Two novel epistatic mutations (E1:K211E and E2:V264A) in structural proteins of Chikungunya virus enhance fitness in Aedes aegypti

Virology 497 (2016) 59–68

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Two novel epistatic mutations (E1:K211E and E2:V264A) in structural proteins of Chikungunya virus enhance fitness in Aedes aegypti Ankita Agarwal a, Ajay Kumar Sharma b, D. Sukumaran b, Manmohan Parida a, Paban Kumar Dash a,n a b

Division of Virology, Defence R and D Establishment, Jhansi Road, Gwalior 474002, M.P., India Vector Management Division, Defence R and D Establishment, Jhansi Road, Gwalior 474002, M.P., India

art ic l e i nf o

a b s t r a c t

Article history: Received 7 June 2016 Returned to author for revisions 28 June 2016 Accepted 30 June 2016

Expansion of CHIKV outbreaks with appearance of novel mutations are reported from many parts of the world. Two novel mutations viz. E1:K211E and E2:V264A in background of E1:226A are recently identified from Aedes aegypti dominated areas of India. In this study, the role of these mutations in modulation of infectivity, dissemination and transmission by two different Aedes species was studied. Mutations were sequentially constructed in CHIKV genome and female Ae. aegypti and Aedes albopictus mosquitoes were orally infected with eight different CHIKV mutants. Double mutant virus containing E1: K211E and E2:V264A mutations in background of E1:226A revealed remarkably higher fitness for Ae. aegypti, as indicated by significant increase in virus infectivity (13 fold), dissemination (15 fold) and transmission (62 fold) compared to parental E1:226A virus. These results indicate that adaptive mutations in CHIKV are leading to efficient CHIKV circulation in Ae. aegypti endemic areas, contributing and sustaining the major CHIKV outbreaks. & 2016 Elsevier Inc. All rights reserved.

Keywords: Chikungunya Mutations Aedes Infection Dissemination Transmission

1. Introduction The geographical range of CHIKV is constantly expanding since last decade. The Reunion outbreak in 2005 was of highest magnitude where along with classical cases of fever and arthralgia, atypical neurological complications were reported. Genome analysis revealed the identification of E1:226A during the first part of the outbreak i.e. from March-June 2005, and E1:226V variant from September 2005 onwards (Schuffenecker et al., 2006). Acquisition of E1:A226V mutation was later seen in Kerala, southern India from 2007 onwards (Santhosh et al., 2009). CHIKV strains isolated from Cameroon outbreak in 2006 and Gabon outbreak in 2007 also revealed A226V mutation. Thus, the possession of A226V mutation in three independent outbreaks provided selective advantage for transmission by Aedes albopictus that indicated evolutionary convergence (de Lamballerie et al., 2008). It may be noted that during its resurgence in coastal Kenya in 2004, Aedes aegypti was the primary vector, but in Reunion islands Ae. albopictus was incriminated as the major vector (Ng and Hapuarachchi, 2010). Both Ae. albopictus and Ae. aegypti are incriminated as the major vector supporting CHIKV transmission in Asia as well as n

Corresponding author. E-mail addresses: [email protected], [email protected] (P.K. Dash). http://dx.doi.org/10.1016/j.virol.2016.06.025 0042-6822/& 2016 Elsevier Inc. All rights reserved.

Americas (Kraemer et al., 2015). In northern India, Ae. aegypti is the dominant vector (Shrinet et al., 2012) and the circulating CHIKV still harboring E1:226A without resorting to 226V mutation. However, in southern states of India, particularly Kerala which is located in coastal areas, Ae. albopictus is highly abundant due to excess rubber plantations, which is a larval or oviposition habitat for this vector (Kumar et al., 2008). From 2007 onwards, the circulating CHIKV in this Ae. albopictus dominant area are found to harbor E1:226V mutation. CHIKV isolated from many parts of south east Asia (Cambodia, Thailand, Singapore and Malaysia) revealed E1:A226V mutation, where Ae. albopictus is the dominant species (Duong et al., 2012). Interestingly, CHIKV circulating and causing major outbreaks in Ae. aegypti dominated areas do not demonstrate this unique mutation. All the isolates continued to harbor E1:226A. In 2007, isolates from Uttar Pradesh confirmed the presence of E1:226A (Singh et al., 2012). Further, in a hospital based study from 2008 to 2009, sequence analysis of E1 gene revealed ‘A’ at 226 position in patients from New Delhi (Ray et al., 2012). E1:226A was also reported in 2010 from New Delhi outbreak (Shrinet et al., 2012). These reports clearly demonstrate the continued circulation of E1:226A in India. More recently, CHIK outbreak occurred in Bhutan in 2012, where isolates were reported to have originated from northern Indian isolates, showed the presence of E1:226A (Wangchuk et al., 2013). The hypothesis of high fitness of 226V variant for Ae. albopictus mosquitoes can be observed by the successful introduction and

60

A. Agarwal et al. / Virology 497 (2016) 59–68

rapid spread of CHIKV infection in Ae. albopictus dominated areas of Italy (Rezza et al., 2007). Role of CHIKV E1:A226V mutation in increased fitness in Ae. albopictus mosquitoes, in terms of high midgut infectivity, dissemination to salivary glands and transmission to vertebrate species has been demonstrated previously (Tsetsarkin et al., 2007). Widespread variation in vector competence among different geographic strains of Aedes for CHIKV has already been reported since mid 70's (Tesh et al., 1976). The competence of Indian Aedes mosquitoes for this unique mutation (E1:226A/V) is not yet studied. Therefore, present study was carried out to evaluate differential vector competence and transmission potential of CHIKV E1:226A vs. 226V in Indian Ae. aegypti and Ae. albopictus mosquitoes. Furthermore, two novel mutations viz. E1:K211E and E2:V264A are isolated from New Delhi in 2010 (Shrinet et al., 2012), Tamil Nadu (Sumathy and Ella, 2012) as well as from Kolkata in 2011 and 2012 (Taraphdar and Chatterjee, 2015) in background of E1:226A in Ae. aegypti dominated areas. Among these mutations, K211E is present in Asian genotype, but V264A is not found in any other CHIKV genotype. Our study is also directed to investigate the role of these additional mutations in modulation of CHIKV infectivity or transmission.

2. Results 2.1. Rescue of CHIKV from infectious clone Rescue of CHIKV from infectious clone is shown in Fig. S1. 2.2. Identification of sites for mutation Sequence analysis of CHIKV isolates from 2009 to 2010 epidemics in the states of Tamil Nadu and Andhra Pradesh revealed two unique mutations viz. E1:K211E and E2:V264A. The isolates of the study had 226A in E1 glycoprotein. Characterization of Delhi CHIKV strains from 2010 outbreak led to the identification of same two mutations, in background of E1:226A. Molecular characterization of the virus circulating in urban areas of West Bengal state from 2006 to 2012 led to the identification of E1:226A, E1:K211E and E2:V264A mutation (Table 2). Amino acid alignment of representative sequence obtained from recent outbreaks of India has been shown in Fig. S2. These two unique mutations were not observed in CHIKV carrying E1:226V. Due to the simultaneous appearance of these mutations from different outbreaks, these mutations were selected for further study. 2.3. Phylogenetic analysis Phylogenetic analysis classified the CHIKV into 3 genotypes: ECSA (East Central South African), Asian and West African. ECSA was further grouped into ECSA enzootic, ECSA Brazil and IOL (Indian Ocean lineage). Further grouping within IOL revealed two

Table 2 Genomic sites identified for mutation with their importance. Sl no Genomic sites of mutation

Importance

1

E1:226

V226A

2

E1:211

K211E

3

E2:264

V264A

Appearance of ‘V’ since 2005 in Ae. albopictus dominated areas Appearance of ‘E’ since 2010 in New Delhi, Andhra Pradesh, Tamil Nadu, West Bengal Appearance of ‘A’ since 2010 in New Delhi, Andhra Pradesh, Tamil Nadu, West Bengal

distinct lineages (E1:226A and E1:226V) on the basis of an important substitution in E1 protein. Four representative recent Indian isolates from Tamil Nadu (2010) and West Bengal (2011, 2012) harboring E1:K211E and E2:V264A mutations in background of E1:226A formed a distinct cluster (Fig. 1). 2.4. Selection pressure analysis The analysis revealed that majority of CHIKV codons were under strong negative selection. Total 96 sites were identified to be under positive selection pressure. E1:A226V and E2:V264A was selected by MEME with p value of 0.001 and 0.079 respectively. E1:K211E was selected by three methods viz. FEL, MEME, FUBAR. It showed p value of 0.048 (FEL), p value of 0.023 (MEME) and posterior probability of 0.928 (FUBAR) (Table 3). Based on phylogenetic analysis, selection pressure analysis and mutations implicated in recent outbreaks in India, these three sites were selected for further study. These mutations were constructed in CHIKV infectious clone and their role in modulation of CHIKV infectivity or transmission was studied. 2.5. Superimposition of non-mutated and mutated E1 and E2 protein of CHIKV Superimposed homology models of non-mutated and mutated E1 and E2 protein of CHIKV are shown in Fig. 2 with the mutations mapped and highlighted (A226V, K211E and V264A) in three dimensional structures. We found moderate structural difference in domain A of mutated E2 protein (264A) with that of non-mutated (264V) E2 protein. However, no structural difference in E1 protein was noticed. 2.6. Confirmation and titration of mutant CHIKV Mutant viruses were rescued as described earlier and confirmed by nucleotide sequencing (Fig. S3) using primers as described previously (Santhosh et al., 2009). Specific infectivity of in vitro transcribed RNA of different clones was found to be comparable (Table S2). The titer of all the viruses was 4108 PFU/ml. For oral infection to mosquitoes, all these viruses were used at a titer of 108 PFU/ml.

Table 1 Primers used for construction of mutations in Chikungunya virus infectious clone. Gene Mutation Primer Id Sequence (5′ to 3′) E1

V226A

V226AF V226AR

CAGAGACCGGCTGCGGGTACGGTACAC GTGTACCGTACCCGCAGCCGGTCTCTG

E1

K211E

K211EF K211ER

AAGTCGCACACCTGAGAGTGAGGACGTCTATGCTAATACAC GTGTATTAGCATAGACGTCCTCACTCTCAGGTGTGCGACTT

E2

V264A

V264AF V264AR

TTCCGCTGGCAAATGCAACATGCAGGGTGCC GGCACCCTGCATGTTGCATTTGCCAGCGGAA

A. Agarwal et al. / Virology 497 (2016) 59–68

61

Fig. 1. Phylogenetic tree among CHIKV generated by Maximum-Likelihood method based on the nucleotide sequence of complete structural gene (3747 nucleotides). Bootstrap values are indicated at major nodes. Each strain is represented by its GenBank accession number, country of origin and year of isolation. Further name of provinces/ states were provided for the Indian isolates (Due to non availability of nucleotide sequence of complete structural gene, New Delhi isolates are not included in phylogenetic tree).

Table 3 Selection pressure analysis of CHIKV genome datasets using SLAC, FEL, MEME and FUBAR. Amino acid position (ORF)

E2 3060 E1 3493 3508

Amino acid position (Protein)

SLAC

FEL

MEME

FUBAR

dN-dS

p-value

dN-dS

p-value

ω

p-value

dN-dS

Post. Pr.

264

3.613

0.667

1.124

0.434

4 100

0.079

 0.271

0.278

211 226

17.178 3.613

0.207 0.571

11.150 0.175

0.048 0.981

4 100 4 100

0.023 0.001

2.465 0.120

0.928 0.447

Criteria to consider sites with significant evidence of positive selection: p-value o 0.1 in SLAC, FEL and MEME, and posterior probability 40.9 in FUBAR. Sites with significant evidence of positive selection are written in bold font. Significant p-value and posterior probability are written in bold font.

2.7. Effect of mutations on CHIKV infection, dissemination and transmission in Ae. aegypti and Ae. albopictus mosquitoes The viral RNA titers of different mutants are provided in Table S3. Infection and dissemination rates of different mutant viruses in background of 226A/V in Ae. aegypti and Ae. albopictus at 108 PFU/ ml dose were 100%, however the transmission rates were variable, which are shown in Fig. S4.

significantly higher compared to 226V (p¼ 0.04) (Fig. 3a). In Ae. albopictus, titer of 226A and 226V in midgut were comparable (p ¼0.82) at day 7 pi. However at day 14 pi, titer of 226V was significantly higher compared to 226A (p ¼0.001). At day 7 pi, titer of 226A and 226V in legs and wings of Ae. albopictus were comparable (p¼ 0.11). However, at day 14 pi, titer of 226 V was significantly higher compared to 226A (p¼ 0.03). Compared to 226A, the titer of 226V was significantly higher at both day 7 (p ¼0.003) and 14 pi (p ¼0.04) in saliva of Ae. albopictus (Fig. 3b).

2.7.1. Effect of E1:226A vs. E1:226V in Ae. aegypti and Ae. albopictus In Ae. aegypti, RNA titer of 226A and 226V in midgut were comparable (p¼ 0.48 and p ¼0.31) at day 7 and 14 pi. The titer of 226A in legs and wings of Ae. aegypti was significantly higher compared to 226V at both day 7 (p¼ 0.005) and 14 pi (p ¼0.05). At day 7 pi, titer of 226A and 226V in saliva of Ae. aegypti were comparable (p ¼0.46). However at day 14 pi, titer of 226A was

2.7.2. Effect of E1:K211E in background of E1:226A vs. E1:226V in Ae. aegypti and Ae. albopictus In Ae. aegypti, introduction of K211E mutation in 226A virus increased midgut titer by 6 fold (p¼ 0.13), legs and wings titer by 6.5 fold (p¼ 0.19) and saliva titer by 12 fold (p ¼0.21) at day 14 pi. Introduction of K211E mutation in 226V virus, did not significantly

62

A. Agarwal et al. / Virology 497 (2016) 59–68

Fig. 2. Superimposition homology model of non-mutated and mutated E1 and E2 protein of CHIKV (E1:A226V, E1:K211E, E2:V264A). Different domains in these secondary structures are indicated. E1 and E2 gene consisted of three domains: I–III and A–C respectively. Amino acid mutation site is highlighted as CPK format as indicated by green color (non-mutated) and red color (mutated) in native E1 and E2 structures.

affect midgut, legs and wings and saliva titer (Fig. 4a). In Ae. albopictus, introduction of E1:K211E in background of either 226A or 226V did not lead to any significant difference in midgut, legs and wings and saliva titer at either day of post infection (Fig. 4b). 2.7.3. Effect of E2:V264A in background of E1:226A vs. E1:226V in Ae. aegypti and Ae. albopictus In Ae. aegypti, introduction of V264A mutation in 226A virus increased midgut titer by 4.5 fold (p ¼0.25), legs and wings titer by 5 fold (p ¼ 0.28) and saliva titer by 3.5 fold (p¼ 0.50) at day 14 pi. Introduction of V264A mutation in 226V virus, did not significantly affect midgut, legs and wings and saliva titer (Fig. 4a). In Ae. albopictus, introduction of E2:V264A in background of either 226A or 226V did not lead to any significant difference in midgut, legs and wings and saliva titer at either day of post infection (Fig. 4b). 2.7.4. Combined effect of E1:K211E and E2:V264A in background of E1:226A vs. E1:226V in Ae. aegypti and Ae. albopictus In Ae. aegypti, introduction of K211E, V264A mutations in 226A virus increased midgut titer by 13 fold (p ¼ 0.04), legs and wings titer by 15 fold (p ¼0.04) and saliva titer by 62 fold (p ¼0.04) at day 14 pi. Introduction of K211E and V264A mutation in 226V virus, did not significantly affect midgut, legs and wings and saliva titer (Fig. 4a). In Ae. albopictus, introduction of E1:K211E and E2:V264A in background of either 226A or 226V did not lead to any significant difference in midgut, legs and wings and saliva titer at either day of post infection (Fig. 4b).

2.8. Infection, dissemination and transmission rates at different doses of mutant CHIKV in Ae. aegypti At 108 PFU/ml, infection and dissemination rates were found to be 100%. Transmission rate was found to increase from 81% to 100% upon double mutation. At 106 PFU/ml, infection rate increased from 81% to 93%, dissemination rate increased from 50% to 75% and transmission rate increased from 31% to 56% upon double mutation. At 104 PFU/ml, infection rate increased from 31% to 81% (p ¼0.01), dissemination rate increased from 18% to 62% (p ¼0.02) and transmission rate increased from 12% to 56% (p¼ 0.02) upon double mutation (Fig. 5).

3. Discussion CHIKV outbreaks in both old and new world with novel mutations raise grave concerns among public health officials and researchers. Recent mutational analysis of CHIKV isolates from 2005 to 2011 revealed co-circulation of both E1:226A and E1:226V strains, generating firm evidence of the circulation of these mutants in different parts of the world (Kumar et al., 2014). However, despite of the abundance of Ae. albopictus in south east Asia, E1:226V was not noticed in background of Asian lineage. It is due to the epistatic interaction of E1:226A with E1:98T residue that is limiting the penetrance of 226V adaptation in Ae. albopictus (Tsetsarkin et al., 2011). The distribution pattern of Ae. aegypti and Ae. albopictus mosquitoes in India can be viewed in terms of entomological data provided by several research groups. Ae. aegypti is present

A. Agarwal et al. / Virology 497 (2016) 59–68

63

Fig. 3. Effect of E1:226A vs. E1:226V in (a) Ae. aegypti (b) Ae. albopictus. Viral load in mosquitoes after CHIKV infection was determined at day 7, 14 pi. For infection and dissemination rates, mosquito organs were homogenized, clarified supernatant was used for viral RNA extraction and then quantitative real time RT PCR was carried out. For transmission analysis, saliva was used. Viral RNA titer is expressed in terms of log10 RNA copies/midgut or legs and wings or saliva. Results are expressed as mean 7 SD of 2 independent experiments. The asterisk indicates statistical significance (*p value o 0.05).

throughout India (Angel and Joshi, 2009; Mariappan et al., 2013; Pramanik et al., 2007). However, the relative abundance of Ae. albopictus is very high in north eastern belt and southern India (Kumar et al., 2012; Niyas et al., 2010). The extensive rubber plantation in Kerala supports the breeding of Ae. albopictus (Kumar et al., 2008). In view of this, we tried to evaluate the differential transmission of E1:226A and 226V in Ae. aegypti and Ae. albopictus mosquitoes. Different epistatic mutations in E1 and E2 of CHIKV affecting vector adaptation have already been reported. However, a thorough analysis of CHIKV revealed the consistent presence of E2: G60D and E2:I211T in all recent ECSA, including CHIKV circulating in both northern and southern India. Their role in adaptation of CHIKV to Ae. aegypti and Ae. albopictus has been earlier reported (Tsetsarkin et al., 2009). After E1:226V mutation, several secondstep mutations like K233E, R198Q and K252Q led to lineage diversification. Out of these, K252Q was found to affect dissemination in Ae. albopictus significantly (Tsetsarkin et al., 2014). Another epistatic mutation, E2:L210Q in background of E1:226V was reported only from Ae. albopictus dominant areas of Kerala (Niyas et al., 2010) and Odisha (Das et al., 2012) from 2009 onwards. The role of this adaptive mutation (E2:L210Q) in efficient vector switching has also been identified (Tsetsarkin and Weaver, 2011). All these mutations are consistently absent in recent Indian isolates from New Delhi, Tamil Nadu and West Bengal (Shrinet et al., 2012; Sumathy and Ella, 2012; Taraphdar and Chatterjee, 2015) where E1:226A is still circulating. Our results confirmed high susceptibility of Indian Aedes mosquitoes for both E1:226A and 226V mutants of CHIKV. The replication of 226V in Indian Ae. albopictus revealed significantly higher midgut infectivity, dissemination and transmission compared to 226A. This higher transmission of 226V in Ae. albopictus

might be due to efficient midgut colonization, better dissemination and efficient crossing of salivary gland barriers. The role of E1:226V in efficient infection of Ae. albopictus midgut has been previously demonstrated (Tsetsarkin et al., 2007). In contrast, though replication of 226A and 226V is similar in midgut of Ae. aegypti, but 226A showed higher dissemination as well as transmission compared to 226V as revealed by both higher viral RNA titer in saliva as well as transmission rates. This might have resulted due to efficient crossing of midgut escape barrier of Ae. aegypti by 226A compared to 226V. These results demonstrated the higher transmission potential of Indian Ae. aegypti for E1:226A mutant. This preferential transmission in Ae. aegypti might have sustained major CHIKV outbreaks so far, without resorting to further mutation from 226A to 226V. In contrast, 226V mutation was retained in Ae. albopictus dominant areas from 2007 onwards. Recent report regarding an imported and autochthonous case, caused limited 226A transmission in southeastern France in 2010, where Ae. albopictus is the dominant species provides support to our findings. The imported CHIKV with 226A from India failed to be efficiently transmitted by local Ae. albopictus (Grandadam et al., 2011). On the contrary, the importation of same virus with 226A from northern India to Ae. aegypti infested area of southern Bhutan, resulted in a major outbreak (Wangchuk et al., 2013). This correlates with our experimental results where 226A showed better transmissibility in Ae. aegypti compared to Ae. albopictus. Though India witnessed major outbreaks in last decade, the distinct circulation of 226A and 226V can be linked to the geographical segregation of their respective vectors that facilitates higher transmission. Two novel mutations E1:K211E and E2:V264A were found in all samples of Delhi in late 2010 (Shrinet et al., 2012). CHIKV isolates from Andhra Pradesh and Tamil Nadu also harbored these two

64

A. Agarwal et al. / Virology 497 (2016) 59–68

Fig. 4. Effect of single mutation (either E1:K211E or E2:V264A) and double mutations (E1:K211E and E2:V264A) in background of E1:226A vs. E1:226V in (a) Ae. aegypti (b) Ae. albopictus. Viral load in mosquitoes after CHIKV infection was determined at day 7, 14 pi. For infection and dissemination rates, mosquito organs were homogenized, clarified supernatant was used for viral RNA extraction and then quantitative real time RT PCR was carried out. For transmission analysis, saliva was used. Viral RNA titer is expressed in terms of log10 RNA copies/midgut or legs and wings or saliva. Results are expressed as mean7 SD of 2 independent experiments. The asterisk indicates statistical significance (*p value o0.05).

mutations (Sumathy and Ella, 2012). E1:K211E and E2:V264A mutations were also found in both imported and autochthonous strains of CHIKV in Southeastern France in 2010 (Grandadam et al., 2011). Selection pressure analysis revealed that both these sites are under significant positive selection. It is also important to mention that all the samples containing these two novel mutations are present in background of E1:226A and in Ae. aegypti dominated areas. So, this was an interesting experiment to investigate the role

of these two mutations which are under significant positive selection in increasing transmission and fitness of Aedes mosquitoes. Our results demonstrated that introduction of E1:K211E or E2: V264A mutation in background of 226A, led to increased infectivity, dissemination and transmission in Ae. aegypti. However, in Ae. albopictus no such difference was observed. Introduction of E1:K211E or E2:V264A mutation in background of 226V did not correspond to fitness change in either of the Aedes species.

A. Agarwal et al. / Virology 497 (2016) 59–68

65

Fig. 5. Infection, dissemination and transmission rates of different mutant CHIKV in Ae. aegypti at 108, 106, 104 PFU/ml doses (corresponding to the blood meal titer of 3.3  107 PFU/ml, 3.3  105 PFU/ml, 3.3  103 PFU/ml). For infection and dissemination rates, mosquito organs were homogenized, clarified supernatant was used for viral RNA extraction and then quantitative real time RT PCR was carried out. For transmission analysis, saliva was used. Number of midgut, legs and wings and saliva positive for CHIKV was determined at day 14 pi and expressed in percentage. Results are expressed as mean 7SD of 2 independent experiments. Significant increase in infection, dissemination and transmission rate upon mutation is indicated by asterisk (*p value o 0.05).

Combined expression of E1:K211E and E2:V264A in background of E1:226A revealed higher fitness for Ae. aegypti, that was measured in terms of increased infectivity, dissemination and transmission. However, in Ae. albopictus no difference was observed. It is interesting to point out that the mutant strain E1:226V which was responsible for causing massive outbreaks in Ae. albopictus dominated areas of southern India since 2007, has not yet acquired these novel mutations. The negative effect of these mutations in background of E1:226A/V on Ae. albopictus fitness can be easily viewed in terms of decreased or non-significant difference in infection, dissemination or transmission potential. This may explain the non transmission of these new mutants by Ae. albopictus population. Upon double mutation, in background of E1:226A, fitness was increased in Ae. aegypti for CHIKV at day 14 pi. Though biological variation in the different datasets was observed in this study, however statistically significant difference was observed between 226A and double mutant virus in Ae. aegypti confirming the biological relevance. Further experiments with two lower doses: 106 PFU/ml and 104 PFU/ml also revealed significantly higher infection, dissemination and transmission rates. The appearance of novel mutations E1:K211E and E2:V264A in the background of E1:226A in Ae. aegypti dominated areas can be correlated to very high infection, dissemination and transmission rates of double mutant virus compared to parental E1:226A strain in this study. These adaptive mutations might have helped in persistence of E1:226A virus in India, rather than undergoing mutation to E1:226V as observed in Ae. albopictus dominated areas of many parts of the world including southern India since 2007. Molecular mechanisms involving selection of these mutations is unknown. However, in literature some of the mechanisms have been proposed. Substitution of lysine by glutamic acid at 211 position of E1 protein might be facilitating low pH mediated endosomal entry (Voss et al., 2010). Another E2 substitution V264A might be indirectly enhancing E2-E1 heterodimer dissociation leading to improved fusion with host membrane as reported previously for other mutations (Tsetsarkin et al., 2014). Alternative hypothesis involves presence of specific receptors on midgut

epithelium of a particular Aedes species leading to improved viral colonization (Arias-Goeta et al., 2013). In conclusion, expansion of geographical range of Aedes mosquitoes coinciding with spread of CHIKV warrants study of differential vector competence and transmission of different viral mutants. The present study clearly revealed higher transmission potential of 226A and 226V by Ae. aegypti and Ae. albopictus respectively. Novel adaptive mutations E1:K211E and E2:V264A in the background of E1:226A are highly favorable in Ae. aegypti, which is responsible for facilitating efficient virus circulation, further contributing to expanded CHIK outbreaks.

4. Materials and methods 4.1. Cells Vero, C6/36 and BHK-21 cells were procured from National Center for Cell Sciences (NCCS, Pune, India). Vero cells were maintained in Eagle's Minimal Essential Medium (EMEM) (Sigma, USA) supplemented with 10% fetal bovine serum (Sigma, USA) and 2 mM L-glutamine. EMEM was additionally supplemented with 10% Tryptose phosphate broth (Sigma, USA) for C6/36 cells. BHK21cells were maintained in Dulbecco's Minimal Essential Medium (DMEM) (Sigma, USA). 4.2. Rescue of CHIKV infectious clone CHIKV strain 06-049 (GenBank accession no. AM258994) was obtained from serum of a febrile patient from Saint-Louis, Reunion in 2006 (Schuffenecker et al., 2006). The virus was isolated in Aedes pseudoscutellaris cells and RNA was used as the template for an infectious clone (Coffey and Vignuzzi, 2011). Plasmid harboring full length CHIKV infectious clone CHIKVFLICSacIImutLC was a kind gift from Drs. M. Vignuzzi and L. Coffey, Institut Pasteur, Paris. The infectious clone contains amino acid Valine (V) at E1:226 position. Similar CHIKV strain harboring E1:226V was found

66

A. Agarwal et al. / Virology 497 (2016) 59–68

widely circulating in many parts of Indian Ocean islands, India and Italy during 2006-07. 100 ng of pBR-322 encoding full length CHIKV genome was transformed into Escherichia coli DH5α cells. Transfection grade plasmid was then purified from E. coli DH5α culture using EndoFree Plasmid Maxi kit (Qiagen, Germany). 5 mg of purified plasmid was linearized with Not I enzyme (Roche, USA). Linearized DNA was in vitro transcribed from SP6 promoter using mMESSAGE mMACHINE kit (Ambion, USA). 10 mg RNA was then electroporated into BHK-21 cells using Gene Pulser XCell electroporator (Bio-Rad, USA) at 1.2 kV. Electroporated BHK-21 cells were then incubated at 37 °C in a 5% CO2 incubator. At 24, 48 h post electroporation, 400 ml supernatant was harvested. The titration of the rescued virus was done by plaque assay in Vero cells (Flint et al., 2004). 4.3. Identification of sites in Chikungunya virus structural protein for constructing mutations through molecular phylogeny and selection pressure analysis Important adaptive mutations in CHIKV genome (structural polyprotein) were identified on the basis of comparative analysis of large number of CHIKV sequences derived from recent outbreaks. For phylogenetic analysis, nucleotide sequence of complete structural gene (3747 nucleotides) of representative CHIKV of diverse geographical origins including from recent Indian outbreaks were retrieved from GenBank and aligned employing MUSCLE. Phylogenetic analysis was conducted using MEGA version 5.03 (Tamura et al., 2011). A Maximum-Likelihood tree was constructed employing TN93 þG þI model and confirmed through 1000 replicates of the dataset. For selection pressure analysis, multiple sequence alignment algorithm based on ClustalW was used. Selection pressure acting on individual codons of the ORF was assessed by preparing a dataset comprising of 125 CHIKV sequences (Table S1), retrieved from NCBI GenBank. Closely related sequences (4 99.9% nucleotide identity) and sequences having ambiguous characters were removed. Non coding sequences between the structural and non structural ORFs and stop codons were removed. The analysis was carried out using HyPhy open-source software package provided under the Datamonkey web-server (http://www.datamonkey.org/) (Delport et al., 2010). The ratio of non-synonymous (dN) to synonymous (dS) substitutions per site (dN/dS) were estimated using four different approaches including single-likelihood ancestor counting (SLAC), fixed effects likelihood (FEL), mixed effects model of evolution (MEME) and fast unbiased Bayesian approximation (FUBAR). In case of SLAC, FEL and MEME, sites with p-value o 0.1 and in FUBAR, posterior probability 40.9 are considered significantly positive. Three adaptive mutations were shortlisted on the basis of selection pressure analysis and mutational analysis of CHIKV isolates from recent outbreaks in India.

4.5. Generation of CHIKV mutants Mutant CHIKV was generated using 10 ng plasmid of CHIKV infectious clone containing 226V as template in a mutagenic PCR using QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, USA). Mutagenic primers were designed through QuikChange Primer Design tool (www.genomics.agilent.com). Primer sequences are provided in Table 1. Mutations were sequentially constructed. First, E1:226A mutation was created. Further mutations E1:K211E and E2:V264A were generated in background of both 226A and 226V to generate CHIKV with following mutations: 1. E1:K211E and E1:226A 2. E1:K211E and E1:226V 3. E2:V264A and E1:226A 4. E2:V264A and E1:226V 5. E1:K211E and E2:V264A in background of 226A 6. E1:K211E and E2:V264A in background of 226V. The reaction was carried out as per manufacturer's instructions. 1 ml of Dpn I was then added in reaction mixture to degrade parental methylated strand. 2 ml of Dpn I treated DNA was added to XL10-Gold ultracompetent cells for transformation. Confirmed colonies were processed for virus rescue as described earlier. All rescued viruses were confirmed by nucleotide sequencing prior to use. 4.6. Determination of specific infectivity Specific infectivity of in vitro transcribed RNA of different clones was determined. For this, cell supernatant (from electroporated BHK-21 cells) containing different mutant CHIKV were titrated by plaque assay in Vero cells (Flint et al., 2004). 4.7. Propagation and titration of mutant viruses C6/36 cells were seeded in 75 cm2 flask to 75–80% confluency. Cells were rinsed with PBS and cell supernatant (from electroporated BHK-21 cells) containing different mutant CHIKV were allowed to infect the C6/36 cells. Following adsorption for 2 h at 37 °C, cells were washed with PBS. Fresh EMEM medium containing 2% FBS was added and cells were incubated at 32 °C for 3 days. Cell control was kept alongside. After visualization of cytopathic effect, cell culture supernatant was harvested and titrated by plaque assay in Vero cells (Flint et al., 2004). 4.8. Mosquitoes Ae. aegypti and Ae. albopictus were field collected from Gwalior district, Madhya Pradesh, India and maintained as laboratory colony in Vector Management Division, Defense Research and Development Establishment (DRDE), Gwalior at 28 72 °C with 80% relative humidity and 14:10 light:dark photo period. The larval stages were maintained in enamel bowl filled with tap water and yeast tablets were added as larval food. After pupation, the pupae were collected and kept in a closed cage. Adult mosquitoes were provided with 10% sucrose solution soaked in cotton pads.

4.4. Structural modeling

4.9. Oral infection of mosquitoes and mosquito processing

Modeler version 9.1 was used for comparative homology modeling of E1 and E2 proteins. Amino acid sequence of CHIKV E1 and E2 proteins (Protein Id: CAJ90479) of infectious clone strain were downloaded from NCBI and template was created by mutating the respective residues (E1:A226V, E1:K211E and E2: V264A). Superimposition of 226A and 226V of E1 protein, 211K and 211E of E1 protein, 264V and 264A of E2 protein were analyzed by UCSF Chimera. Superimposed model was then visualized through Discovery studio version 4.1. The selected mutations (A226V, K211E and V264A) identified in the study were highlighted as CPK format.

4–5 days old female Ae. aegypti and Ae. albopictus (at generation level of 15 and 17 respectively) were starved for 24 h prior to infectious blood meal. The infectious blood meal was prepared by adding 1 ml of CHIK culture supernatant in 2 ml of washed rabbit erythrocytes. The titer of all the mutant viruses was found to be 4108 PFU/ml. Therefore for comparison of viral titers, viruses were provided similarly at the titer of 108 PFU/ml to all groups. For comparison of infection, dissemination and transmission rates, viruses were provided at three different doses of 108 PFU/ml, 106 PFU/ml and 104 PFU/ml leading to the final respective concentrations of 3.3  107 PFU/ml, 3.3  105 PFU/ml, 3.3  103 PFU/ml of

A. Agarwal et al. / Virology 497 (2016) 59–68

CHIKV in blood meal. Mosquitoes were orally infected through a hemotek feeding membrane (Discovery workshops, Accrinton, UK) covering the base of glass feeder, connected to a water circulator, maintained at 37 °C. The blood-virus mixture (ratio 2:1) containing 5 mM ATP (as a phagostimulant) is added on the membrane from the top of the feeder. Fully engorged females were transferred to small cardboard containers and provided with 10% sucrose up to 7 and 14 days. Immediately after the feeding process, two fully engorged Ae. aegypti and Ae. albopictus were collected to titrate the virus imbibed and marked as day 0. Blood meal was also back titrated to confirm the viral titer. Ae. aegypti and Ae. albopictus were processed individually on day 7 and 14 post infection (pi) to determine infection, dissemination and transmission rate as well as viral titer in different organs and saliva as described previously (Agarwal et al., 2013). 4.10. Extraction of viral RNA and real time RT-PCR Viral RNA was extracted from 100 ml of clarified homogenate of individual midgut and legs and wings and 100 ml EMEM containing saliva of orally infected individual Ae. aegypti and Ae. albopictus mosquito using QIAamp viral RNA mini kit (Qiagen, Germany) according to the manufacturer’s protocol. The RNA was finally eluted in 50 ml elution buffer and stored at  80 °C until use. SYBR Green I based one step real time quantitative RT-PCR was performed and RNA copies/mosquito organ were determined from standard curve as described previously (Agarwal et al., 2013). 4.11. Statistical analysis Viral titer is expressed in terms of log10 RNA copies/midgut or legs and wings or saliva (mean7standard deviation). Infection, dissemination, transmission rates are expressed as percentage. Fold changes were calculated upon single and double mutation with respect to parental virus. Results are represented as mean values of 16 mosquitoes obtained from two independent experiments (n¼ 8 mosquitoes/experiment). Comparison between the groups was done separately at day 7 and 14 pi by t-test (unpaired, two-tailed) and One way ANOVA (Bonferroni and Holm multiple comparison). Number of infected mosquitoes was compared by Fisher’s exact test. The asterisk indicates statistical significance (*p value o0.05).

Conflict of interest The authors declare no conflict of interest.

Acknowledgments This work was funded by Defence Research Development Organization, Ministry of Defence, Govt. of India. We thank Dr. Lokendra Singh, Director, DRDE for his keen interest and support in this study. We thankfully acknowledge Drs. L. Coffey and M. Vignuzzi, Institut Pasteur, Paris, France for providing CHIKV infectious clone for this study. We also thank Dr. Gaurav Joshi, Texas Tech University, Lubbock, Texas for homology modeling. Ankita Agarwal thanks Department of Biotechnology (DBT), Govt. of India for providing fellowship and contingency grants. Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.virol.2016.06.025.

67

References Agarwal, A., Singh, A.K., Sharma, S., Soni, M., Thakur, A.K., Gopalan, N., Parida, M.M., Rao, P.V., Dash, P.K., 2013. Application of real-time RT-PCR in vector surveillance and assessment of replication kinetics of an emerging novel ECSA genotype of Chikungunya virus in Aedes aegypti. J. Virol. Methods 193, 419–425. Angel, B., Joshi, V., 2009. Distribution of dengue virus types in Aedes aegypti in dengue endemic districts of Rajasthan, India. Indian J. Med. Res. 129, 665–668. Arias-Goeta, C., Mousson, L., Rougeon, F., Failloux, A.B., 2013. Dissemination and transmission of the E1–226V variant of chikungunya virus in Aedes albopictus are controlled at the midgut barrier level. PLoS One 8, e57548. Coffey, L.L., Vignuzzi, M., 2011. Host alternation of Chikungunya virus increases fitness while restricting population diversity and adaptability to novel selective pressures. J. Virol. 85, 1025. Das, B., Sahu, A., Das, M., Patra, A., Dwibedi, B., Kar, S.K., Hazra, R.K., 2012. Molecular investigations of Chikungunya virus during outbreaks in Orissa, Eastern India in 2010. Infect. Genet. Evol. 12 (5), 1094–1101. Delport, W., Poon, A.F., Frost, S.D., 2010. Datamonkey 2010: a suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics 26, 2455–2457. Duong, V., Andries, A.C., Ngan, C., Sok, T., Richner, B., Asgari-Jirhandeh, N., Bjorge, S., Huy, R., Ly, S., Laurent, D., Hok, B., Roces, M.C., Ong, S., Char, M.C., Deubel, V., Tarantola, A., Buchy, P., 2012. Reemergence of Chikungunya virus in Cambodia. Emerg. Infect. Dis. 18, 2066–2069. Flint, S.J., Enquist, L.W., Racaniello, V.R., Skalka, A.M., 2004. Principles of Virology: Molecular Biology, Pathogenesis and Control of Animal viruses, 2nd edition. ASM Press, Washington, D.C, pp. 31–32. Grandadam, M., Caro, V., Plumet, S., Thiberge, J.M., Souares, Y., Failloux, A.B., Tolou, H.J., Budelot, M., Cosserat, D., Leparc-Goffart, I., Despres, P., 2011. Chikungunya virus, Southeastern France. Emerg. Infect. Dis. 17, 910–913. Kraemer, M.U., Sinka, M.E., Duda, K.A., Mylne, A.Q., Shearer, F.M., Barker, C.M., Moore, C.G., Carvalho, R.G., Coelho, G.E., Van Bortel, W., Hendrickx, G., Schaffner, F., Elyazar, I.R., Teng, H.J., Brady, O.J., Messina, J.P., Pigott, D.M., Scott, T.W., Smith, D.L., Wint, G.R., Golding, N., Hay, S.I., 2015. The global distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. Elife 4, e08347. Kumar, A., Mamidi, P., Das, I., Nayak, T.K., Kumar, S., Chhatai, J., Chattopadhyay, S., Suryawanshi, A.R., Chattopadhyay, S., 2014. A novel 2006 Indian outbreak strain of Chikungunya virus exhibits different pattern of infection as compared to prototype strain. PLoS One 9, e85714. Kumar, N.P., Joseph, R., Kamaraj, T., Jambulingam, P., 2008. A226V mutation in virus during the 2007 Chikungunya outbreak in Kerala, India. J. Gen. Virol. 89, 1945–1948. Kumar, N.P., Sabesan, S., Krishnamoorthy, K., Jambulingam, P., 2012. Detection of Chikungunya virus in wild populations of Aedes albopictus in Kerala State, India. Vector Borne Zoonotic Dis. 12, 907–911. de Lamballerie, X., Leroy, E., Charrel, R.N., Ttsetsarkin, K., Higgs, S., Gould, E.A., 2008. Chikungunya virus adapts to tiger mosquito via evolutionary convergence: a sign of things to come? Virol. J. 5, 33. Mariappan, T., Muniaraj, M., Victor Jerald Leo, S., Sathish Babu, R., Dhananjeyan, K.J., Rajamannar, V., Tewari, S.C., Manavalan, R., Munirathinam, A., Krishnamoorthy, R., Philip Samuel, P., Paramasivan, R., Arunachalam, N., Tyagi, B.K., 2013. Entomological investigation of Chikungunya outbreaks in a few sites in Tamil Nadu during 2010. Natl. Med. J. India 26, 249–250. Ng, L.C., Hapuarachchi, H.C., 2010. Tracing the path of Chikungunya virus-evolution and adaptation. Infect. Genet. Evol. 10, 876–885. Niyas, K.P., Abraham, R., Unnikrishnan, R.N., Mathew, T., Nair, S., Manakkadan, A., Issac, A., Sreekumar, E., 2010. Molecular characterization of Chikungunya virus isolates from clinical samples and adult Aedes albopictus mosquitoes emerged from larvae from Kerala, South India. Virol. J. 13 (7), 189. Pramanik, M.K., Aditya, G., Raut, S.K., 2007. Seasonal prevalence of Aedes aegypti immatures in Kolkata, India. Southeast Asian J. Trop. Med. Public Health 38, 442–447. Ray, P., Ratagiri, V.H., Kabra, S.K., Lodha, R., Sharma, S., Sharma, B.S., Kalaivani, M., Wig, N., 2012. Chikungunya infection in India: results of a prospective hospital based multi-centric study. PLoS One 7, e30025. Rezza, G., Nicoletti, L., Angelini, R., Romi, R., Finarelli, A.C., Panning, M., Cordioli, P., Fortuna, C., Boros, S., Magurano, F., Silvi, G., Angelini, P., Dottori, M., Ciufolini, M. G., Majori, G.C., Cassone, A., 2007. Infection with Chikungunya virus in Italy: an outbreak in a temperate region. Lancet 370, 1840–1846. Santhosh, S.R., Dash, P.K., Parida, M., Khan, M., Rao, P.V., 2009. Appearance of E1: A226V mutant Chikungunya virus in Coastal Karnataka, India during 2008 outbreak. Virol. J. 27, 172. Schuffenecker, I., Iteman, I., Michault, A., Murri, S., Frangeul, L., Vaney, M.C., Lavenir, R., Pardigon, N., Reynes, J.M., Pettinelli, F., Biscornet, L., Diancourt, L., Michel, S., Brisse, S., 2006. Genome microevolution of Chikungunya viruses causing the Indian Ocean outbreak. PLoS Med. 3, e263. Shrinet, J., Jain, S., Sharma, A., Singh, S.S., Mathur, K., Rana, V., Bhatnagar, R.K., Gupta, B., Gaind, R., Deb, M., Sunil, S., 2012. Genetic characterization of Chikungunya virus from New Delhi reveal emergence of a new molecular signature in Indian isolates. Virol. J. 9, 100. Singh, R.K., Tiwari, S., Mishra, V.K., Tiwari, R., Dhole, T.N., 2012. Molecular epidemiology of Chikungunya virus: mutation in E1 gene region. J. Virol. Methods 185, 213–220. Sumathy, K., Ella, K.M., 2012. Genetic diversity of Chikungunya virus, India 2006– 2010: Evolutionary dynamics and serotype analyses. J. Med. Virol. 84, 462–470. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:

68

A. Agarwal et al. / Virology 497 (2016) 59–68

molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Taraphdar, D., Chatterjee, S., 2015. Molecular characterization of Chikungunya virus circulating in urban and rural areas of West Bengal, India after its re-emergence in 2006. Trans. R. Soc. Trop. Med. Hyg. 109, 197–202. Tesh, R.B., Gubler, D.J., Rosen, L., 1976. Variation among goegraphic strains of Aedes albopictus in susceptibility to infection with chikungunya virus. Am. J. Trop. Med. Hyg. 25, 326–335. Tsetsarkin, K.A., Weaver, S.C., 2011. Sequential adaptive mutations enhance efficient vector switching by Chikungunya virus and its epidemic emergence. PLoS Pathog. 7, e1002412. Tsetsarkin, K.A., Vanlandingham, D.L., McGee, C.E., Higgs, S., 2007. A single mutation in Chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog. 3, e201. Tsetsarkin, K.A., McGee, C.E., Volk, S.M., Vanlandingham, D.L., Weaver, S.C., Higgs, S.,

2009. Epistatic roles of E2 glycoprotein mutations in adaption of Chikungunya virus to Aedes albopictus and Ae. aegypti mosquitoes. PLoS One 4, e6835. Tsetsarkin, K.A., Chen, R., Leal, G., Forrester, N., Higgs, S., Huang, J., Weaver, S.C., 2011. Chikungunya virus emergence is constrained in Asia by lineage-specific adaptive landscapes. Proc. Natl. Acad. Sci. USA 108, 7872–7877. Tsetsarkin, K.A., Chen, R., Yun, R., Rossi, S.L., Plante, K.S., Guerbois, M., Forrester, N., Perng, G.C., Sreekumar, E., Leal, G., Huang, J., 2014. Multi-peaked adaptive landscape for chikungunya virus evolution predicts continued fitness optimization in Aedes albopictus mosquitoes. Nat. Commun. 5, 4084. Voss, J.E., Vaney, M.C., Duquerroy, S., Vonrhein, C., Girard-Blanc, C., Crublet, E., Thompson, A., Bricogne, G., Rey, F.A., 2010. Glycoprotein organization of Chikungunya virus particles revealed by X-ray crystallography. Nature 468, 709–712. Wangchuk, S., Chinnawirotpisan, P., Dorji, T., Tobgay, T., Dorji, T., Yoon, I., Fernandez, S., 2013. Chikungunya fever outbreak, Bhutan, 2012. Emerg. Infect. Dis. 19, 1681–1684.