Two mutations in the vif gene of maedi-visna virus have different phenotypes, indicating more than one function of Vif

Virology 488 (2016) 37–42

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Two mutations in the vif gene of maedi-visna virus have different phenotypes, indicating more than one function of Vif Sigrídur R. Franzdóttir a, Katrín Ólafsdóttir a, Stefán R. Jónsson a, Hannah Strobel a, Ólafur S. Andrésson b, Valgerdur Andrésdóttir a,n a b

Institute for Experimental Pathology, Keldur, University of Iceland, Reykjavik, Iceland Faculty of Life and Environmental Sciences, University of Iceland, Iceland

art ic l e i nf o

a b s t r a c t

Article history: Received 10 April 2015 Returned to author for revisions 26 October 2015 Accepted 31 October 2015

Like most other lentiviruses, maedi-visna virus (MVV) requires Vif for replication in natural target cells and in vivo. Here, we show that Vif-deficient MVV accumulates G–A mutations in the sequence context characteristic of ovine APOBEC3, consistent with a role of MVV Vif in neutralizing APOBEC3. We studied two point mutations in the vif gene of MVV. One was a tryptophan to arginine mutation that affects the interaction with APOBEC3 and caused G–A hypermutation. The other mutation was a proline to serine mutation that together with a mutation in the capsid protein caused attenuated replication in fetal ovine synovial (FOS) cells but not in sheep choroid plexus (SCP) cells. There was no hypermutation associated with this mutation. These results suggest that MVV Vif exerts more than one function and that there may be interaction between Vif and the capsid. The results also suggest the involvement of an unknown host factor in MVV Vif function. & 2015 Elsevier Inc. All rights reserved.

Keywords: Maedi-visna virus Lentivirus Vif Capsid APOBEC3 Host restriction

Introduction Maedi-visna virus (MVV) is a lentivirus of sheep, mainly affecting the lungs and the nervous system. The target cells of MVV infection are predominantly cells of the monocyte/macrophage lineage, and virus expression is activated upon macrophage maturation (Gorrell et al., 1992; Petursson et al., 1991). Like other lentiviruses except equine infectious anemia virus (EIAV), MVV requires Vif (virion infectivity factor) for efficient replication in primary macrophages and in vivo (Kristbjornsdottir et al., 2004). Human immunodeficiency virus type 1 (HIV-1) Vif has been shown to neutralize human APOBEC3 (hA3) proteins, which are cellular inhibitors of HIV-1 replication. The hA3 proteins are cytosine deaminases that deaminate C to U within newly synthesized single-strand DNA of the virus, leading to G–A mutation in the proviral DNA or degradation of the retroviral cDNA prior to integration (Harris et al., 2003; Lecossier et al., 2003; Sheehy et al., 2002). There is also evidence to suggest that some of the hA3 proteins can inhibit virus replication in the absence of hypermutation (Holmes et al., 2007; Newman et al., 2005). n Correspondence to: Institute for Experimental Pathology, University of Iceland, Keldur, Keldnavegi 3, 112 Reykjavik, Iceland. E-mail address: [email protected] (V. Andrésdóttir).

http://dx.doi.org/10.1016/j.virol.2015.10.035 0042-6822/& 2015 Elsevier Inc. All rights reserved.

Whereas the primates have seven A3 genes, sheep and cattle have three and mice have only one (Harris and Liddament, 2004; Jonsson et al., 2006; LaRue et al., 2008; OhAinle et al., 2006). Sheep code for at least four A3 proteins from three genes; OaA3Z1, OaA3Z2 and OaA3Z3, and a double domain protein, OaA3Z2-Z3. All four proteins elicit DNA cytosine deaminase activity. The double domain protein OaA3Z2-Z3 has a similar subcellular distribution as A3F and A3G in humans and it is neutralized by MVV Vif. It has a preference for deaminating cytosines in the sequence context T (T/C)C, which we show here is the target site for mutations in Vifdeficient (dVif) strains. OaA3Z2-Z3 is therefore likely to be the predominant antiretroviral ovine A3 in vivo (Jonsson et al., 2006; LaRue et al., 2008). The A3 proteins have very broad antiviral activity, thus A3s of mice, sheep, pigs and cows as well as those of primates can inhibit HIV-1 (Bishop et al., 2004; Jonsson et al., 2006). Vif function, however, is highly host-specific. For instance, Vif of HIV-1 can neutralize many of the human A3s, but not those of African green monkey, mice, sheep, pigs or cows, and the Vif proteins of MVV, BIV and FIV could not restore replication of dVif HIV-1 in human cells (Jonsson et al., 2006; Mariani et al., 2003; Simon et al., 1995). However, recent studies have shown that some Vif-A3 interactions are more promiscuous than previously appreciated. Thus, MVV Vif not only leads to degradation of ovine A3, but also human and rhesus macaque A3H as well as cat and cow Z3 type A3 proteins. (Larue et al., 2010).

38

S.R. Franzdóttir et al. / Virology 488 (2016) 37–42

HIV-1 Vif has been shown to target hA3G and hA3F for proteasomal degradation by recruiting cullin5-ElonginB/C through a viral specific BC-box ( SLQXLA) and a novel HCCH zinc binding motif and thereby preventing encapsidation of the hA3G and hA3F proteins (Luo et al., 2005; Yu et al., 2003). The recruitment of the noncanonical cofactor core-binding factor beta (CBFβ) is also required for HIV-1 Vif A3 degradation activity in vivo (Jager et al., 2012). Several amino acids in the N-terminal part of HIV-1 Vif have been shown to be important in the interaction between Vif and A3 proteins (Mehle et al., 2007; Russell and Pathak, 2007; Tian et al., 2006). The MVV vif gene encodes a 29 kDa highly basic protein that is expressed in the late phase along with the structural proteins (Audoly et al., 1992). Despite limited amino acid similarity, all Vif proteins contain the BC-box, SLQXLA (Oberste and Gonda, 1992; Yu et al., 2003). CBFβ, which is required for HIV-1 Vif A3 degradation activity in vivo is completely dispensable for MVV Vif function, but MVV Vif uniquely requires a novel cofactor, cyclophilin A (CYPA) for anti-A3 activity (Kane et al., 2015). It therefore appears that the lentivirus vif genes have evolved differently to neutralize their respective host A3 proteins. Retrovirus capsids have been shown to be targets for host restriction in a number of cell–virus systems. TRIM5α, a protein that belongs to a family of around 70 so-called tripartite motif (TRIM)-containing proteins, has been shown to be responsible for most of this restriction. Recently, an active TRIM5α protein was identified in ovine cells (Jauregui et al., 2012). In a previous study we identified a point mutation in the vif gene of MVV, that together with a mutation in CA rendered the virus replication defective both in vitro and in vivo (Gudmundsson et al., 2005). This mutant (CA(L120R)-Vif(P205S)) had different replication properties in vitro to a Vif-deleted MVV (dVif), in that CA(L120R)-Vif(P205S) was replication proficient in sheep choroid plexus (SCP) cells, whereas the dVif MVV was not. Neither virus could replicate in macrophages or was infectious in vivo. In the present study, we constructed a tryptophan to arginine substitution (W98R) in the central part of Vif to further elucidate the function of Vif. We tested the replication proficiency of mutant viruses with this mutation in a wild type background and together with the CA (L120R) mutation, and compared to the Vif(P205S) mutation both in wild type and a CA(L120R) background. The virus with the Vif(W98R) mutation replicated poorly in SCP cells whereas fetal ovine synovial (FOS) cells were semi-permissive. An increased frequency of G–A mutations was detected in SCP derived viral genomes. The context of these mutations matches the target sequence of ovine A3Z2-Z3 (Jonsson et al., 2006), indicating that this residue was associated with ovine A3Z2-Z3 neutralization. This phenotype was identical in both a wild type and a CA(L120R) background. The Vif (P205S) mutation, however, did not cause G–A mutations in the nonpermissive (FOS) cells. These results suggest that MVV Vif has at least two functions; A3 antagonism, and an additional function which is associated with the capsid and dependent on an unknown cell-specific host factor.

Results Two mutations in the vif gene result in different replication properties We have previously shown that a P205S mutation in the C-terminus of Vif has a different phenotype than dVif. The Vif (P205S) mutation does not have a detectable effect on replication 1

W98R

on its own, but in combination with a mutation in the capsid, CA (L120R), there is markedly reduced replication proficiency in fetal ovine synovial (FOS) cells, macrophages and in vivo, while SCP cells are fully permissive (Gudmundsson et al., 2005; Kristbjornsdottir et al., 2004). The main goal of this study was to present evidence for two distinct functions of Vif by introducing point mutations into different parts of the protein and characterizing the resulting phenotypes. To this end, we introduced a W98R substitution in Vif, using the MVV molecular clone KV1772 as a backbone, with or without the CA(L120R) mutation. This mutation in Vif was selected since it had been previously shown to attenuate the replication of the closely related caprine arthritis encephalitis virus (CAEV) (Seroude et al., 2001) and we found that it was unable to restrict the activity of OaAZ2-Z3 using HEK293T cells. The locations of the two introduced mutations in Vif are shown in Fig. 1. The recombinant viruses were tested for replication in FOS cells and SCP cells. Cells were infected with equal amounts of virus (as determined by measuring RT activity) and viral replication was monitored daily by using a TaqMan-based real-time RT-PCR assay. The Vif(P205S) mutation had little effect in the KV1772 background, whereas the Vif(W98R) displayed slower replication kinetics and replicated to lower titers in SCP cells as compared to the wild-type KV1772 strain. A dVif mutant with most of the vif gene deleted was included for comparison, and the replication kinetics of the Vif (W98R) mutant were similar to the dVif mutant. The FOS cells were somewhat more permissive both for dVif and the Vif(W98R) mutant (Fig. 2A and B). In the background of the CA(L120R) mutation, however, the replication efficiency of the virus with the Vif(W98R) mutation was similar to the KV1772 background both in SCP and in FOS cells, while virus with the Vif(P205S) mutation in a CA(L120R) background replicated distinctively slower and to a lower titer in FOS cells than in SCP cells (Fig. 2C and D). It therefore appears that the attenuated replication of the CA(L120R)-Vif(P205S) mutant in FOS cells is not an additive effect of two unrelated mutations but rather suggests that the mutations disrupt some interaction of CA and Vif. The Vif(P205S) mutation defines a function of Vif different from A3 neutralization To address the question whether the CA(L120R)-Vif(P205S) interaction was in any way related to the known role of Vif in counteracting A3, we analyzed the putative effect of A3 editing on the virions with different mutations in vif. For mutational analysis, we sequenced a 428 bp region in the env gene of individual viral genomes (nt 6947–7323 in the molecular clone KV1772 (Andresson et al., 1993)). As shown in Fig. 3, a high number of G–A mutations was observed in dVif virions produced in SCP cells. The same was true for the Vif(W98R) mutant. The preferred sequence context for the G–A mutations is shown in Fig. 3. Seventy-eight per cent of the G–A mutations in the dVif strain and 70% G–A mutations in the Vif (W98R) mutant occurred in G(G/A)A trinucleotides. This is in accordance with the preferred sequence context of OaA3Z2–Z3 editing (Jonsson et al., 2006; LaRue et al., 2009) and indicates that these mutations in the vif gene disrupt the ability of Vif to neutralize OaA3Z2-Z3. However, no G–A hypermutation was found in the CA(L120R)-Vif(P205S) proviruses, neither produced in SCP cells (data not shown) nor in the non-permissive FOS cells (Fig. 3). To further determine A3 degradation induced by the different mutated Vifs, HEK293T cells were co-transfected with OaA3Z2-Z3HA and either wtVif-HA, Vif(SLQ-AAA)-HA, Vif(P205S)-HA or Vif 173SLQRLA

P205S

230

MVV Vif

Fig. 1. A schematic of MVV Vif. The conserved BC-box SLQRLA is shaded and the positions of the two point mutations are indicated.

S.R. Franzdóttir et al. / Virology 488 (2016) 37–42

10000000

1000000

1000000

100000

100000

10000

10000

1000

KV1772

1000

RNA copies/300 μl

39

VifP205S

100

VifP205S

100

dVif

dVif

10

KV1772

10

VifW98R

1

VifW98R

1 0

5

10

15

20

0

5

10

15

20

25

100000000 1000000

10000000 1000000

100000

100000

10000

10000

1000

1000

CA-L120R

100

CA-VifW98R

10

CA-L120R

100

CA-Vif W98R

10

CA-VifP205S

CA-VifP205S

1

1 0

5

10

15

0

20

10

20

30

Days post infection

50 45 40 35 30 25 20 15 10 5 0

percrent

G-A mutations / 10kb

Fig. 2. Replication kinetics of virus production in SCP cells (A and C) and FOS cells (B and D) as measured by TaqMan-based RT-qPCR.

G-A mutations

90 80 70 60 50 40 30 20 10 0

G(G/A)A dVif

VifW98R

Fig. 3. Hypermutation assay of wt MVV and vif mutants. (A) A histogram depicting the frequencies of G–A mutations observed in MVV clones after infection of nonpermissive cells; SCP cells for KV1772wt, dVif, and VifW98R, and FOS cells for CA(L120R)-Vif(P205S). 12–19 clones were sequenced for each virus. Infected cells were taken from the spreading infection shown in Fig. 2. (B) Trinucleotide context of the mutations in (A).

(W98R)-HA. Vif with the P205S mutation degraded A3 as efficiently as wild type Vif, while Vif(W98R) and Vif(SLQ-AAA) were unable to degrade A3 (Fig. 4). The Vif(P205S) mutation therefore appears to define a function of Vif different from A3 degradation.

OaA3Z2-Z3-HA Vif-HA

Discussion The role of the Vif protein of HIV-1 in counteracting the antiviral activity of hA3G and hA3F has been extensively studied

β-acn

Fig. 4. OaA3Z2-Z3 degradation activity of wt and mutated Vif. Cells were transiently transfected with HA-tagged OaA3Z2-Z3 and either wt or mutated Vif.

40

S.R. Franzdóttir et al. / Virology 488 (2016) 37–42

(reviewed in (Henriet et al., 2009; Wissing et al., 2010). Our findings that vif-deficient MVV accumulates G–A mutations with an OaA3Z2-Z3-like trinucleotide mutation spectrum suggest that OaA3Z2-Z3 is active in vivo. The sequence context preferred by the OaA3Z2-Z3 is T(C/T)C in the minus strand which translates to G(A/ G)A in the plus-strand DNA. This target sequence resembles that for the murine A3 (Esnault et al., 2005) more than any of the human A3 proteins which may reflect the dynamic evolution of the A3 genes in primates (Jonsson et al., 2006; LaRue et al., 2008). In this study we described the different phenotypes of two point mutations in Vif, one was a W98R mutation and the other was a P205S mutation. A Vif P205S mutant replicated well in SCP and FOS cells; however, when in combination with a L120R mutation in the capsid, the virus displayed a conditionally synthetically deleterious phenotype, with the virus replicating well in SCP cells, but undergoing distinctively retarded replication in FOS cells. A Vif(W98R) mutant showed a slower rate of replication in SCP cells as well as FOS cells, and there was no effect of the mutation in the capsid. The W98 residue in Vif was originally described in CAEV Vif as necessary for efficient virus replication and unrelated to Gag binding (Seroude et al., 2001). The G–A hypermutation in the target sequence G(A/G)A associated with this mutation in addition to the inability to degrade OaA3Z2-Z3 in vitro (Fig. 4) indicates that the mutation disrupts Vif-mediated degradation of OaA3Z2Z3. This is consistent with the finding in HIV-1 Vif that most of the highly conserved Trp residues in the N-terminal end of Vif are involved in A3 binding (Tian et al., 2006). The P205S mutation is in the C-terminal part of Vif where membrane association, Vif multimerization and interaction with the nucleocapsid part of Gag have been mapped for HIV-1 (Bouyac et al., 1997; Goncalves et al., 1994; Goncalves et al., 1995; Jonsson et al., 2006; Yang et al., 2001). Interaction of Vif with the NC part of Gag has also been mapped in this region in CAEV (Seroude et al., 2001). There was no G–A hypermutation associated with this mutation and the mutation did not affect the ability of Vif to degrade OaA3Z2-Z3. When the CA(L120R)-Vif(P205S) mutant was first described (Gudmundsson et al., 2005), there was some concern that the two mutations were unrelated and that the effect was additive. In this study we show that the mutation in CA has no detectable effect on a point mutation that affects A3 interaction of Vif (Vif(W98R)), neither in SCP nor FOS cells, whereas it has a profound effect on Vif(P205S) replication in FOS cells (Fig. 2). Our hypothesis is that there exists some restrictive activity in FOS cells that is not present in SCP cells. The CA(L120R)-Vif(P205S) mutant may either be unable to evade detection by this activity or is unable to antagonize it to prevent its anti-viral function. Despite much effort, we have not been able to show any interaction between Vif and CA, and neither have others (Seroude et al., 2001). The mutation in the capsid is an L-to-R mutation in amino acid 120 of the capsid corresponding to K131 in helix 7 in the HIV-1 CA. There is a charged amino acid in this position in all lentiviral capsids except those of MVV and CAEV (von Schwedler et al., 1998). MVV is restricted by sheep TRIM5 when overexpressed in cell culture (Jauregui et al., 2012) but it is not known how MVV escapes TRIM5 in vivo. It has been reported that TRIM5 escape mutants in other retroviruses often involve charge-changes (Ohkura and Stoye, 2013), and it could be speculated that the capsids of MVV and CAEV have evolved to substitute L for R120 in order to escape endogenous TRIM5. The L120R mutation would then make the capsid sensitive to endogenous TRIM5, which Vif would normally compensate. Cyclophilin A binds to HIV-1 capsid and has a role in modulating TRIM5 restriction (Sokolskaja et al., 2006), but does not bind to MVV capsid (Kane et al., 2015). Cyclophilin A binds to MVV Vif, however, and is required for the

anti-A3 function of the MVV Vif protein, but it may have another function as well, i.e. to modulate TRIM5 restriction. Whether cyclophilin A or some other host protein is the missing link between Vif and the capsid, suggested by the mutant phenotypes described here, is under investigation.

Materials and methods Construction of Vif(W98R) and CA(L120R)-Vif(W98R) MVV infectious clones and expression plasmids The molecularly cloned maedi-visna virus KV1772 has been described previously (Andresson et al., 1993; Skraban et al., 1999). The clone is contained in two plasmids, p8XSp5-RK1 and p67r (Skraban et al., 1999). For construction of Vif(W98R), the BamHI/HincII fragment (nucleotides 4587–6392) from p8XSp5-RK1 was cloned into pUC19. The tryptophan to arginine substitution at position 98 of Vif was generated by PCR-mediated site-directed mutagenesis using oligonucleotides 5'- GAAATGCAAGGCAATATAAAAGCCAGGG-3' (nucleotides 5250–5276) and 5'-CCCTGGCTTTTATATTGCCTTGCATTTC-3 (nucleotides 5276–5250). The resulting pUC19BamHI4587-HincII6392 plasmid was digested with MluI and BglII and the MluI4680-BglII5841 fragment was isolated and cloned into p8XSp5-RK1 with or without the CAL120R mutation for generating Vif(W98R) or CA(L120R)-Vif(W98R), respectively. The Vif (P205S) and CA(L120R)-Vif (P205S) molecular clones have been described previously (Gudmundsson et al., 2005). For expression vectors, the W98R and P205S mutations were introduced by site-directed mutagenesis into codon-optimized MVV Vif constructs with C-terminal Myc tags in pVR1012 (Larue et al., 2010). For the W98R mutation, the primers 5‘CGCAACGCTCGGCAGTACAAG 3‘ forward and 5‘CTTGTACTGCCGAGCGTTGCG3‘ reverse were used, and for the P120S mutation the primers 5‘GTGCAAAAGTTCTCATGGTGCAGG3‘ forward and 5‘CCTGCACCATGAGAACTTTTGCAC3’ reverse were used. All mutations were verified by sequencing. Cells, virus and transfections SCP cells (Georgsson et al., 1976; Sigurdsson et al., 1960) and FOS cells (Andresson et al., 1993), were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 2 mM glutamine, 100 IU of penicillin per ml, 100 IU of streptomycin per ml, and either 10% lamb serum (growth medium) or 1% lamb serum (maintenance medium). FOS cells were grown in 25 cm2 flasks to 90–95% confluency for transfection by Lipofectamine as specified by the manufacturer (Invitrogen). Equimolar quantities of the two plasmids containing the viral genome, a total of 6 mg DNA, were cut with XbaI and ligated before transfection. Supernatants from transfected cells were passaged into SCP cells when cytopathic effect appeared or RT was detected. Multiplicity of infection (moi) was calculated by the Reed-Muench method as TCID50/ml. RT assay Viral particles from 300 ml of cell-free supernatants from infected cells were pelleted at 14,000 rpm for 1 h in a microfuge. The pelleted virus was resuspended in TNE (10 mM Tris–HCl (pH 7.5), 100mM NaCl, 1mM EDTA) containing 0.1% Triton X-100. RT activity was assayed on a poly(A) template, adding oligo-dT primer and dTTP. The resulting RNA–DNA heteroduplexes were detected by PicoGreen reagent as specified by the manufacturer (Molecular Probes Inc., Eugene, Oregon).

S.R. Franzdóttir et al. / Virology 488 (2016) 37–42

A3 degradation assays Six-well plates were seeded with 5
105 HEK293T cells per well and transfected the next day using Lipofectamine LTX as specified by the manufacturer. To assay for degradation of OaA3Z2-Z3 by wt MVV Vif and the various mutant Vif proteins, 0.2 mg pcDNA3.1-OaA3Z2-Z3-3xHA and 0.2 mg pVR1012-Vif-3xHA were used for cotransfection. To maintain equivalent DNA amounts, empty pVR1012 vector DNA was used when needed. After 48–72 h cell lysates were harvested and boiled for 5 min before the proteins were separated by SDS-PAGE and transferred to PVFD transfer membrane. Immunoblotting was performed with antibodies against the HA-tag. β-actin was used as a loading control. Secondary antibodies were HRP-conjugated anti-rabbit or anti-mouse antibodies (Dako), and detection was carried out using Pierce ECL Plus Western Blotting Substrate (Thermo Scientific). Hypermutation assays Hypermutation of the various Vif mutants was detected by amplifying and sequencing a 428 bp fragment (nucleotides 6911– 7339) from the env gene, using proviral DNA from infected cells. Multiple PCR reactions were performed and cloned into pUC19 plasmids. One clone from each PCR reaction was sequenced to ensure independent sampling. Real-time PCR assay Viral particles from 300 ml of cell-free supernatants from infected cells were pelleted at 14,000 rpm for 1 h in a microfuge. The pellet was dissolved in 10 ml TNE (10 mM Tris pH 7.5; 100 mM NaCl; 1 mM EDTA) with 0.1% Triton X-100. This lysate was used for generating cDNA using RevertAid M-MuLV reverse transcriptase (Fermentas) and a primer from the gag gene (V-1818 5’CGG GGTACCTTACAACATAGGGGGCGCGG 3'). Real-time PCR was carried out in a final volume of 20 ml. The primers and Taqman probe were as follows: Forward primer: V1636 50 -TAAATCAAAAGTGTTATA ATTGTGGGA- 30 , reverse primer: V-1719: 50 -TCCCACAATGATGGCATATTA TTC- 30 , Taqman probe: V1665Taqman 50 -FAM-CCAGGACATCTCGCAAGA CAGTGTAGACA-BHQ-1 30 . Calibration curves were derived by running 10fold dilutions of specific cDNA over the range of 60 to 6
107 copies. Each assay included duplicate wells for each dilution of calibration DNA and for each cDNA sample.

Acknowledgments This study was supported by the Icelandic Research Fund (Grant nos. 070453-021 and 141085-052) and the University of Iceland Research Fund.

References Andresson, O.S., Elser, J.E., Tobin, G.J., Greenwood, J.D., Gonda, M.A., Georgsson, G., Andresdottir, V., Benediktsdottir, E., Carlsdottir, H.M., Mantyla, E.O., 1993. Nucleotide sequence and biological properties of a pathogenic proviral molecular clone of neurovirulent visna virus. Virology 193, 89–105. Audoly, G., Sauze, N., Harkiss, G., Vitu, C., Russo, P., Querat, G., Suzan, M., Vigne, R., 1992. Identification and subcellular localization of the Q gene product of visna virus. Virology 189, 734–739. Bishop, K.N., Holmes, R.K., Sheehy, A.M., Davidson, N.O., Cho, S.J., Malim, M.H., 2004. Cytidine deamination of retroviral DNA by diverse APOBEC proteins. Curr. Biol. 14, 1392–1396. Bouyac, M., Courcoul, M., Bertoia, G., Baudat, Y., Gabuzda, D., Blanc, D., Chazal, N., Boulanger, P., Sire, J., Vigne, R., Spire, B., 1997. Human immunodeficiency virus type 1 Vif protein binds to the Pr55Gag precursor. J. Virol. 71, 9358–9365.

41

Esnault, C., Heidmann, O., Delebecque, F., Dewannieux, M., Ribet, D., Hance, A.J., Heidmann, T., Schwartz, O., 2005. APOBEC3G cytidine deaminase inhibits retrotransposition of endogenous retroviruses. Nature 433, 430–433. Georgsson, G., Nathanson, N., Palsson, P.A., Petursson, G., 1976. The pathology of visna and maedi in sheep. Front. Biol. 44, 61–96. Goncalves, J., Jallepalli, P., Gabuzda, D.H., 1994. Subcellular localization of the Vif protein of human immunodeficiency virus type 1. J. Virol. 68, 704–712. Goncalves, J., Shi, B., Yang, X., Gabuzda, D., 1995. Biological activity of human immunodeficiency virus type 1 Vif requires membrane targeting by C-terminal basic domains. J. Virol. 69, 7196–7204. Gorrell, M.D., Brandon, M.R., Sheffer, D., Adams, R.J., Narayan, O., 1992. Ovine lentivirus is macrophagetropic and does not replicate productively in T lymphocytes. J. Virol. 66, 2679–2688. Gudmundsson, B., Jonsson, S.R., Olafsson, O., Agnarsdottir, G., Matthiasdottir, S., Georgsson, G., Torsteinsdottir, S., Svansson, V., Kristbjornsdottir, H.B., Franzdottir, S.R., Andresson, O.S., Andresdottir, V., 2005. Simultaneous mutations in CA and Vif of Maedi-Visna virus cause attenuated replication in macrophages and reduced infectivity in vivo. J. Virol. 79, 15038–15042. Harris, R.S., Bishop, K.N., Sheehy, A.M., Craig, H.M., Petersen-Mahrt, S.K., Watt, I.N., Neuberger, M.S., Malim, M.H., 2003. DNA deamination mediates innate immunity to retroviral infection. Cell 113, 803–809. Harris, R.S., Liddament, M.T., 2004. Retroviral restriction by APOBEC proteins. Nat. Rev. Immunol. 4, 868–877. Henriet, S., Mercenne, G., Bernacchi, S., Paillart, J.C., Marquet, R., 2009. Tumultuous relationship between the human immunodeficiency virus type 1 viral infectivity factor (Vif) and the human APOBEC-3G and APOBEC-3F restriction factors. Microbiol. Mol. Biol. Rev. 73, 211–232. Holmes, R.K., Koning, F.A., Bishop, K.N., Malim, M.H., 2007. APOBEC3F can inhibit the accumulation of HIV-1 reverse transcription products in the absence of hypermutation. Comparisons with APOBEC3G. J. Biol. Chem. 282, 2587–2595. Jager, S., Kim, D.Y., Hultquist, J.F., Shindo, K., LaRue, R.S., Kwon, E., Li, M., Anderson, B.D., Yen, L., Stanley, D., Mahon, C., Kane, J., Franks-Skiba, K., Cimermancic, P., Burlingame, A., Sali, A., Craik, C.S., Harris, R.S., Gross, J.D., Krogan, N.J., 2012. Vif hijacks CBF-beta to degrade APOBEC3G and promote HIV-1 infection. Nature 481, 371–375. Jauregui, P., Crespo, H., Glaria, I., Lujan, L., Contreras, A., Rosati, S., de Andres, D., Amorena, B., Towers, G.J., Reina, R., 2012. Ovine TRIM5alpha can restrict visna/ maedi virus. J. Virol. 86, 9504–9509. Jonsson, S.R., Hache, G., Stenglein, M.D., Fahrenkrug, S.C., Andresdottir, V., Harris, R. S., 2006. Evolutionarily conserved and non-conserved retrovirus restriction activities of artiodactyl APOBEC3F proteins. Nucl. Acids Res. 34, 5683–5694. Kane, J.R., Stanley, D.J., Hultquist, J.F., Johnson, J.R., Mietrach, N., Binning, J.M., Jonsson, S.R., Barelier, S., Newton, B.W., Johnson, T.L., Franks-Skiba, K.E., Li, M., Brown, W.L., Gunnarsson, H.I., Adalbjornsdottir, A., Fraser, J.S., Harris, R.S., Andresdottir, V., Gross, J.D., Krogan, N.J., 2015. Lineage-specific viral hijacking of non-canonical E3 ubiquitin ligase cofactors in the evolution of Vif antiAPOBEC3 activity. Cell Rep. 11, 1236–1250. Kristbjornsdottir, H.B., Andresdottir, V., Svansson, V., Torsteinsdottir, S., Matthiasdottir, S., Andresson, O.S., 2004. The vif gene of maedi-visna virus is essential for infectivity in vivo and in vitro. Virology 318, 350–359. LaRue, R.S., Andresdottir, V., Blanchard, Y., Conticello, S.G., Derse, D., Emerman, M., Greene, W.C., Jonsson, S.R., Landau, N.R., Lochelt, M., Malik, H.S., Malim, M.H., Munk, C., O'Brien, S.J., Pathak, V.K., Strebel, K., Wain-Hobson, S., Yu, X.F., Yuhki, N., Harris, R.S., 2009. Guidelines for naming nonprimate APOBEC3 genes and proteins. J. Virol. 83, 494–497. LaRue, R.S., Jonsson, S.R., Silverstein, K.A., Lajoie, M., Bertrand, D., El-Mabrouk, N., Hotzel, I., Andresdottir, V., Smith, T.P., Harris, R.S., 2008. The artiodactyl APOBEC3 innate immune repertoire shows evidence for a multi-functional domain organization that existed in the ancestor of placental mammals. BMC Mol. Biol. 9, 104. Larue, R.S., Lengyel, J., Jonsson, S.R., Andresdottir, V., Harris, R.S., 2010. Lentiviral Vif degrades the APOBEC3Z3/APOBEC3H protein of its mammalian host and is capable of cross-species activity. J. Virol. 84, 8193–8201. Lecossier, D., Bouchonnet, F., Clavel, F., Hance, A.J., 2003. Hypermutation of HIV-1 DNA in the absence of the Vif protein. Science 300, 1112. Luo, K., Xiao, Z., Ehrlich, E., Yu, Y., Liu, B., Zheng, S., Yu, X.F., 2005. Primate lentiviral virion infectivity factors are substrate receptors that assemble with cullin 5-E3 ligase through a HCCH motif to suppress APOBEC3G. Proc. Natl. Acad. Sci. USA 102, 11444–11449. Mariani, R., Chen, D., Schrofelbauer, B., Navarro, F., Konig, R., Bollman, B., Munk, C., Nymark-McMahon, H., Landau, N.R., 2003. Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell 114, 21–31. Mehle, A., Wilson, H., Zhang, C., Brazier, A.J., McPike, M., Pery, E., Gabuzda, D., 2007. Identification of an APOBEC3G binding site in human immunodeficiency virus type 1 Vif and inhibitors of Vif-APOBEC3G binding. J. Virol. 81, 13235–13241. Newman, E.N., Holmes, R.K., Craig, H.M., Klein, K.C., Lingappa, J.R., Malim, M.H., Sheehy, A.M., 2005. Antiviral function of APOBEC3G can be dissociated from cytidine deaminase activity. Curr. Biol. 15, 166–170. Oberste, M.S., Gonda, M.A., 1992. Conservation of amino-acid sequence motifs in lentivirus Vif proteins. Virus Genes 6, 95–102. OhAinle, M., Kerns, J.A., Malik, H.S., Emerman, M., 2006. Adaptive evolution and antiviral activity of the conserved mammalian cytidine deaminase APOBEC3H. J. Virol. 80, 3853–3862. Ohkura, S., Stoye, J.P., 2013. A comparison of murine leukemia viruses that escape from human and rhesus macaque TRIM5alphas. J. Virol. 87, 6455–6468. Petursson, G., Andresdottir, V., Andresson, O., Torsteinsdottir, S., Georgsson, G., Palsson, P.A., 1991. Human and ovine lentiviral infections compared. Comp. Immunol. Microbiol. Infect. Dis. 14, 277–287.

42

S.R. Franzdóttir et al. / Virology 488 (2016) 37–42

Russell, R.A., Pathak, V.K., 2007. Identification of two distinct human immunodeficiency virus type 1 Vif determinants critical for interactions with human APOBEC3G and APOBEC3F. J. Virol. 81, 8201–8210. Seroude, V., Audoly, G., Gluschankof, P., Suzan, M., 2001. Tryptophan 95, an amino acid residue of the Caprine arthritis encephalitis virus vif protein which is essential for virus replication. Virology 280, 232–242. Sheehy, A.M., Gaddis, N.C., Choi, J.D., Malim, M.H., 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418, 646–650. Sigurdsson, B., Thormar, H., Palsson, P.A., 1960. Cultivation of visna virus in tissue culture. Archiv fur die gesamte Virusforschung 10, 368–380. Simon, J.H., Southerling, T.E., Peterson, J.C., Meyer, B.E., Malim, M.H., 1995. Complementation of vif-defective human immunodeficiency virus type 1 by primate, but not nonprimate, lentivirus vif genes. J. Virol. 69, 4166–4172. Skraban, R., Matthiasdottir, S., Torsteinsdottir, S., Agnarsdottir, G., Gudmundsson, B., Georgsson, G., Meloen, R.H., Andresson, O.S., Staskus, K.A., Thormar, H., Andresdottir, V., 1999. Naturally occurring mutations within 39 amino acids in the envelope glycoprotein of maedi-visna virus alter the neutralization phenotype. J. Virol. 73, 8064–8072.

Sokolskaja, E., Berthoux, L., Luban, J., 2006. Cyclophilin A and TRIM5alpha independently regulate human immunodeficiency virus type 1 infectivity in human cells. J. Virol. 80, 2855–2862. Tian, C., Yu, X., Zhang, W., Wang, T., Xu, R., Yu, X.F., 2006. Differential requirement for conserved tryptophans in human immunodeficiency virus type 1 Vif for the selective suppression of APOBEC3G and APOBEC3F. J. Virol. 80, 3112–3115. von Schwedler, U.K., Stemmler, T.L., Klishko, V.Y., Li, S., Albertine, K.H., Davis, D.R., Sundquist, W.I., 1998. Proteolytic refolding of the HIV-1 capsid protein aminoterminus facilitates viral core assembly. EMBO J. 17, 1555–1568. Wissing, S., Galloway, N.L., Greene, W.C., 2010. HIV-1 Vif versus the APOBEC3 cytidine deaminases: an intracellular duel between pathogen and host restriction factors. Mol. Asp. Med. 31, 383–397. Yang, S., Sun, Y., Zhang, H., 2001. The multimerization of human immunodeficiency virus type I Vif protein: a requirement for Vif function in the viral life cycle. J. Biol. Chem. 276, 4889–4893. Yu, X., Yu, Y., Liu, B., Luo, K., Kong, W., Mao, P., Yu, X.F., 2003. Induction of APOBEC3G ubiquitination and degradation by an HIV-1 Vif-Cul5-SCF complex. Science 302, 1056–1060.