then diluted 1:10 again, so the final dilution was 1:100.

2.4.

Immunoscreening

Approximately 2 · 103 phages from the cDNA-library were plated on one 137 mm-LB-agarplate with tetracycline (50 lg/ ml) till plaques are visible. Then proteins were blotted on Duralose-membranes (Stratagene Europe, Amsterdam, Netherlands) for 4–5 h. These membranes were washed with TBST, all unspecific epitopes blocked with TBS contained 5%-powderd milk and incubated with the sera for 3 h. Immunoreactions between IgG-immunoglobulines from the sera and the recombinant-expressed tumor-protein from the phages were detected with a secondary-antibody Alkaline Phosphatase-conjugated AffiniPure Goat Anti-Human IgG, Fcv Fragment Specific (Dianova, Hamburg, Germany). The positive clones can be visualized by a color-reaction between with 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium salt (BCIP/NBT; Promega, Mannheim, Germany).

2.5.

Preparation of the positive clones

The present study was conducted in accordance with the guidelines of the Ethics Committee of the University of Erlangen-Nuremberg. All patients were informed of possible discomfort and risks of the surgical treatment and further use of all pathological specimens for research purpose. Tissue samples and sera were frozen immediately after surgery in liquid nitrogen and stored at 80 C.

Positive clones were isolated, plated again and checked threetimes. False-positive clones were excluded by one control step without sera. The phagemid vector pBK-CMV was isolated by in vivo excision from the positive clones according to the manufacturer’s instructions.

2.2.

About 750 ng from the so prepared pCMV-phagemids was sequenced with the Big Dye 3.0-sequencing kit (ABI, Warrington, UK) on a ABI Prism 3.0. The primers were standard M13 sequence and T3 primers (MWG, Ebersberg, Germany). The sequences were compared with the NCBI-database and with the SEREX-database (www.ncbi.nlm.nih.gov).

cDNA-library

RNA was extracted from tumor tissue using the Rneasy Minikit (Qiagen, Hilden, Germany) and the mRNA was purified with the Oligotex mRNA-kit (Qiagen, Hilden, Germany). Integrity of RNA was controlled by electrophoresis; the starting-

2.6.

Sequencing

EUROPEAN JOURNAL OF CANCER

2.7.

RT-PCR

The expression of heat shock transcription factor 2 was checked by RT-PCR. Therefore 2 lg RNA were transcribed with the omniscript RT-kit (Qiagen, Hilden, Germany) using a polydT-Primer (Promega, Mannheim, Germany). About 2 ll from the so prepared cDNA was used for every PCR in a 25 ll-reaction with the HotStarTaq-kit (Qiagen, Hilden, Germany). The products were checked on 2%-agarosegel with SYBR-Greenstaining and sequenced. Acc. No. Primer 50: cgcgttaacaatgaagcaga Acc. No. Primer 30: gttgctgttgtgcatgcttt Product length: 526 bases.

6806888, 6806888,

Base Base

79–98, 605–586,

3.

Results

3.1.

Screening with autologous sera

The primary screening of approximately 4 · 105 clones of the HNSCC-cDNA library with autologous sera resulted in 37 positive clones. All positive clones were examined three times with serum and once without serum. After preparation and sequencing 17 different DNA sequences could be determined (some clones were found several times). With the data base comparison (www.ncbi.nlm.nih.gov) homologies could be found for all DNA fragments. Table 1 shows all positively identified clones, the established homologies, as well as the frequency, with which the clones were found. For five cDNAs the protein sequence exists only hypothetically.

3.2. 2.8.

In situ hybridization

In situ hybridization was performed with minor modifications as described previously (Braissant). Frozen biopsies were sectioned to 8 lm in a 20 C cooled cryostat and mounted on a glass slide. The HSF2-RNA-probes were labeled by incorporation of digoxygenin-labeled dUTP (Roche Diagnostic GmbH, Mannheim, Germany) with the MAXIscript in vitro Transcription Kit (Ambion, Huntingdon, UK). Hybridizations were performed with Dig-labeled sense and antisense HSF2-probes for 20 h. After washing, the sections were treated with RNAse A (50 lg/ml) for 30 min at 37 C to minimize the background. The hybridized probes were detected with a peroxidase-conjugated anti-Dig antibody (Roche Diagnostics GmbH, Mannheim, Germany) in a enzyme-catalyzed color reaction with BCIP/NBT (Promega, Mannheim, Germany).

e3

4 9 ( 2 0 1 3 ) e 1 –e 7

Comparison with the SEREX-database

In the case of the sequence comparison with the SEREX-database, in which nearly 1700 immunogenic antigens characterized by SEREX are contained, homologies resulted for the KIAA0530 gene and to the hepatocellular carcinoma-associated antigen gene. All seven clones with KIAA0530 as insert show high homologies to clone 1274 in the SEREX-database, which was found in a screening of a breast cancer-library. In the SEREX-database there are more homologous clones to KIAA0530, detected in colorectal carcinoma- and testis-library. No homologies were found to the other clones, so they seemed to be specific to squamous cell carcinomas of the head and neck.

3.3.

Characterization of the tumor-associated antigens

The positive clones of the autologous screening were divided in four functional groups (Fig. 1). The first group consists of

Table 1 – Summary of detected antigens by SEREX analysis of squamous cell carcinoma with autologous sera Gene

Homo sapiens KIAA0530 protein H. s. Heat shock transcription factor 2 (HSF2) H. s. mRNA for WDR9 protein H. s. TANK-binding kinase 1 (TBK1) Human Zn-15 related zinc finger protein (rlf) H. s. CCCTC-binding factor (CTCF) H. s. STE20-like kinase (JIK) H. s. Similar to microtubule-associated prot. 7 H. s. Squamous cell carcinoma antigen recognised by T cells 3 (SART3), mRNA H. s. Partial RARA gene, intron 2 H. s. dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit (DPM1) Hepatocellular carcinoma-associated antigen (HCA90) H. s. KIAA0669 gene product H. s. KIAA0800 gene product H. s. KIAA1411 protein H. s. cDNA FLJ10973 fis H. s. cDNA FLJ12799 fis H. s. KIAA1229 protein/thrombomodulin

Access No.

Localisation

Homology to SEREXdatabase

6q16.1 6q22.33 21q22.2

NG-Br-42

Frequency

14755650 6806888 14970563 19743810 1218027 5729789 19923463 22060297 213227689

1p32 16q22.1 12q Chr. X 12q24.1

7· 5· 4· 3· 2· 2· 2· 2· 1·

12054223 4503362

17q12 20q13.13

1· 1·

15077023 7662235 18606289 13540485 7023350 10434498 14727196/11421351

NGO-St-23 3q25.1 3p21.31 6q12-q13

1· 1· 1· 1· 1· 1· 1·

e4

EUROPEAN JOURNAL OF CANCER

proteins, which are important for the cell division and the cell skeleton. In this group belongs only the protein TPX2, which is responsible for the formation of the division spindle. In the second group are enzymes of the metabolism. These are the tank binding kinase 1 and STE20-like kinase, which belong to the family of serin/threonin kinases. Apart of the two kinases the one sorting nexin protein (SNX4) is a member of this group. Proteins of this family are responsible in eukaryotes for the transport of the proteins taken up by endocytosis into the cell. In addition these proteins bind at certain receptors at the cell membrane (e.g. EGF-, insulin- and leptinreceptor).15 The receptor-obtained endocytosis is strongly restrained by the overexpression of SNX4.16 Likewise a cytosolic protein is the Vpr binding protein, which binds to the Vpr protein of the HIV-1-Virus and is responsible for the pathogenesis and the replication of the virus.17 The last representative in this group is the DPM1 protein, which represent probably a dolichol-phosphate mannosyl-transferase and which is located in the endoplasmatic reticulum. A third group with proteins with unknown function was defined. In this group there are two KIAA genes (KIAA0669, KIAA1411), a FLJ gene (FLJ14503) and a DKFZ protein (DKFZp686B01259). The protein sequences are only hypothetical and the functions therefore are mostly unknown. FLJ14503 could be microtubuli associated. The KIAA0669-protein exhibits similarities with the TSC-22-protein and belongs therefore to the family of the TSC-22/Dip/Bun-Proteine. The TSC-22-protein is a TGFB stimulated transcription-repressor. The fourth group carries the names of control proteins and contains most representatives. In this group there are two transcription factors (heat shock transcription factor 2, Zn15) and a transcription factor typical clone (CCCTC binding factor), which is involved in the gene regulation of some well-known oncogenes, e.g. MXC, ARF, PIM1, PLK, Igf2. The Zn-15-cDNA shows also a homology to the H. s. rearranged l-myc fusion cDNA, a construct from the gene RLF and LMYC,

4 9 ( 2 0 1 3 ) e 1 –e 7

which were found with two cell lines of the small cell lung cancer. Also to this group belongs the hypothetical protein KIAA0530, which exhibits a DNA binding-domain in form of a zinc finger motive, and the RARA-protein, a nuclear receptor for retinoacid and gene modulator. Likewise in this group there is the splice factor (squamous cell carcinoma antigen; SART3), which was discovered by CTLs-assays. The last protein in this group is the WDR9-protein. The gene of this core protein is located in the down syndrome critical region-2 on chromosome 21. With the help of its 9WD-Repeats this protein interacts with other proteins and is involved in the gene regulation.

3.4.

Screening with heterologous sera

All positive clones were tested with 10 sera from different squamous cell carcinoma patients and with 10 sera by control persons without tumor disease. With the control sera all clones reacted negatively. In the test of the clones with sera from other patients with squamous cell carcinoma two clones were found positive (KIAA0669, WDR9 protein) and one clone (HSF2) twice (see Table 2). Subsequently, a screening of some positive clones (KIAA0530, WDR9 protein, HSF2 and tank binding kinase) followed with nine sera from patients with different cancer (melanoma, adenocarcinoma, multiple myeloma, leiomyosarkoma, adenoid cystic carcinoma, meningioma, atypical meningioma, lung cancer, glioma). Only the WDR9 protein was found as positive with the sera of a melanoma patient, all other clones in these analysis are squamous cell carcinoma specific.

3.5.

Expression-analysis of HSF2 by RT-PCR

For RT-PCR experiments from different squamous cell carcinomas and from different tissues only the clone X 5.1.1.1. (H. s. heat shock transcription factor 2) was evaluated, since this was found most frequently in our heterologous screening. HSF2 is a transcription factor, which is as heterodimer with HSF1 and responsible for the activation of the heat shock proteins Hsp70 and Hsp90. The mRNA for HSF2 is 2444 bp long and the protein consists of 536 amino acids. The primer sequences were specified from the sequences of the data base with appropriate software. The amplified cDNA was 527 bp long. The RNA for the RT-PCR was extracted from the tumors of the seven patients, with whom the heterologous sera screening were performed. For expression comparison analysis, RT-PCR was performed and compared with primers for the b-actin gene (see Fig. 2).

Table 2 – Positive antigens in the heterologous screening with sera from other squamous cell carcinoma patients and from different tumours Protein

Fig. 1 – Division of the founded antigens their cellular lokalisation.

KIAA0669 HSF2 WDR9

Found in Scc.-sera

Found in melanoma-sera

2· 3· 2·

0 0 1·

EUROPEAN JOURNAL OF CANCER

3.6.

Expression-analysis of HSF2 by in situ-hybridisation

In order to examine the expression and the intracellular distribution of HSF2, in situ hybridisations were performed. Each tumor was hybridized with antisense-probes as well as senseprobes as negative control. Parallel to the in situ hybridization experiments, corresponding hematoxyline–eosine stained slides were made for each patient (see Fig. 3) observed. Observed expression-levels for HSF2 varied from case to case. While in one patient expression levels increased in the tumor in relation to the boundary region, whereas another patient showed an even expression level in the tumor and boundary region. As normal control, the HSF2-probe was hybridized also to specimen from health oral mucosa. Since in the mucous membrane and the epithelial layer in normal tissue is very close, HSF2 antisense-staining appears rather strong, but clearly weaker than in the tumor. No correlation between

4 9 ( 2 0 1 3 ) e 1 –e 7

e5

the presence of antibodies against HSF2 and an increased expression in the tumor could was observed. In situ hybridization showed the distribution of HSF2 in the tumors and the boundary regions. In the tumor 654, which shows a weak expression in RT-PCR, we found HSF2 to be overexpressed in the tumor. In contrast to it there are no differences detectable in the expression level between the tumor and the boundary region in the in situ hybridisation from tumor 656, although this tumor showed a high expression level in the RT-PCR. In mouth mucous membrane, HSF2 is expressed evenly. The tumor of the patient 814, from which the cDNA-library was made, showed a clear overexpression of HSF2. No correlation could be found between the overexpression of HSF2 and the presence of antibodies against HSF2.

3.7.

Sequence analysis of HSF2

The HSF2-cDNA was completely sequenced in four overlapping sequences. In comparison to the data base sequence (ACC No. 680688 nucleotide 1265–1318), 54 nucleotides were missing. This sequence corresponds to the exon 11 and is called splice variant b in the literature.

4.

Fig. 2 – RT-PCR analyses of HSF2 in various head and neck squamous cell carcinomas and normal tissues. From left to right: scc–no. 645, 647, 654, 657, 663, 817, testis, kidney, liver, thymus, skin. Upper row: expression of HSF2; lower row: expression of b-actin.

Discussion

When taking the next step towards a immunology based therapeutic approach in cancer therapy, it has been envisioned that cancer antigens are successfully targeted by the patients own immune response. The remaining task would be to identify them. By using the SEREX technique, Scanlan identified the immunogenic potential of NY-CO-1 and stimulated mouse t-cells with the NY-CO-1. By applying the SEREX technique, numerous immunogenic structures in many tumors, such as melanomas18 or gliomas19 have been characterized so far. These new antigens were divided into nine groups20: cancer/testis antigens; differentiation antigens; antigens due to mutations; splice variants; viral antigens; antigens due to overexpression; antigens, due

Fig. 3 – In situ hybridization with HSF2 antigen on scc. And oral mucosa.

e6

EUROPEAN JOURNAL OF CANCER

to gene amplification; cancer related antigens; cancer independent antigens. With respect to therapeutic applications, most research has so far centered on the group of the cancer/testis antigens, which appears to be most promising in terms of possible clinical applications. In order to detect cancer/testis antigens, the SEREX procedure is frequently modified. cDNA-libraries from testis-tissue were screened with sera from patients suffering from various tumors.21 The advantage of screening testis tissues is based on ist expression of multiple genes that are not expressed anymore in later stages as cells differentiate. So far little do we know about possible antigenic structures that could be utilized for immunotherapeutic approaches in HNSCC.22,10 There are numerous expression studies investigating expression levels of various antigenic structures in HNSCC that were primarily described in other tumors. But no antigen has proven to be a promising target for a clinical study. We tried to characterize tumor antigens in our HNSCC patient collective by using the SEREX method. When compared with other techniques, SEREX has some shortcomings in terms of the prokaryotic expression-system, in which posttranslational changes are undetectable and that mutated antibodies cannot be traced back to a certain protein. But nevertheless it is a straight forward technique for screening multiple patient samples. By screening HNSCC cDNA-libraries with autologous sera, 17 different clones were found and described. All 17 clones had homologies in the gene bank, and six of them were only hypothetical and not yet characterized. The most frequently found antigen was KIAA0530. We found several homologous clones for chest and lung tumors for it in the SEREX database. The KIAA0530-protein is supposed to be a member of the Krueppel family of C2H2-type zinc finger protein and a transcription factor. The gene name for KIAA0530 is ZNF292 and was discovered after sequencing various cDNA-clones and identification of its open reading frame.23 It was furthermore found in a cDNA derived from human brain tissue. Antibodies against it were also found in previous SEREX analyses of breast cancer and HNSCC.10 Vaughan verified KIA0530 in RNA expression studies and found it to be highly expressed in healthy thymus, brain and trachea. In tumors, highest levels were found in the center and 7-fold lower expression levels in the edges. In combination with our results, these data confirm the technique’s reliability, reproducibility and the importance of KIAA0530 in HNSCC. Further investigation on its cellular function is underway. In heterologous screening of our clones with 10 HNSCC sera, we found antibodies against heat shock transcription factor 2 (HSF2) in 3 of 11 sera. HSF2 belonges to the human heat shock transcription factor family, which consist of four members. Heat shock transcription factor 2 and HSF1 are responsible for the activation of the heat shock proteins 70 and 90 (Hsp 70 and Hsp 90) during cellular stress. HSF2 is also involved in certain developmental stages of the cell.24 In contrast to HSF1, HSF2 is activated during certain cell differentiation steps and is reversibly inactivated by heat.25 HSF2 is reported to be activated by blocking of the proteasome,26 which is frequently the case in tumor cells and HSF2 knockout mice show an increased prenatal lethality. However the

4 9 ( 2 0 1 3 ) e 1 –e 7

HSP protein production in HSF2 knockout mice is not disturbed, which points towards an additional regulation mechanism.27 Alternative splicing regularly results in two isoforms of the HSF2 protein. Our cDNA sequence was identified as the b-splice variant of the HSF2-protein and did not show any mutations. In this shorter b-isoform (HSF2B), which was initially found in Hela S3 cells, the DS-domain is missing, which is essential for binding other cofactors.28 In accord with known expressions patterns of HSF2, we found the gene present in all analyzed tissues. Highest expression levels were found in tissue from testis and in skin. In HNSCC’s, no correlation between expression level and tumor stage could was found. By heterologous screening of our clones, we only found one antibody against in sera from patients with tumors other than HNSCC’s. A melanoma patient had antibodies against WDR9. This protein is supposed to be a transcription factor, possesses nine WD-repeats for protein interaction and shows similarities with the mouse neural differentiation protein. The coding gene is a component of the Down-syndrome critical region 2 on the chromosome 21. The protein consists of 2269 amino acids29 and is located in the cell core. In the mouse homologous Wdr9-protein, a transcription-activation domain is described and a role in the chromatin remodeling was therefore postulated.30 Since the WDR9-gene is upregulated in proliferating tissues, a participation in the cell division is likely.29 So far several isoforms with varying length have been identified. With regards to the functional organization antigens identified by SEREX screening in HNSCC’s, two things are particularly noticeable: First of all we only found ubiquitously expressed genes and no cancer/testis antigens. Upon their immunogenity can only be speculated. And second, the associated pathways are located in the nucleus and mostly involve transcription factors. The antigenic pattern of SCC’s in general seems to be highly heterogeneous as no molecular entity can be identified. The multiplicity of the found antigen is nevertheless an indication for the reaction of the immune system to the altered cancerous state. Our efforts will be to correlate the antigens with the clinical outcome and tumor dynamics.

Conflict of interest statement None declared.

R E F E R E N C E S

1. Stafford ND, Ashman JN, MacDonal AW, Ell SR, Monson JR, Greenman J. Genetic analysis of head and neck squamous cell carcinoma and surrounding mucosa. Arch Otolaryngol Head Neck Surg 1999;125(12):1341–8. 2. Wu CL, Sloan P, Read AP, Harris R, Thakker N. Deletion mapping on the short arm of chromosome 3 in squamous cell carcinoma of the oral cavity. Cancer Research 1994;54(24):6484–8. 3. Raja S, Godfrey TE, Luketich JD. The role of tumor suppressor genes in esophageal cancer. Minerva Chir 2002;57(6):767–80.

EUROPEAN JOURNAL OF CANCER

4. Gleich LL, Salamone FN. Molecular genetics of head and neck cancer. Cancer Control 2002;9(5):369–78. 5. Chen YT, Gure AO, Tsang S, et al. Identification of multiple cancer/testis antigens by allogeneic antibody screening of a melanoma cell library. Proc Natl Acad Sci USA 1998;95:6919–23. 6. Bauer C, Diesinger I, Brass N, Steinhart H, Iro H, Messe EU. Translation initiation factor eIF-4G is immunogenic, overexpessed and amplified in patients with squamous cell lung carcinoma. Cancer 2001;92:822–9. 7. Reichardt VL, Brossart P, Kant L. Dendritic cells in vaccination therapies of human malignant disease. Blood Rev 2004;18(4):235–43. 8. Pietersz GA, Apostolopoulos V, McKenzie IF. Generation of cellular immune responses to antigenic tumor peptides. Cell Mol Life Sci 2000;57(2):290–310. 9. Walz A, Mack B, Schmitt B, Gires O, Wollenberg B, Zeidler R. Antitumour effects of a bispecific trivalent antibody in multicellular tumour spheroids. Anticancer Res 2004;24(2B): 887–893. 10. Vaughan H, St Clair F, Scanlan M, Chen YT, Maraskovsky E, Sizeland A, et al. The humoral immune response to head and neck cancer antigens as defined by the serological analysis of tumor antigens by recombinant cDNA expression cloning. Cancer Immunity 2004;4:5. 11. Kienstra M, Neel B, Strome S, Roche P. Identification of NY-ESO-1, MAGE-1, and MAGE-3 in head and neck squamous cell carcinoma. Head Neck:457–63. 12. Gotte K, Usener D, Riedel F, Hormann K, Schadendorf D, Eichmuller S. Tumor-associated antigens as possible targets for immune therapy in head and neck cancer comparative mRNA expression analysis of RAGE and GAGE genes. Acta Otolaryngol 2002;122(5):546–52. 13. Villaret D, Glisson B, Kenady D, et al. A multicenter phase II study of tgDCC-E1A for the intratumoral treatment of patients with recurrent head and neck squamous cell carcinoma. Head Neck 2002;24(7):661–9. 14. Sahin U, Tureci O, Schmitt H, et al. Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci USA 1995;92:11810–3. 15. Parks WT, Frank DB, Huff C, et al. Sorting nexin 6, a novel SNX, interacts with the transforming growth factor-beta family of receptor serine–threonine kinase. J Biol Chem 2001;276(22):19332–9. 16. Leprince C, Le Scolan E, Meunier B, et al. Sorting nexin 4 and amphiphysin 2, a new partnership between endocytosis and intracellular trafficking. J Cell Sci 2003;116:1937–48. 17. Zhang S, Feng Y, Narayan O, Zhao LJ. Cytoplasmic retention of HIV-1 regulatory protein Vpr by protein-protein interaction with a novel human cytoplasmic protein VprBP. Gene 2001;263(1–2):131–40.

4 9 ( 2 0 1 3 ) e 1 –e 7

e7

18. Jager D, Stockert E, Jager E, et al. Serological cloning of a melanocyte rab guanosine 5’-triphosphate-binding protein and a chromosome condensation protein from a melanoma complementary DNA library. Cancer Res 2000;60(13): 3584–3591. 19. Struss AK, Romeike BF, Munnia A, et al. PHF3-specific antibody responses in over 60% of patients with glioblastoma multiforme. Oncogene 2001;20:4107–14. 20. Tureci O, Sahin S, Pfreundschuh M. Serological analysis of human tumor antigens: molecular definition and implication. Mol Med Today 1997;3:342–9. [Review]. 21. Jager D, Unkelbach M, Frei C, et al. Identification of tumor-restricted antigens NY-BR-1, SCP-1, and a new cancer/ testis-like antigen NW-BR-3 by serological screening of a testicular library with breast cancer serum. Cancer Immun 2002;2:5. 22. Monji M, Senju S, Nakatsura T, et al. Head and neck cancer antigens recognized by the humoral immune system. Biochem Biophys Res Commun 2002;294:734–41. 23. Mammalian Gene Collection (MGC) Program Team. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. PNAS 2002;99(26):16899–903. 24. Lee SS, Kwon SH, Sung JS, Han MY, Park YM. Cloning and characterization of the rat Hsf2 promoter: a critical role of proximal E-box element and USF protein in Hsf2 regulation in different compartments of the brain. Biochim Biophys Acta 2003;1625(1):52–63. 25. Mathew A, Mathur SK, Morimoto RI. Stress-specific activation and repression of heat shock factor 1 and 2. Mol Cell Biol 2001;21(21):7163–71. 26. Pritts TA, Hungness ES, Hershko DD, et al. Proteasome inhibitors induce heat shock response and increase IL-6 expression in human intestinal epithelial cells. Am J Physiol Regul Integr Comp Physiol 2002;282:R1016–26. 27. Wang G, Zhang J, Moskophidis D, Mivechi NF. Targeted disruption of the heat shock transcription factor (hsf) 2 gene results in increased embryonic lethality, neuronal defects and reduced spermatogenesis. Genesis 2003;36(1):48–61. 28. He H, Soncin F, Grammatikakis N, et al. Elevated expression of heat shock factor (HSF) 2A stimulates HSF2induced transcription during stress. J Biol Chem 2003;278(37):35465–75. 29. Ramos VC, Vidal-Taboada J, Bergonon S, Egeo A, Fisher EM, Scartezzini P, et al. Characterisation and expression analysis of the WDR9 gene, located in the down critical region-2 of the human chromosome 21. Biochim Biophys Acta 2002;1577:377–83. 30. Huag H, Rambaldi I, Daniels E, Featherstone M. Expression of the Wdr9 gene and protein products during mouse development. Dev Dynam 2003;227(4):608–14.