Two versatile eukaryotic expression vectors permitting epitope tagging, radiolabelling and nuclear localisation of expressed proteins

Gene, 168 (1996) 165-167 © 1996 Elsevier Science B.V. All rights reserved. 0378-1119/96/$15.00

165

G E N E 09467

Short Communications

Two versatile eukaryotic expression vectors permitting epitope tagging, radiolabelling and nuclear localisation of expressed proteins (FLAG tag; heart muscle kinase; in vitro transcription; in vitro translation)

Oleg Georgiev, Jean-Pierre Bourquin, Matthias Gstaiger, Lea Knoepfel, Walter Schaffner and Christopher Hovens lnstitut ffir Molekular Biologie H, der Universitgit Zfirich, Winterthurerstrasse 190, CH-8057 Zfirich, Switzerland Tel. (41-1) 257-4908; Fax (41-1) 363-8502 Received by R.E. Yasbin: 26 April 1995; Revised/Accepted: 28 July/7 August 1995; Received at publishers: 19 October 1995

SUMMARY

Two versatile eukaryotic expression vectors have been developed which permit the production of an epitope-tagged cDNA insert by transient transfection in mammalian cells or by in vitro transcription-translation. The first vector, pCATCH, can be used to clone cDNA inserts in three different frames via eight unique restriction sites in a multiple cloning site (MCS) located downstream from both the FLAG epitope and the specific heart muscle kinase phosphorylation site, conferring the possibility of in vitro radiolabeUing. A specific protease cleavage site enables the removal of the FLAG epitope, simplifying affinity purification of recombinant CATCH proteins, pCATCH possesses stop codons in all three reading frames at the 3' terminal end of the MCS. A derivative of this vector, pCATCH-NLS, was constructed by incorporating an SV40 nuclear localisation signal upstream from the MCS, for directed localisation of the tagged proteins.

INTRODUCTION

In order to confirm whether two proteins can interact, it is often useful to transiently express cDNAs in mammalian cell lines and subsequently assay for protein-protein Correspondence to: Dr. C. Hovens at his present address: Institut ftir Medizinische Virologie, der Universit/~t Zi~rich, Gloriastrasse 30/32, CH-8028 Zt~rich, Switzerland. Tel. (41-1) 257-3766; Fax (41-1) 252-8107; e-mail: [email protected] Abbreviations: aa, amino acid(s); Ab, antibody(ies); bp, base pair(s); Bobl, B-cell-specific octamer factor binding protein; cDNA, complementary DNA; CMV, cytomegalovirus; EMSA, electrophoretic mobility shift assay; FLAG, short peptide marker sequence AspTyrLysAspAspAspAspLys; HMK, heart muscle kinase; kb, kilobase(s) or 1000 bp; Kozak, optimal mammalian consensus translation start sequence; MCS, multiple cloning site(s); NLS, nuclear localisation sequence; nt, nucleotide(s); oligo, oligodeoxyribonucletide; re-, recombinant; SV40, simian virus 40 large T antigen; TBE, 0.09 M Tris.borate/0.002 M EDTA buffer. SSDI 0378-1119(95)00764-4

interactions. To facilitate such analyses we have modified the eukaryotic expression vector pcDNA1/Amp (Invitrogen, San Diego, CA, USA) creating a vector with a number of features common to prokaryotic expression vectors (Blanar and Rutter, 1992; Huang et al., 1994; Pallisgaard et al., 1994) which permits these analyses to be performed. For optimal expression of constructs the vector has the strong constitutive promoter from CMV, along with an optimal mammalian consensus translation start sequence (Kozak) in the context of the initiator ATG codon. The highly immunogenic FLAG epitope permits the immunodetection of expressed proteins via readily available commercial monoclonal antibodies. This epitope also permits the possible purification of eukaryotic expressed proteins via a FLAG column. A protease cleavage signal permits removal of the FLAG epitope. Direct subcellular localisation of the expressed protein is also possible with the FLAG epitope. For analyses using the

166 t w o h y b r i d s y s t e m ( F i e l d s a n d S o n g , 1989) in an m a m m a -

EXPERIMENTAL AND DISCUSSION

lian c e l l u l a r b a c k g r o u n d , it is n e c e s s a r y to direct p r o t e i n s to the nucleus, h e n c e a d e r i v a t i v e of p C A T C H , pCATCH-NLS

called

(Fig. 1) was d e s i g n e d to e n a b l e this. A n

(a) Expression and analysis of re-proteins in the pCATCH system

8 - a a s e q u e n c e f r o m the S V 4 0 l a r g e T a n t i g e n n u c l e a r

I n o r d e r to c h e c k r e c o g n i t i o n of r e - p r o t e i n s in t h e

l o c a l i s a t i o n signal ( N L S ) is s i t u a t e d d o w n s t r e a m a n d in

C A T C H s y s t e m by t h e a n t i - F L A G e p i t o p e A b we c l o n e d

f r a m e to the F L A G

and HMK

sequences directing the

n u c l e a r a c c u m u l a t i o n of t a g g e d p r o t e i n s . S P 6 a n d T 7

anti-Flag

R N A p o l y m e r a s e t r a n s c r i p t i o n i n i t i a t i o n sites f l a n k b o t h

<

sides of the M C S p e r m i t i n g in v i t r o t r a n s c r i p t i o n a n d

0

;

anti-LacZ ,

t r a n s l a t i o n of inserts f r o m e i t h e r o r i e n t a t i o n .

pCATCH Hindlll ~7 ~

FLAG

gagacccaagcttggtaccgagctcggatc~ccaccatggactacaaAga~gatgac

enteroklnase

N HMK

BamHI

anti-Flag 4 supershifted 1

BOBl-Oct-1 complex D

EcoR!

Y

K

D

EcoRV

D

complex

Oct-1

D

BstX I

gataalg~aagaagagcat~t~ltgggatccccagaattctgcagatatccatcacac

D

K

A

R

R

Not I

A

S

V

G

S

Xhol Sphl Nsll

P

E

F

C

R

Y

P

S

H

Xbal

tggcggccgctcgagcatgcatctagttagtcagtctagactagctg~c~agagggc W ~ P L E H A S S * * * * *

cctattctatagtgt

~Sp6 %

pCATCH-NLS Hindlll 17 ~

FLAG

gagacccaagcttggtaccgagctcggatcaccaccatg~actaa&a~gacgatgac M D Y K D D D

enteroklnase SV4O NLS

HMK

BamHI

gat a a a g c a a g a a g a g c a t c t g t g g g a t c a c ~ g a a g a a g a a g c g a a a g g t a cggat c D K A R R A S V G S P K K K R K V R I

EcoRI

EcoRV

estX I

Not I

Xhol Sphl Nsil

cccagaat tctgcagatatccatcacact ggcggccgc tcgagcatgcat c t agt t a P R I L Q I s I T L A A A R A C I *

Xbal gtcagtctagactagctgactagagggcccagggcctattctatagtgt ~

free probe

Sp6

Fig. 1. Nucleotide and aa sequence of the pCATCH and pCATCHNLS MCS created by insertion of synthetic cassettes into pcDNA1/Amp. Stop codons are indicated by an asterisk. The Kozak sequence, FLAG epitope, enterokinase cleavage site, HMK phosphorylation site and the SV40 NLS (only in pCATCH-NLS) are as indicated. Methods:A 71-mer double stranded oligo encoding an Kozak sequence and FLAG and HMK sequences was inserted into the BamHI and EcoRI sites of pcDNAl/Amp such that the 5' BamHI site in the vector was destroyed and an additional BamHI site was recreated Y to the FLAG and HMK sequences. A STOP oligo (upper strand, 5'-CTAGTTAGTCAGTCTAGACTAGCTGA; lower strand, 5'-CTAGTCAGCTAGTCTAGACTGACTAA) encoding eukaryotic translation stop codons in all three frames was then inserted into the 3' XbaI site. We named this vector pCATCH. A derivative of this vector pCATCH-NLS was then constructed by inserting a 34-mer double stranded oligo encoding the 7-aa SV40 NLS into the 3' BamHl site of pCATCH. The BamHI-compatible ends of this oligo was once again constructed in such a way so as to destroy the 5' BamHI site and recreate the 3' site. The proper orientation and sequence identity of the inserted synthetic cassettes was confirmed by sequence analysis using two vector-specific T7 (5'-TAATACGACTCACTATA) and SP6 (5'-ATTTAGGTGACACTATA) oligo primers.

1

2

3

4

5

6

7

Fig. 2. An anti-FLAG Ab causes a supershift in EMSA with re-proteins produced in pCATCH. An octamer containing oligo of the Ig-~ promoter (Kemler et al., 1991) was used in EMSA with HeLa extracts (2~tl) containing Oct-1 and FLAG-tagged Bobl protein (4lxl) translated in vitro from pCATCH using rabbit reticulocyte lysates (Bobl RL). Triangles on the right of the gels indicate supershifted complexes. Lanes: 1, HeLa extract+Bobl RL; 2-4, HeLa extract+Bobl RL and increasing amounts of anti-FLAG Ab (M2); 2, 0.01 ng; 3, 0.1 ng; 4, l ng. Lanes 5-7 contain HeLa extract+Bobl RL+increasing amounts of anti-LacZ Ab; 5, 0.01 ng; 6, 0.1 ng; 7, 1 ng. Methods: Indicated amounts of nuclear extracts, reticulocyte lysates and pure proteins were preincubated for 15 min at room temperature. After addition of the bandshift buffer (Schreiber et al., 1993) containing an endlabelled oligo (10 fmol) with an octamer site from the Ig-~c (Kernler et al., 1991) promoter the reaction mix was incubated for a further 20 rain at room temperature before being loaded on a 4% polyacrylamide (1:19) gel (0.25 × TBE). Nuclear extracts from HeLa cells were prepared as described (Kemler et al., 1991). B obl cDNA was in vitro transcribed from pCATCH and in vitro translated using rabbit reticulocyte lysate (in a final reaction volume of 50 ~tl) according to the manufacturers conditions (Promega, Madison, WI, USA).

167 a 1-kb Bob1 cDNA clone (Gstaiger et al., 1995) into the

BamHI site of pCATCH, translated it in vitro and checked for binding of this protein to Oct-1 by bandshift assays. Binding of Bobl to Oct-1 causes a supershift of the Oct-1 complex (Gstaiger et al., 1995). Preincubation of the FLAG-tagged Bobl/Oct-1 complex with the antiFLAG Ab causes a further supershift of the complex confirming that the FLAG epitope in the re-Bobl protein is recognised by the anti-FLAG Ab (Fig. 2). In addition we have also confirmed that the pCATCH-NLS vector directs nuclear localisation through direct immunoflourescence of the FLAG epitope in transiently transfected HeLa cells (data not shown). (b) Conclusions

(1) We have constructed two versatile eukaryotic expression vectors suitable for transient transfection studies of FLAG-tagged proteins in mammalian cells and for in vitro analyses. (2) Using these vectors we have been able to analyse the interaction in vitro between Oct-1 and a B-cell coactivator of transcription Bobl. We have confirmed with direct immunofluorescence studies that these vectors yield quantifiable amounts of re-proteins in the appropriate sub-cellular compartment in vivo.

~_CKNOWLEDGEMENTS This work was supported by the Kanton of Z0rich and the Schweizerische Nationalfonds.

REFERENCES Blanar, M.A. and Rutter, W.J.: Interaction cloning: identification of a helix-loop-helix zipper protein that interacts with c-Fos. Science 256 (1992) 1014-1018. Gstaiger, M:, Knopfel, L., Georgiev, O., Schaffner, W. and Hovens, M.C.: Bobl, a B-cell coactivator of octamer binding transcription factors. Nature 373 (1995) 360-362. H611er, M., Westin, G., Jiricny, J. and Schaffner, W.: Spl transcription factor binds DNA and activates transcription even when the binding site is CpG methylated. Genes Dev. 2 (1988) 1127-1135. Hopp, H.P., Prickett, K.S., Price, V.L., Libby. R.T., March, C.J., Cerretti, D.P., Urdal, D.L. and Conlon, P.J.: A short polypeptide marker sequence useful for recombinant protein identification and purification. Bio/Technology 6 (1988) 1204. Huang, B., Shi, Z. and Tsai, M.D.: A small, high-copy-number vector suitable for both in vitro and in vivo gene expression. Gene 151 (1994) 143 145. Fields, S. and Song, O.: A novel genetic system to detect protein-protein interactions. Nature 340 (1989) 245 246. Kemler, I., Bucher, E., Seipel, K., Mtiller-Immergliick, M.M. and Schaffner, W.: Promoters with the octamer DNA motif (ATGCAAAT} can be ubiquitous or cell type-specific depending on binding affinity of the octamer site and Oct-factor concentration. Nucleic Acids Res. 19 (1991) 237-242. Pallisgaard, N., Pedersen, F.S., Birkelund, S. and Jorgensen, P.: A common multiple cloning site in a set of vectors for expression of eukaryotic genes in mammalian, insect and bacterial ceils. Gene 138 (1994) 115 118. Schreiber, E., Tobler, A., Malipiero, U., Schaffner, W. and Fontana, A.: cDNA cloning of human N-Oct3, a nervous-system specific POU domain transcription factor binding to the octamer DNA motif. Nucleic Acids Res. 21 (1993) 253-258.