- Email: [email protected]
Tumor necrosis factor alpha promoter polymorphism studies in pregnant women
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/jrhm
Original Article
Tumor necrosis factor alpha promoter polymorphism studies in pregnant women Imran Ali Khan a,b,c, Vasundhara Kamineni d, Subhadra Poornima a, Parveen Jahan c, Qurratulain Hasan a,b, Pragna Rao e,* a
Department of Genetics and Molecular Medicine, Kamineni Hospitals, LB Nagar, Hyderabad 500068, India Department of Genetics, Vasavi Medical and Research Centre, Lakdikapool, Hyderabad 500004, India c Department of Genetics and Biotechnology, University College of Science, Osmania University, Tarnaka, Hyderabad 500007, India d Department Obstetrics and Gynecology, Kamineni Hospitals, LB Nagar, Hyderabad 500068, India e Department of Biochemistry, Kasturba Medical College, Manipal University, Manipal 576104, Karnataka, India b
article info
abstract
Article history:
Aims: The aim of this study was to explore the possible association between the 850 C/T
Received 19 November 2014
polymorphism in the tumor necrosis factor alpha (TNF-a) gene promoter, and pregnancy-
Accepted 11 January 2015
associated diseases such as gestational diabetes mellitus (GDM) and preeclampsia (PE), in
Available online 21 January 2015
south Indian women. GDM and PE are common complications that occur during pregnancy and are the leading causes of perinatal mortality. To date, the mechanisms that initiate
Keywords:
GDM and PE in humans have remained elusive.
TNF-a
Methods: This prospective case-control study was carried out with 505 pregnant women:
C850T
140 women had GDM, and 105 with PE. Remaining 260 women were age- and frequency-
GDM
matched controls. TNF-a (eC850T) genotyping was determined by polymerase chain re-
PE
action with restriction fragment length polymorphism (PCR-RFLP) analysis.
South Indian population
Result: We found no statistically significant difference in the genotypic and allelic distribution between GDM women and controls (for CT þ TT vs. CC, c2 ¼ 0.3919; p ¼ 0.61; Odds Ratio (OR) ¼ 0.76 (95% CI: 0.203e1.876)). No significant differences was observed in the allele and genotype frequency between PE women and controls (for CT þ TT vs. CC, p ¼ 0.31; OR ¼ 0.55 (95% CI: 0.171e1.784); T vs. C, p ¼ 0.71; OR ¼ 0.94 (95% CI: 0.680e1.3)). Conclusion: From our results, we conclude that the (eC850T) promoter polymorphism has no role in the propensity of pregnant women from south Indian populations to develop GDM or PE. Copyright © 2015, Reed Elsevier India Pvt. Ltd. All rights reserved.
* Corresponding author. E-mail address: [email protected] (P. Rao). http://dx.doi.org/10.1016/j.jrhm.2015.01.001 2214-420X/Copyright © 2015, Reed Elsevier India Pvt. Ltd. All rights reserved.
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
1.
Introduction
Gestational Diabetes Mellitus (GDM) and preeclampsia (PE) are multifactorial and severe, complicated disorders of human pregnancy, which cause maternal, as well as perinatal morbidity and mortality.1 GDM and PE are relatively common diseases and affect ~16% of all pregnancies, resulting in a variety of complications that primarily affect the fetus, including macrosomia, stillbirth, jaundice, and respiratory distress syndrome. The relationships and genetic background predisposing pregnant women to GDM and PE are still not clear.2e4 GDM is characterized by a carbohydrate intolerance of variable severity that develops during pregnancy when the pregnancy hormones interfere with the body's ability to use insulin, the hormone that modulates glucose uptake into cells. As a result, glucose levels in the bloodstream become elevated.5 PE is a hypertensive disorder associated with elevated blood pressure and proteinuria that frequently develops after 20 weeks of gestation.6 The common risk factors for GDM and PE include obesity, increased maternal age, a history of GDM/PE, previous adverse pregnancy outcomes, and a high-risk ethnicity. Both the diseases are serious threats to the mother and the child. Single-nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-a) promoter gene can regulate plasma levels of TNF-a, and the action of insulin.7,8 However, these findings are not supported by some studies.9,10 Kato et al11 first reported a base substitution of C/T at position 850 of the promoter region of human TNF-a in 1999. TNF-a is a multifunctional cytokine produced mainly by macrophages and lymphocytes, as well as in pregnancy by trophoblast cells. It is a pro-inflammatory cytokine involved in the pathogenesis of various autoimmune and inflammatory diseases,12 and has been implicated in mediating insulin resistance.13 The polymorphisms in the promoter region are found at positions 1032, 863, 857, 850, 575, 375, 308, 274, 243, 237 and 162.14e16 There are two promoter transition polymorphisms (eG308A and eC850T) that have been associated with chronic inflammatory diseases such as ulcerative colitis, rheumatoid arthritis, PE, and Crohn's disease.17 One such SNP, the 805 C/T polymorphism, is located at position 805 in the promoter region of the TNF-a gene and has been selected for this study. It was recently suggested that TNF-a may play an important role in apoptosis and obesity-related metabolic disorders such as insulin resistance, disturbance of lipid metabolism, and hypercoagulability, and may be one of the mediators of atherosclerosis.18 TNF-a therefore may play an important role in the pathophysiology of multifactorial diseases like GDM and PE. Previously, investigators have focused on several new potential mediators of insulin resistance, which have a key role in the development of GDM, including the cytokine (TNF-a).19,20 There is a lot of evidence that suggests a relationship between PE and TNF-a. Increased serum TNF-a activity has been identified in PE.21 The main objective of this case-control study was to identify the association between TNF-a (850C > T) gene promoter polymorphism (rs1799724) and south Indian pregnant women who develop GDM and PE.
2.
Materials and methods
2.1.
Pregnant women study
19
A case-control study was conducted in 505 pregnant women from the south Indian population; this included patients diagnosed with GDM (n ¼ 140) and hypertension (PE) (n ¼ 105) during pregnancy. All control pregnant women (n ¼ 260) were recruited from the same demographic area based upon age and normal glucose, systolic blood pressure (SBP) and diastolic blood pressure (DBP) values. This study was carried out in the Kamineni Hospitals, Hyderabad, India. The exclusion criteria for GDM were, women with a diagnosis of diabetes prior to pregnancy, and for PE women, those with chronic hypertension. The study was approved by the Ethics Committee of Kamineni Hospital, Hyderabad. Written informed consent was obtained from all the pregnant women who participated in this study.
2.2.
Validation of GDM women
GDM subjects were selected based on the results of glucose tests. All the pregnant women were screened for GDM between 24 and 28 weeks of gestation, as per the American Diabetes Association (ADA) guidelines.22 A glucose challenge test (GCT) was performed by administering 50 g of glucose to pregnant women whose fasting plasma glucose value exceeded 130 mg/dL. The GCT positive women underwent a standard oral glucose tolerance test (OGTT) involving the administration of 100 g of glucose after overnight fasting and three days of unrestricted diet. Blood samples were drawn during fasting, 1, 2, and 3 h after glucose administration. In this study, women were classified as GDM when two or more glucose values met or exceeded the threshold values that were established in our earlier studies.23 All women with GDM were monitored for metabolic and obstetric manifestations and the need for either a supplementary treatment with insulin or for a controlled diet until delivery.24
2.3.
Diagnostic criteria for PE women
PE was diagnosed based on two consecutive measurements of systolic and diastolic blood pressure taken, after the 20th week of pregnancy, at least 6 h apart. Increase in diastolic blood pressure to >110 mmHg or a rise of 15e30 mmHg above the normal pre-pregnancy values indicates PE. This could be accompanied with 300 mg protein in the 24 h urine specimen or urine dipstick >1þ.25,26
2.4.
DNA isolation and genotyping
For confirmation of the disease, serum from blood (3 mL) was collected from the GDM women (and from the control women, for comparison), and 2 ml of blood sample collected in EDTA vial was used to extract genomic DNA following salting out method.23 The DNA was stored at 20 C until processed. TNFa genotypes were identified by polymerase chain reaction, followed by restriction fragment length polymorphism (PCRRFLP) analysis, as previously described for the 850C > T
20
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
polymorphism.17 The primers used for the amplification of the TNF-a bearing the polymorphism C850T were forward: and reverse: 50 ATGGCACTCTGTAGGACTGCT30 50 GTCTCAGCTCACGATCACCAT3'. The amplified products were digested with HincII restriction enzyme ([rs1799724]850 C > T polymorphism) by incubating at 37 C for 16 h, followed by separating the fragments on 2% agarose gel containing ethidium bromide, and visualizing under ultraviolet light. HincII restriction enzyme was purchased from Fermentas (Hannover, MD, USA). Wild-type (CC) genotypes showed the presence of fragments of 140 base pairs (bp), heterozygous (CT) genotypes showed fragments of 140 bp, 120 bp and 20 bp, and variant (TT) genotypes showed fragments of 120 bp and 20 bp.
2.5.
Statistical analysis
Clinical data are expressed as mean ± standard deviation (SD). HardyeWeinberg equilibrium (HWE) was tested for both GDM and PE with the TNF-a gene polymorphism. The association between genotypes and cases was examined by odds ratio (OR) with 95% confidence interval (CI), obtained using Fisher's exact test and 95% confidence intervals obtained using SPSS version 19.0 software (SPSS, Chicago, USA). Significance was set at p < 0.05. Allelic frequencies were calculated according to the number of different alleles observed and the total number of alleles examined.
3.
Results
3.1.
Clinical analysis
In the present study, the TNF-a promoter polymorphism was analyzed in pregnant women without (n ¼ 260), with GDM (n ¼ 140) and with PE (n ¼ 105). Clinical details of the pregnant women's are tabulated in Table 1. Patients (i.e., GDM and PE) were matched for ages, with the control group. SBP and DBP were significantly different between PE cases and controls (p ¼ 0.0001). Fasting Blood Sugar (FBS) and Post prandial blood glucose (PPBG) values were found to be significantly different between the GDM cases and control subjects (p < 0.05). However, 45% of individuals managed diabetes with appropriate
diet and exercise, while 55% of the patients required 4e8 units of insulin for the entire antenatal period.
3.2.
Genetic association
The genotypic and allelic distributions of TNF-a polymorphism for GDM and PE cases, and for controls are shown in Table 2. All genotype distributions in the GDM and PE cases were in accordance with the HWE among the controls. We found no significant association/distribution between the GDM and controls [for TT vs. CT, c2 ¼ 0.3670; p ¼ 0.36; OR ¼ 0.76 (95% CI: 0.434e1.361); CT þ TT vs. CC, c2 ¼ 0.3919; p ¼ 0.61; OR ¼ 0.76 (95% CI: 0.203e1.876)]. There was no significance difference observed in the frequency of the T and C allele between GDM patients and the control group [c2 ¼ 0.4638; p ¼ 0.46; OR ¼ 0.89 (95% CI: 0.668e1.201)] (Table 3). We found that none of the genotypes and alleles were significantly associated between the PE cases and controls [for TT vs. CT, c2 ¼ 0.8998; p ¼ 0.89; OR ¼ 0.96 (95% CI: 0.527e1.754); CT þ TT vs. CC, c2 ¼ 0.3183; p ¼ 0.31; OR ¼ 0.55 (95% CI: 0.171e1.784; T vs. C, c2 ¼ 0.7106; p ¼ 0.71; OR ¼ 0.94 (95% CI: 0.680e1.3)]. The power and sample size calculation were found to be 55%.
4.
Discussion
The aim of the present study was to estimate allele and genotype frequencies of the eC850T polymorphism and pregnancy associated diseases; GDM and PE in the south Indian population. The present study is the first to appraise the distribution of the TNF-a (rs1799724) transition polymorphism in GDM women from the Asian Indian population, and we simultaneously conducted this assessment with PE patients from the same population. The transition C850T substitution in the promoter region of the TNF-a gene was not significant for the two diseases. This study was carried out among GDM and PE patients with normal controls for comparison of results with GDM Vs Controls and PE Vs controls. The results of our study do not demonstrate any association of the TNF-a polymorphism with GDM and PE when compared with the controls in our study population. GDM is a heterogeneous and chronic metabolic disorder characterized by insulin resistance and pancreatic b-cell
Table 1 e Clinical characteristics of pregnant women. S.No 1 2 3 4 5 6 7 8 9 10
Profiles
Controls (n ¼ 260)
GDM (n ¼ 140)
p value
PE (n ¼ 105)
p value
Age (Years) Weight (kg) BMI (kg/m2) Mean Gestational Age FBS (mg/dL) PPBG (mg/dL) SBP (mmHg) DBP (mmHg) Family history Insulin/Diet (Rx)
17e36 (27.8 ± 4.41) 57.4 ± 6.86 24.6 ± 3.64 NA 83.2 ± 10.37 112.0 ± 39.70 119 79 133 (51.1%) NA
22e38 (29.1 ± 4.46) 69.2 ± 10.43 27.0 ± 3.93 24.9 ± 5.01 121.9 ± 13.21 158.8 ± 47.76 NA NA 84 (60%) 77(55%)/63(45%)
0.86 0.0001 0.29 NA 0.0008 0.001 NA NA 0.03 NA
22e38 (28.9 ± 4.5) 51.2 ± 6.26 27.1 ± 3.9 24.1 ± 4.9 NA NA 158 101 NA NA*
0.64 0.28 0.59 NA NA NA 0.0001 0.0001 NA* NA*
NA ¼ Not analyzed/Not applicable. NA ¼ Not analyzed/Not applicable*.
21
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
Table 2 e Genotype and allele frequencies of the study population. Controls (n ¼ 260)
rs1799724 Genotype and allele CC CT TT C T a
7 206 47 220 300
GDM cases (n ¼ 140) n (%) 6 (4.3) 114 (81.4) 20 (14.3) 126 (0.45) 154 (0.55)
(2.7) (79.2) (18.1) (0.42) (0.58)
p valuea
0.43
0.46
PE cases (n ¼ 105) 5 (4.8) 82 (78.1) 18 (17.1) 92 (0.49) 118 (0.51)
p valuea
0.32
0.71
Chi-square p value.
dysfunction, which involves defects in various molecular pathways.27,28 In previous studies, candidate genes involved in the signaling pathways of insulin, glucose, and the differentiation of adipocytes have been reported, only a few of these polymorphisms are associated with T2DM in different populations.29 The results obtained show that the frequency of SNP in position 805 in the promoter region of human TNF-a between control and GDM subjects was not significantly different. Further, there was no difference between control and GDM groups in terms of genotype at this site (805). It can therefore be concluded that the SNP at position 805 in the promoter region of the human TNF-a gene is not associated with the development/incidence of GDM. Montazeri et al20 carried out TNF-a (308) gene polymorphism studies in GDM women and concluded that TNF-a had no role in the development of the disease in the Malaysian population. The same group has carried out the TNF-a (308) gene polymorphism study in a different region of Malaysia (Seremban), and the results are subsidiary to the earlier studies (p > 0.05).30 Thus, our results occur with the findings from several earlier studies. PE is a common complex disease with both genetic and environmental components, including impaired maternal immune response and different aspects of metabolic syndromes, such as insulin resistance, obesity, and dyslipidemia.31 There is increasing evidence showing that cytokines may be involved in the pathogenesis of PE.12,32e34 The allele frequency of T in the PE patient group (0.51%) was lower than in the control group (0.58). The frequencies of CT and TT genotypes were also lower in the PE group. Several studies have reported a high occurrence of the TNF-a eC850T polymorphism among pregnant women with PE.35 While, Zhao et al36 carried out their studies in the Chinese population, they concluded that the T allele was a protective factor against the development of the disease. Other studies have found similar results to us, in which the disease is not associated.37 There
Table 3 e Statistical analysis for GDM and PE. Disease Risk allele GDM
T
PE
T
Model Additive Recessive Dominant Allele Additive Recessive Dominant Allele
Odds ratio (95%CI) p value 1.14 0.75 0.61 0.89 0.93 0.93 0.55 0.94
(0.68, 1.93) (0.42, 1.33) (0.20, 1.87) (0.66, 1.20) (0.53, 1.62) (0.51, 1.70) (0.17, 1.78) (0.68, 1.30)
0.60 0.33 0.39 0.46 0.80 0.83 0.31 0.71
are several studies have been carried out with 308 promoter polymorphism with PE and the results indicate both positive and negative associations.1,31,38,39 The protective effect of the 850 locus in diabetic (GDM) and hypertensive (PE) disorders that complicate pregnancy are fully understood. The present study showed that this locus might alter the transcriptional activity of TNF-a mRNA, and thereby decrease the production of TNF-a mRNA. The exact mechanism awaits further study.36 There were two marked inadequacies in the present study. Firstly, the subjects were randomly recruited from a specific geographical niche without any specific reference to their ethnicity. Further, the gestational age for control samples were not recorded. Nevertheless, we summarize from the results of the present study that SNP in the promoter polymorphism (850C > T) in the TNF-a gene cannot be considered as an independent risk factor as a predictor for the development of GDM/PE in our subjects.
Conflicts of interest All authors have none to declare.
Acknowledgment We are gratified to Indian Council for Medical Research for the funding of this work (Sanction no.5-3-8-39-2007; RHN). Gratitude is expressed to all the pregnancy women who has supported this study with their participation.
references
1. Molvarec A, Jermendy A, Kovacs M, Prohaszka Z, Rigo Jr J. Toll-like receptor 4 gene polymorphisms and preeclampsia: lack of association in a Caucasian population. Hypertens Res. 2008;31:859e864. 2. Kumar L, Chaurasiya OS, Jian G, Nath D, Shobhne HJ. The evaluation of cord blood magnesium level in neonates of magnesium sulphate treated pre-eclamptic/eclamptic mothers and its clinical correlation. PJSR. 2013;6:16e19. 3. Bhat M, K N R, Sarma SP, Menon S, C V S, GK S. Determinants of gestational diabetes mellitus: a case control study in a district tertiary care hospital in south India. Int J Diabetes Dev Ctries. 2010;30:91e96.
22
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
4. Bryson CL, Ioannou GN, Rulyak SJ, Critchlow C. Association between gestational diabetes and pregnancy-induced hypertension. Am J Epidemiol. 2003;158:1148e1153. 5. Zhang C, Bao W, Rong Y, et al. Genetic variants and the risk of gestational diabetes mellitus: a systematic review. Hum Reprod Update. 2003;19:376e390. 6. Yelumalai S, Muniandy S, Zawiah Omar S, Qvist R. Pregnancy-induced hypertension and preeclampsia: levels of angiogenic factors in Malaysian women. J Clin Biochem Nutr. 2010;47:191e197. 7. Fernandez-Real JM, Gutierrez C, Ricart W. The TNF-alpha gene NcoI polymorphism influences the relationship among insulin resistance, percent body fat, and increased serum leptin levels. Diabetes. 1997;46:1468e1472. 8. Dalzeil B, Gosby AK, Richman RM. Association of the TNFalpha -308 G/A promoter polymorphism with insulin resistance in obesity. Obes Res. 2002;10:401e407. 9. Koch M, Rett A, Volk E. The tumour necrosis factor alpha -238 G–> A and -308 G–> A promoter polymorphisms are not associated with insulin sensitivity and insulin secretion in young healthy relatives of Type II diabetic patients. Diabetologia. 2000;43:181e184. 10. Rasmussen SK, Urhammer SA, Jensen JN. The -238 and -308 G–>A polymorphisms of the tumor necrosis factor alpha gene promoter are not associated with features of the insulin resistance syndrome or altered birth weight in Danish Caucasians. J Clin Endocrinol Metab. 2000;85:1731e1734. 11. Kato K, Ijiri R, Tanaka Y. Nasal chondromesenchymal hamartoma of infancy: the first Japanese case report. Pathol Int. 1999;49:731e1736. 12. Chan JC, Cheung JC, Stehouwer CD. The central roles of obesity-associated dyslipidaemia, endothelial activation and cytokines in the Metabolic Syndrome e an analysis by structural equation modelling. Int J Obes Relat Metab Disord. 2002;26:994e1008. 13. Dandona P, Weinstock R, Thusu K. Tumor necrosis factoralpha in sera of obese patients: fall with weight loss. J Clin Endocrinol Metab. 1998;83:2907e2910. 14. Allen RD. Polymorphism of the human TNF-alpha promoter random variation or functional diversity? Mol Immunol. 1999;36:1017e1027. 15. Wilson AG, Symons JA, McDowell TL. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci U S A. 1997;94:3195e3199. 16. Teramoto M, Kitawaki J, Koshiba H. Genetic contribution of tumor necrosis factor (TNF)-alpha gene promoter (-1031, -863 and -857) and TNF receptor 2 gene polymorphisms in endometriosis susceptibility. Am J Reprod Immunol. 2004;51:352e357. 17. Lakshmi KV, Shetty P, Vottam K. Tumor necrosis factor alpha-C850T polymorphism is significantly associated with endometriosis in Asian Indian women. Fertil Steril. 2010;94:453e456. 18. Cho HC, Yu G, Lee MY. TNF-a polymorphisms and coronary artery disease: association study in the Korean population. Cytokine. 2013;62:104e109. 19. Havel PJ. Control of energy homeostasis and insulin action by adipocyte hormones: leptin, acylation stimulating protein, and adiponectin. Curr Opin Lipidol. 2002;13:51e59. 20. Montazeri S, Nalliah S, Radhakrishnan AK. Association between polymorphisms in human tumor necrosis factor alpha (e308) and-beta (252) genes and development of gestational diabetes mellitus. Diabetes Res Clin Pract. 2010;88:139e145. 21. Rinehart BK, Terrone DA, Lagoo-Deenadayalan S. Expression of the placental cytokines tumor necrosis factor alpha,
22. 23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33. 34.
35.
36.
37.
38.
39.
interleukin 1beta, and interleukin 10 is increased in preeclampsia. Am J Obstet Gynecol. 1999;181:915e920. American Diabetes Association, Diagnosis and Classification of Diabetes Mellitus. vol. 34. 2011:S62eS69. Khan IA, Shaik NA, Pasupuleti P, Chava S, Jahan P, Hasan Q, Rao P. Screening of mitochondrial mutations and insertiondeletion polymorphisms in gestational diabetes mellitus in Asian Indians. Saud J Bio Sci. 2015. http://dx.doi.org/10.1016/ j.sjbs.2014.11.001. Pappa KI, Gazouli M, Anastasiou E. The major circadian pacemaker ARNT-like protein-1 (BMAL1) is associated with susceptibility to gestational diabetes mellitus. Diabetes Res Clin Pract. 2013;99:151e157. Irinyenikan TA, Roberts OA, Arowojolu A. Serum lipid levels in pregnant normotensive and gestational hypertensive women in Ibadan, Nigeria. Ann Biol Res. 2013;4:204e208. Aggarwal S, Dimri N, Tandon I. Preeclampsia in North Indian women: the contribution of genetic polymorphisms. J Obstet Gynaecol Res. 2011;37:1335e1341. Bao XY, Xie C, Yang MS. Association between type 2 diabetes and CDKN2A/B: a meta-analysis study. Mol Bio Rep. 2012;39:1609e1616. Matharoo K, Arora P, Bhanwer AJ. Association of adiponectin (AdipoQ) and sulphonylurea receptor (ABCC8) gene polymorphism with Type 2 Diabetes in North Indian population of Punjab. Gene. 2013;527:228e234. Martinez-Gomez LE, Cruz M, Martinez-Nava GA, MadridMarina V. A replication study of the IRS1, CAPN 10, TCF7L2 and PPARG gene polymorphisms associated with type 2 diabetes in two different populations of Mexico. Ann Hum Genet. 2011;75:612e620. Montazeri S, Nalliah S, Radhakrishnan AK. Is there a genetic variation association in the IL-10 and TNF alpha promoter gene with gestational diabetes mellitus? Hereditas. 2010;147:94e102. Vural P, Degirmencioglu S, Saral NY. Tumor necrosis factor alpha, interleukin-6 and interleukin-10 polymorphisms in preeclampsia. J Obstet Gynaecol Res. 2010;36:64e71. Kilpatrick DC. HLA-dependent TNF secretory response may provide an immunogenetic link between pre-eclampsia and type 1 diabetes mellitus. Dis Markers. 1996;13:43e47. Clark P, Boswell F, Greer IA. The neutrophil and preeclampsia. Semin Reprod Endocrinol. 1998;16:57e64. Benyo DF, Miles TM, Conrad KP. Hypoxia stimulates cytokine reproduction by villous explants from the human placenta. J Clin Endocrinol Metab. 1997;82:1582e1588. Stuber F. Effects of genomic polymorphisms on the course of sepsis: is there a concept for gene therapy? J Am Soc Nephrol. 2001;12:S60eS64. Zhao Y, Xia S, Zou L. The association between polymorphism of TNF-alpha gene and hypertensive disorder complicating pregnancy. J Huazhong Univ Sci Technolog Med Sci. 2007;27:729e732. Canto-Cetina T, Canizales-Quinteros S, de la Chesnaye E. Analysis of C-850T and G-308A polymorphisms of the tumor necrosis factor-alpha gene in Maya-Mestizo women with preeclampsia. Hypertens Pregnancy. 2007;26:283e291. Ros HS, Cnattingius S, Lipworth L. Comparison of risk factors for preeclampsia and gestational hypertension in a population-based cohort study. Am J Epidemiol. 1998;147:1062e1070. Stonek F, Bentz EK, Hafner E. A tumor necrosis factor-alpha promoter polymorphism and pregnancy complications: results of a prospective cohort study in 1652 pregnant women. Reprod Sci. 2007;14:425e429.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/jrhm
Original Article
Tumor necrosis factor alpha promoter polymorphism studies in pregnant women Imran Ali Khan a,b,c, Vasundhara Kamineni d, Subhadra Poornima a, Parveen Jahan c, Qurratulain Hasan a,b, Pragna Rao e,* a
Department of Genetics and Molecular Medicine, Kamineni Hospitals, LB Nagar, Hyderabad 500068, India Department of Genetics, Vasavi Medical and Research Centre, Lakdikapool, Hyderabad 500004, India c Department of Genetics and Biotechnology, University College of Science, Osmania University, Tarnaka, Hyderabad 500007, India d Department Obstetrics and Gynecology, Kamineni Hospitals, LB Nagar, Hyderabad 500068, India e Department of Biochemistry, Kasturba Medical College, Manipal University, Manipal 576104, Karnataka, India b
article info
abstract
Article history:
Aims: The aim of this study was to explore the possible association between the 850 C/T
Received 19 November 2014
polymorphism in the tumor necrosis factor alpha (TNF-a) gene promoter, and pregnancy-
Accepted 11 January 2015
associated diseases such as gestational diabetes mellitus (GDM) and preeclampsia (PE), in
Available online 21 January 2015
south Indian women. GDM and PE are common complications that occur during pregnancy and are the leading causes of perinatal mortality. To date, the mechanisms that initiate
Keywords:
GDM and PE in humans have remained elusive.
TNF-a
Methods: This prospective case-control study was carried out with 505 pregnant women:
C850T
140 women had GDM, and 105 with PE. Remaining 260 women were age- and frequency-
GDM
matched controls. TNF-a (eC850T) genotyping was determined by polymerase chain re-
PE
action with restriction fragment length polymorphism (PCR-RFLP) analysis.
South Indian population
Result: We found no statistically significant difference in the genotypic and allelic distribution between GDM women and controls (for CT þ TT vs. CC, c2 ¼ 0.3919; p ¼ 0.61; Odds Ratio (OR) ¼ 0.76 (95% CI: 0.203e1.876)). No significant differences was observed in the allele and genotype frequency between PE women and controls (for CT þ TT vs. CC, p ¼ 0.31; OR ¼ 0.55 (95% CI: 0.171e1.784); T vs. C, p ¼ 0.71; OR ¼ 0.94 (95% CI: 0.680e1.3)). Conclusion: From our results, we conclude that the (eC850T) promoter polymorphism has no role in the propensity of pregnant women from south Indian populations to develop GDM or PE. Copyright © 2015, Reed Elsevier India Pvt. Ltd. All rights reserved.
* Corresponding author. E-mail address: [email protected] (P. Rao). http://dx.doi.org/10.1016/j.jrhm.2015.01.001 2214-420X/Copyright © 2015, Reed Elsevier India Pvt. Ltd. All rights reserved.
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
1.
Introduction
Gestational Diabetes Mellitus (GDM) and preeclampsia (PE) are multifactorial and severe, complicated disorders of human pregnancy, which cause maternal, as well as perinatal morbidity and mortality.1 GDM and PE are relatively common diseases and affect ~16% of all pregnancies, resulting in a variety of complications that primarily affect the fetus, including macrosomia, stillbirth, jaundice, and respiratory distress syndrome. The relationships and genetic background predisposing pregnant women to GDM and PE are still not clear.2e4 GDM is characterized by a carbohydrate intolerance of variable severity that develops during pregnancy when the pregnancy hormones interfere with the body's ability to use insulin, the hormone that modulates glucose uptake into cells. As a result, glucose levels in the bloodstream become elevated.5 PE is a hypertensive disorder associated with elevated blood pressure and proteinuria that frequently develops after 20 weeks of gestation.6 The common risk factors for GDM and PE include obesity, increased maternal age, a history of GDM/PE, previous adverse pregnancy outcomes, and a high-risk ethnicity. Both the diseases are serious threats to the mother and the child. Single-nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-a) promoter gene can regulate plasma levels of TNF-a, and the action of insulin.7,8 However, these findings are not supported by some studies.9,10 Kato et al11 first reported a base substitution of C/T at position 850 of the promoter region of human TNF-a in 1999. TNF-a is a multifunctional cytokine produced mainly by macrophages and lymphocytes, as well as in pregnancy by trophoblast cells. It is a pro-inflammatory cytokine involved in the pathogenesis of various autoimmune and inflammatory diseases,12 and has been implicated in mediating insulin resistance.13 The polymorphisms in the promoter region are found at positions 1032, 863, 857, 850, 575, 375, 308, 274, 243, 237 and 162.14e16 There are two promoter transition polymorphisms (eG308A and eC850T) that have been associated with chronic inflammatory diseases such as ulcerative colitis, rheumatoid arthritis, PE, and Crohn's disease.17 One such SNP, the 805 C/T polymorphism, is located at position 805 in the promoter region of the TNF-a gene and has been selected for this study. It was recently suggested that TNF-a may play an important role in apoptosis and obesity-related metabolic disorders such as insulin resistance, disturbance of lipid metabolism, and hypercoagulability, and may be one of the mediators of atherosclerosis.18 TNF-a therefore may play an important role in the pathophysiology of multifactorial diseases like GDM and PE. Previously, investigators have focused on several new potential mediators of insulin resistance, which have a key role in the development of GDM, including the cytokine (TNF-a).19,20 There is a lot of evidence that suggests a relationship between PE and TNF-a. Increased serum TNF-a activity has been identified in PE.21 The main objective of this case-control study was to identify the association between TNF-a (850C > T) gene promoter polymorphism (rs1799724) and south Indian pregnant women who develop GDM and PE.
2.
Materials and methods
2.1.
Pregnant women study
19
A case-control study was conducted in 505 pregnant women from the south Indian population; this included patients diagnosed with GDM (n ¼ 140) and hypertension (PE) (n ¼ 105) during pregnancy. All control pregnant women (n ¼ 260) were recruited from the same demographic area based upon age and normal glucose, systolic blood pressure (SBP) and diastolic blood pressure (DBP) values. This study was carried out in the Kamineni Hospitals, Hyderabad, India. The exclusion criteria for GDM were, women with a diagnosis of diabetes prior to pregnancy, and for PE women, those with chronic hypertension. The study was approved by the Ethics Committee of Kamineni Hospital, Hyderabad. Written informed consent was obtained from all the pregnant women who participated in this study.
2.2.
Validation of GDM women
GDM subjects were selected based on the results of glucose tests. All the pregnant women were screened for GDM between 24 and 28 weeks of gestation, as per the American Diabetes Association (ADA) guidelines.22 A glucose challenge test (GCT) was performed by administering 50 g of glucose to pregnant women whose fasting plasma glucose value exceeded 130 mg/dL. The GCT positive women underwent a standard oral glucose tolerance test (OGTT) involving the administration of 100 g of glucose after overnight fasting and three days of unrestricted diet. Blood samples were drawn during fasting, 1, 2, and 3 h after glucose administration. In this study, women were classified as GDM when two or more glucose values met or exceeded the threshold values that were established in our earlier studies.23 All women with GDM were monitored for metabolic and obstetric manifestations and the need for either a supplementary treatment with insulin or for a controlled diet until delivery.24
2.3.
Diagnostic criteria for PE women
PE was diagnosed based on two consecutive measurements of systolic and diastolic blood pressure taken, after the 20th week of pregnancy, at least 6 h apart. Increase in diastolic blood pressure to >110 mmHg or a rise of 15e30 mmHg above the normal pre-pregnancy values indicates PE. This could be accompanied with 300 mg protein in the 24 h urine specimen or urine dipstick >1þ.25,26
2.4.
DNA isolation and genotyping
For confirmation of the disease, serum from blood (3 mL) was collected from the GDM women (and from the control women, for comparison), and 2 ml of blood sample collected in EDTA vial was used to extract genomic DNA following salting out method.23 The DNA was stored at 20 C until processed. TNFa genotypes were identified by polymerase chain reaction, followed by restriction fragment length polymorphism (PCRRFLP) analysis, as previously described for the 850C > T
20
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
polymorphism.17 The primers used for the amplification of the TNF-a bearing the polymorphism C850T were forward: and reverse: 50 ATGGCACTCTGTAGGACTGCT30 50 GTCTCAGCTCACGATCACCAT3'. The amplified products were digested with HincII restriction enzyme ([rs1799724]850 C > T polymorphism) by incubating at 37 C for 16 h, followed by separating the fragments on 2% agarose gel containing ethidium bromide, and visualizing under ultraviolet light. HincII restriction enzyme was purchased from Fermentas (Hannover, MD, USA). Wild-type (CC) genotypes showed the presence of fragments of 140 base pairs (bp), heterozygous (CT) genotypes showed fragments of 140 bp, 120 bp and 20 bp, and variant (TT) genotypes showed fragments of 120 bp and 20 bp.
2.5.
Statistical analysis
Clinical data are expressed as mean ± standard deviation (SD). HardyeWeinberg equilibrium (HWE) was tested for both GDM and PE with the TNF-a gene polymorphism. The association between genotypes and cases was examined by odds ratio (OR) with 95% confidence interval (CI), obtained using Fisher's exact test and 95% confidence intervals obtained using SPSS version 19.0 software (SPSS, Chicago, USA). Significance was set at p < 0.05. Allelic frequencies were calculated according to the number of different alleles observed and the total number of alleles examined.
3.
Results
3.1.
Clinical analysis
In the present study, the TNF-a promoter polymorphism was analyzed in pregnant women without (n ¼ 260), with GDM (n ¼ 140) and with PE (n ¼ 105). Clinical details of the pregnant women's are tabulated in Table 1. Patients (i.e., GDM and PE) were matched for ages, with the control group. SBP and DBP were significantly different between PE cases and controls (p ¼ 0.0001). Fasting Blood Sugar (FBS) and Post prandial blood glucose (PPBG) values were found to be significantly different between the GDM cases and control subjects (p < 0.05). However, 45% of individuals managed diabetes with appropriate
diet and exercise, while 55% of the patients required 4e8 units of insulin for the entire antenatal period.
3.2.
Genetic association
The genotypic and allelic distributions of TNF-a polymorphism for GDM and PE cases, and for controls are shown in Table 2. All genotype distributions in the GDM and PE cases were in accordance with the HWE among the controls. We found no significant association/distribution between the GDM and controls [for TT vs. CT, c2 ¼ 0.3670; p ¼ 0.36; OR ¼ 0.76 (95% CI: 0.434e1.361); CT þ TT vs. CC, c2 ¼ 0.3919; p ¼ 0.61; OR ¼ 0.76 (95% CI: 0.203e1.876)]. There was no significance difference observed in the frequency of the T and C allele between GDM patients and the control group [c2 ¼ 0.4638; p ¼ 0.46; OR ¼ 0.89 (95% CI: 0.668e1.201)] (Table 3). We found that none of the genotypes and alleles were significantly associated between the PE cases and controls [for TT vs. CT, c2 ¼ 0.8998; p ¼ 0.89; OR ¼ 0.96 (95% CI: 0.527e1.754); CT þ TT vs. CC, c2 ¼ 0.3183; p ¼ 0.31; OR ¼ 0.55 (95% CI: 0.171e1.784; T vs. C, c2 ¼ 0.7106; p ¼ 0.71; OR ¼ 0.94 (95% CI: 0.680e1.3)]. The power and sample size calculation were found to be 55%.
4.
Discussion
The aim of the present study was to estimate allele and genotype frequencies of the eC850T polymorphism and pregnancy associated diseases; GDM and PE in the south Indian population. The present study is the first to appraise the distribution of the TNF-a (rs1799724) transition polymorphism in GDM women from the Asian Indian population, and we simultaneously conducted this assessment with PE patients from the same population. The transition C850T substitution in the promoter region of the TNF-a gene was not significant for the two diseases. This study was carried out among GDM and PE patients with normal controls for comparison of results with GDM Vs Controls and PE Vs controls. The results of our study do not demonstrate any association of the TNF-a polymorphism with GDM and PE when compared with the controls in our study population. GDM is a heterogeneous and chronic metabolic disorder characterized by insulin resistance and pancreatic b-cell
Table 1 e Clinical characteristics of pregnant women. S.No 1 2 3 4 5 6 7 8 9 10
Profiles
Controls (n ¼ 260)
GDM (n ¼ 140)
p value
PE (n ¼ 105)
p value
Age (Years) Weight (kg) BMI (kg/m2) Mean Gestational Age FBS (mg/dL) PPBG (mg/dL) SBP (mmHg) DBP (mmHg) Family history Insulin/Diet (Rx)
17e36 (27.8 ± 4.41) 57.4 ± 6.86 24.6 ± 3.64 NA 83.2 ± 10.37 112.0 ± 39.70 119 79 133 (51.1%) NA
22e38 (29.1 ± 4.46) 69.2 ± 10.43 27.0 ± 3.93 24.9 ± 5.01 121.9 ± 13.21 158.8 ± 47.76 NA NA 84 (60%) 77(55%)/63(45%)
0.86 0.0001 0.29 NA 0.0008 0.001 NA NA 0.03 NA
22e38 (28.9 ± 4.5) 51.2 ± 6.26 27.1 ± 3.9 24.1 ± 4.9 NA NA 158 101 NA NA*
0.64 0.28 0.59 NA NA NA 0.0001 0.0001 NA* NA*
NA ¼ Not analyzed/Not applicable. NA ¼ Not analyzed/Not applicable*.
21
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
Table 2 e Genotype and allele frequencies of the study population. Controls (n ¼ 260)
rs1799724 Genotype and allele CC CT TT C T a
7 206 47 220 300
GDM cases (n ¼ 140) n (%) 6 (4.3) 114 (81.4) 20 (14.3) 126 (0.45) 154 (0.55)
(2.7) (79.2) (18.1) (0.42) (0.58)
p valuea
0.43
0.46
PE cases (n ¼ 105) 5 (4.8) 82 (78.1) 18 (17.1) 92 (0.49) 118 (0.51)
p valuea
0.32
0.71
Chi-square p value.
dysfunction, which involves defects in various molecular pathways.27,28 In previous studies, candidate genes involved in the signaling pathways of insulin, glucose, and the differentiation of adipocytes have been reported, only a few of these polymorphisms are associated with T2DM in different populations.29 The results obtained show that the frequency of SNP in position 805 in the promoter region of human TNF-a between control and GDM subjects was not significantly different. Further, there was no difference between control and GDM groups in terms of genotype at this site (805). It can therefore be concluded that the SNP at position 805 in the promoter region of the human TNF-a gene is not associated with the development/incidence of GDM. Montazeri et al20 carried out TNF-a (308) gene polymorphism studies in GDM women and concluded that TNF-a had no role in the development of the disease in the Malaysian population. The same group has carried out the TNF-a (308) gene polymorphism study in a different region of Malaysia (Seremban), and the results are subsidiary to the earlier studies (p > 0.05).30 Thus, our results occur with the findings from several earlier studies. PE is a common complex disease with both genetic and environmental components, including impaired maternal immune response and different aspects of metabolic syndromes, such as insulin resistance, obesity, and dyslipidemia.31 There is increasing evidence showing that cytokines may be involved in the pathogenesis of PE.12,32e34 The allele frequency of T in the PE patient group (0.51%) was lower than in the control group (0.58). The frequencies of CT and TT genotypes were also lower in the PE group. Several studies have reported a high occurrence of the TNF-a eC850T polymorphism among pregnant women with PE.35 While, Zhao et al36 carried out their studies in the Chinese population, they concluded that the T allele was a protective factor against the development of the disease. Other studies have found similar results to us, in which the disease is not associated.37 There
Table 3 e Statistical analysis for GDM and PE. Disease Risk allele GDM
T
PE
T
Model Additive Recessive Dominant Allele Additive Recessive Dominant Allele
Odds ratio (95%CI) p value 1.14 0.75 0.61 0.89 0.93 0.93 0.55 0.94
(0.68, 1.93) (0.42, 1.33) (0.20, 1.87) (0.66, 1.20) (0.53, 1.62) (0.51, 1.70) (0.17, 1.78) (0.68, 1.30)
0.60 0.33 0.39 0.46 0.80 0.83 0.31 0.71
are several studies have been carried out with 308 promoter polymorphism with PE and the results indicate both positive and negative associations.1,31,38,39 The protective effect of the 850 locus in diabetic (GDM) and hypertensive (PE) disorders that complicate pregnancy are fully understood. The present study showed that this locus might alter the transcriptional activity of TNF-a mRNA, and thereby decrease the production of TNF-a mRNA. The exact mechanism awaits further study.36 There were two marked inadequacies in the present study. Firstly, the subjects were randomly recruited from a specific geographical niche without any specific reference to their ethnicity. Further, the gestational age for control samples were not recorded. Nevertheless, we summarize from the results of the present study that SNP in the promoter polymorphism (850C > T) in the TNF-a gene cannot be considered as an independent risk factor as a predictor for the development of GDM/PE in our subjects.
Conflicts of interest All authors have none to declare.
Acknowledgment We are gratified to Indian Council for Medical Research for the funding of this work (Sanction no.5-3-8-39-2007; RHN). Gratitude is expressed to all the pregnancy women who has supported this study with their participation.
references
1. Molvarec A, Jermendy A, Kovacs M, Prohaszka Z, Rigo Jr J. Toll-like receptor 4 gene polymorphisms and preeclampsia: lack of association in a Caucasian population. Hypertens Res. 2008;31:859e864. 2. Kumar L, Chaurasiya OS, Jian G, Nath D, Shobhne HJ. The evaluation of cord blood magnesium level in neonates of magnesium sulphate treated pre-eclamptic/eclamptic mothers and its clinical correlation. PJSR. 2013;6:16e19. 3. Bhat M, K N R, Sarma SP, Menon S, C V S, GK S. Determinants of gestational diabetes mellitus: a case control study in a district tertiary care hospital in south India. Int J Diabetes Dev Ctries. 2010;30:91e96.
22
j o u r n a l o f r e p r o d u c t i v e h e a l t h a n d m e d i c i n e 1 ( 2 0 1 5 ) 1 8 e2 2
4. Bryson CL, Ioannou GN, Rulyak SJ, Critchlow C. Association between gestational diabetes and pregnancy-induced hypertension. Am J Epidemiol. 2003;158:1148e1153. 5. Zhang C, Bao W, Rong Y, et al. Genetic variants and the risk of gestational diabetes mellitus: a systematic review. Hum Reprod Update. 2003;19:376e390. 6. Yelumalai S, Muniandy S, Zawiah Omar S, Qvist R. Pregnancy-induced hypertension and preeclampsia: levels of angiogenic factors in Malaysian women. J Clin Biochem Nutr. 2010;47:191e197. 7. Fernandez-Real JM, Gutierrez C, Ricart W. The TNF-alpha gene NcoI polymorphism influences the relationship among insulin resistance, percent body fat, and increased serum leptin levels. Diabetes. 1997;46:1468e1472. 8. Dalzeil B, Gosby AK, Richman RM. Association of the TNFalpha -308 G/A promoter polymorphism with insulin resistance in obesity. Obes Res. 2002;10:401e407. 9. Koch M, Rett A, Volk E. The tumour necrosis factor alpha -238 G–> A and -308 G–> A promoter polymorphisms are not associated with insulin sensitivity and insulin secretion in young healthy relatives of Type II diabetic patients. Diabetologia. 2000;43:181e184. 10. Rasmussen SK, Urhammer SA, Jensen JN. The -238 and -308 G–>A polymorphisms of the tumor necrosis factor alpha gene promoter are not associated with features of the insulin resistance syndrome or altered birth weight in Danish Caucasians. J Clin Endocrinol Metab. 2000;85:1731e1734. 11. Kato K, Ijiri R, Tanaka Y. Nasal chondromesenchymal hamartoma of infancy: the first Japanese case report. Pathol Int. 1999;49:731e1736. 12. Chan JC, Cheung JC, Stehouwer CD. The central roles of obesity-associated dyslipidaemia, endothelial activation and cytokines in the Metabolic Syndrome e an analysis by structural equation modelling. Int J Obes Relat Metab Disord. 2002;26:994e1008. 13. Dandona P, Weinstock R, Thusu K. Tumor necrosis factoralpha in sera of obese patients: fall with weight loss. J Clin Endocrinol Metab. 1998;83:2907e2910. 14. Allen RD. Polymorphism of the human TNF-alpha promoter random variation or functional diversity? Mol Immunol. 1999;36:1017e1027. 15. Wilson AG, Symons JA, McDowell TL. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci U S A. 1997;94:3195e3199. 16. Teramoto M, Kitawaki J, Koshiba H. Genetic contribution of tumor necrosis factor (TNF)-alpha gene promoter (-1031, -863 and -857) and TNF receptor 2 gene polymorphisms in endometriosis susceptibility. Am J Reprod Immunol. 2004;51:352e357. 17. Lakshmi KV, Shetty P, Vottam K. Tumor necrosis factor alpha-C850T polymorphism is significantly associated with endometriosis in Asian Indian women. Fertil Steril. 2010;94:453e456. 18. Cho HC, Yu G, Lee MY. TNF-a polymorphisms and coronary artery disease: association study in the Korean population. Cytokine. 2013;62:104e109. 19. Havel PJ. Control of energy homeostasis and insulin action by adipocyte hormones: leptin, acylation stimulating protein, and adiponectin. Curr Opin Lipidol. 2002;13:51e59. 20. Montazeri S, Nalliah S, Radhakrishnan AK. Association between polymorphisms in human tumor necrosis factor alpha (e308) and-beta (252) genes and development of gestational diabetes mellitus. Diabetes Res Clin Pract. 2010;88:139e145. 21. Rinehart BK, Terrone DA, Lagoo-Deenadayalan S. Expression of the placental cytokines tumor necrosis factor alpha,
22. 23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33. 34.
35.
36.
37.
38.
39.
interleukin 1beta, and interleukin 10 is increased in preeclampsia. Am J Obstet Gynecol. 1999;181:915e920. American Diabetes Association, Diagnosis and Classification of Diabetes Mellitus. vol. 34. 2011:S62eS69. Khan IA, Shaik NA, Pasupuleti P, Chava S, Jahan P, Hasan Q, Rao P. Screening of mitochondrial mutations and insertiondeletion polymorphisms in gestational diabetes mellitus in Asian Indians. Saud J Bio Sci. 2015. http://dx.doi.org/10.1016/ j.sjbs.2014.11.001. Pappa KI, Gazouli M, Anastasiou E. The major circadian pacemaker ARNT-like protein-1 (BMAL1) is associated with susceptibility to gestational diabetes mellitus. Diabetes Res Clin Pract. 2013;99:151e157. Irinyenikan TA, Roberts OA, Arowojolu A. Serum lipid levels in pregnant normotensive and gestational hypertensive women in Ibadan, Nigeria. Ann Biol Res. 2013;4:204e208. Aggarwal S, Dimri N, Tandon I. Preeclampsia in North Indian women: the contribution of genetic polymorphisms. J Obstet Gynaecol Res. 2011;37:1335e1341. Bao XY, Xie C, Yang MS. Association between type 2 diabetes and CDKN2A/B: a meta-analysis study. Mol Bio Rep. 2012;39:1609e1616. Matharoo K, Arora P, Bhanwer AJ. Association of adiponectin (AdipoQ) and sulphonylurea receptor (ABCC8) gene polymorphism with Type 2 Diabetes in North Indian population of Punjab. Gene. 2013;527:228e234. Martinez-Gomez LE, Cruz M, Martinez-Nava GA, MadridMarina V. A replication study of the IRS1, CAPN 10, TCF7L2 and PPARG gene polymorphisms associated with type 2 diabetes in two different populations of Mexico. Ann Hum Genet. 2011;75:612e620. Montazeri S, Nalliah S, Radhakrishnan AK. Is there a genetic variation association in the IL-10 and TNF alpha promoter gene with gestational diabetes mellitus? Hereditas. 2010;147:94e102. Vural P, Degirmencioglu S, Saral NY. Tumor necrosis factor alpha, interleukin-6 and interleukin-10 polymorphisms in preeclampsia. J Obstet Gynaecol Res. 2010;36:64e71. Kilpatrick DC. HLA-dependent TNF secretory response may provide an immunogenetic link between pre-eclampsia and type 1 diabetes mellitus. Dis Markers. 1996;13:43e47. Clark P, Boswell F, Greer IA. The neutrophil and preeclampsia. Semin Reprod Endocrinol. 1998;16:57e64. Benyo DF, Miles TM, Conrad KP. Hypoxia stimulates cytokine reproduction by villous explants from the human placenta. J Clin Endocrinol Metab. 1997;82:1582e1588. Stuber F. Effects of genomic polymorphisms on the course of sepsis: is there a concept for gene therapy? J Am Soc Nephrol. 2001;12:S60eS64. Zhao Y, Xia S, Zou L. The association between polymorphism of TNF-alpha gene and hypertensive disorder complicating pregnancy. J Huazhong Univ Sci Technolog Med Sci. 2007;27:729e732. Canto-Cetina T, Canizales-Quinteros S, de la Chesnaye E. Analysis of C-850T and G-308A polymorphisms of the tumor necrosis factor-alpha gene in Maya-Mestizo women with preeclampsia. Hypertens Pregnancy. 2007;26:283e291. Ros HS, Cnattingius S, Lipworth L. Comparison of risk factors for preeclampsia and gestational hypertension in a population-based cohort study. Am J Epidemiol. 1998;147:1062e1070. Stonek F, Bentz EK, Hafner E. A tumor necrosis factor-alpha promoter polymorphism and pregnancy complications: results of a prospective cohort study in 1652 pregnant women. Reprod Sci. 2007;14:425e429.