- Email: [email protected]
Understanding the genetic relationships and breeding patterns of Sri Lankan tea cultivars with genomic and EST-SSR markers
Scientia Horticulturae 240 (2018) 72–80
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Understanding the genetic relationships and breeding patterns of Sri Lankan tea cultivars with genomic and EST-SSR markers
T
⁎
K.H.T. Karunarathnaa, K.M. Mewanb, O.V.D.S.J. Weerasenaa, S.A.C.N. Pererac, , E.N.U. Edirisingheb, A.A. Jayasomaa a
Institute of Biochemistry, Molecular Biology and Biotechnology, University of Colombo, Colombo, Sri Lanka Biochemistry Division, Tea Research Institute of Sri Lanka, Thalawakelle, Sri Lanka c Department of Agricultural Biology, Faculty of Agriculture, University of Peradeniya, Peradeniya, 20400, Sri Lanka b
A R T I C LE I N FO
A B S T R A C T
Keywords: Camellia sinensis Genetic diversity Improved cultivars Plant breeding Population structure Selection
Sri Lanka is the second largest global tea exporter. Genetically diverse planting material are vital in adjusting for biotic and abiotic stresses. Accordingly, sixty four tea cultivars, which represent the entirety of the recommended cultivars consisting of 50 improved cultivars and 14 Estate selections were analyzed at 33 Genomic and EST-SSR loci with the objective of assessing the genetic diversity and population structure of cultivated tea in Sri Lanka. Genotypic data were subjected to cluster and population structure analysis using power marker and Structure software. The results revealed three groups in the dendrogram and the population structure was described at the level of three sub-populations; the main sub-populations deriving from a single Assam type tea plant and the other two from old seedling teas and the hybrids between the above sub-populations. The cultivated tea in Sri Lanka were thus revealed to be of vary narrow genetic base dominated by the Assam type tea of Indo-Chinese origin. In conclusion, it is urged for enhancing the genetic diversity of the cultivated tea by incorporating exotic China type tea germplasm and more parents from old seedling teas grown in Sri Lanka in the breeding programme.
1. Introduction
earlier recorded as a separate type is currently considered to be a hybrid between the China and Assam type teas based on molecular evidence (Wambulwa et al., 2016a). Due to cross pollinating breeding behaviour, tea populations are highly heterogeneous and all the above types freely interbreed resulting in a cline varying from ‘China’ types to ‘Assam’ types and intermediates (Wight, 1959).
Tea, Camellia sinensis (L.) O. Kuntze, is the oldest, mildly stimulating, caffeine containing non-alcoholic beverage which is favoured as a daily drink by billions of people world-over. It is an economically important tree crop, grown in over 52 countries in Asia and Africa. Globally, Sri Lanka is the third largest producer and the 2nd largest exporter of tea, playing a vital role in the economy of the country and occupying a prominent place in the world trade of tea with its popular brand ‘Ceylon Tea’. The tea plant is a woody ever-green perennial which belongs to the family Theaceae. It is recorded to be native to Yunnan and Sichuan provinces in China and northern part of Myanmar (Wight, 1959). Based on morphological features, several taxonomic classifications have been proposed for cultivated tea (Sealy, 1958; Wight, 1962; Banerjee, 1992; Ming, 2000). The latest information reveal two distinct varieties of cultivated tea; C. sinensis var. sinensis (China type) and C. sinensis var. assamica (Masters) Chang (Assam type). The Assam type tea is further sub divided into Indian Assam and Chinese Assam types. Cambod type tea, Camellia assamica ssp. Lasiocalyx (Planchon ex Watt) which was
⁎
Corresponding author. E-mail address: [email protected] (S.A.C.N. Perera).
https://doi.org/10.1016/j.scienta.2018.05.051 Received 13 March 2018; Received in revised form 29 May 2018; Accepted 31 May 2018 0304-4238/ © 2018 Elsevier B.V. All rights reserved.
1.1. Progress of tea cultivation in Sri Lanka Cultivated tea has been introduced to Sri Lanka in 1800’s and by the 20th century, tea industry boomed in the country. At the initial establishment of tea cultivation (1824–1833) in Sri Lanka, mainly China type seeds have been introduced for mass cultivation (Ranatunga and Gunesekera, 2008). However, the establishment of these seeds have been very poor and later, Indo-China type seeds imported from Northeast India have been successfully established. These seedlings are of C. sinensis var. assamica and subsequent seedling tea populations (OST) have been derived by wide scale hybridizations among the individuals of these populations owing to tea being a naturally outcrossing plant. In 1937, thirty seeds from a single tree (designated as
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
1.2. Genetic diversity of tea To-date, very little is known about the pattern of genetic variation of cultivated tea in Sri Lanka. Accordingly, there is an urgent need for the accurate estimation of the genetic diversity and relationships of recommended teas using an informative and precise system of characterization. Until recently assessing of tea germplasm and breeding lines in Sri Lanka, has entirely been dependent on the phenotypic evaluations using descriptor states defined for various leaf and bush characters (Gunasekare et al., 2001; Piyasundara et al., 2006) and isozyme techniques (Liyanage et al., 1999). However, these methods, due to their inherent limitations and the effect of the environment can inflict a high degree of plasticity (Wickramaratne, 1981) resulting in vague and ambiguous assessments and inaccurate conclusions. 1.3. Use of molecular markers to assess the genetic diversity of tea At the beginning of molecular era, RFLP (Tanskley et al., 1989; Matsumoto et al., 1994) RAPD (Wachira et al., 1995; Wright et al., 1996; Tanaka and Yamaguchi, 1996; Chen et al., 1998), AFLP (Paul et al., 1997; Huang et al., 2004) and ISSR (Mondal, 2002) techniques have been used to assess genetic diversity of tea in a number of countries. These initial attempts, though hinted at the levels of diversity did not provide sufficient information for a comprehensive analysis of the genetic diversity or for determining population structures. Out of the common molecular marker systems, SSRs have the advantages of the ubiquitous distribution in the genome, high polymorphism over both nuclear and expressed DNA, co-dominant inheritance and transferability across related species (Chase et al., 1996; Fan et al., 2012) and as such have been widely used in many organisms in genetic diversity studies. In tea, recent studies using a set of nuclear SSR revealed a significant amount of useful information on the breeding history and genetic relationships of tea germplasm in Africa (Wambulwa et al., 2016a,b, 2017). Furthermore, SSR markers have recently been successfully used for linkage map construction (Tan et al., 2013) and identification of QTL for biochemical traits (Ma et al., 2014). In Sri Lanka, DNA marker based characterization of tea was initiated with RAPD markers (Mewan et al., 2005; Goonetilleke et al., 2006) for a selected set of ex-situ conserved tea accessions. Results of these studies revealed rather narrow genetic diversity of the cultivars and accessions, but reflected the importance of the use of a more informative DNA marker system which is sufficiently powerful to study closely related individuals. As described above, the most appropriate choice of a marker system under current situation is SSR. With the above background, in the current study, we use 20 ESTSSR and 13 Genomic-SSR markers to genotype the entirety of 64 currently recommended tea cultivars in Sri Lanka with the objectives of elucidating the genetic relationships and the diversity of cultivated tea to make recommendations for effective use of genetic resources in breeding tea for the sustainability of tea cultivation.
Fig. 1. Geographical distribution of 64 recommended tea cultivars in Sri Lanka.
ASM 4/10 and recorded to represent Cambod type tea) have been introduced and widely used in hybridization among themselves and with old seedling tea to develop many of the clonally propagated improved tea cultivars of today. Another introduction of Indo-Chinese type tea (Shan Bansang No 777 and Shan Cho Lang No 777) has been made in 1950’s and has been utilized as parents in breeding in very limited scale. In Sri Lanka, the current recommendation of the Tea Research Institute of Sri Lanka (TRISL) includes a total of 64 tea cultivars, which comprise of 50 ‘TRI cultivars’ and 14 ‘estate cultivars’ (selections made from estate plantations) recommended for cultivation in the 11 agroecological regions (Fig. 1) (Anon., 2002). Majority of the recommended ‘TRI cultivars’ are selections made from open pollinated progenies of a single parental line ASM 4/10 (Richards, 1965). About 55% of the replanted teas are of recommended types which are confined to a very few cultivars, originated from a limited number of parental lines. Reliance on such a few selected and genetically related group of materials for planting would limit the diversity of cultivated tea. Low diversity of cultivated material lower their potential for adjusting to increasing biotic and abiotic stresses which are being enhanced due to global climate change, ultimately questioning the sustenance of tea cultivation.
2. Materials and methods 2.1. Plant material A total of 64 tea cultivars recommended by the TRISL, and established in tea germplasm collection of up country wet zone (Agro-ecological region, AER-U1; 1382 m amsl) at St. Coombs estate, Thalawakelle, Sri Lanka, were studied in the current research. 2.2. DNA extraction and quantification DNA of the 64 TRI recommended tea accessions was extracted from 50 to 100 mg of freeze-dried (Labconco freeze dry system/Freezone®
73
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Table 1 Details of SSR markers used for genotyping (Forward primer (M-13 tail attached to 5′end), Tm- Annealing temperature °C). SSR Loci
Size (bp)
Forward primer sequence (5’-3’)
Reverse primer sequence (5’-3’)
Motif
Tm
GMT 019 GMT 050 GMT 075 GMT 084 GMT 119 GMT 128 GMT 135 GMT 143 GMT 115 GMT 136 GMT 026 GMT 061 GMT 022 EST 073 EST 011 EST 015 EST 006 EST 016 EST 022 EST 055 EST 060 EST 062 EST 086 EST 128 EST 021 EST 052 EST 058 EST 116 EST 166 EST 178 EST 101 EST 096 EST 168
157-185 115-313 113-233 126-172 259-302 302-343 183-276 131-161 148-369 131-156 111-137 154-160 101-189 171-209 216-219 191-167 204-207 92-134 237-243 179-305 203-439 120-150 149-169 151-172 195-280 173-179 282-315 158-190 167-239 134-152 151-172 245-263 206-238
TGATGATGGCAATTAAGATAACA TTGTGAGATGCCATCAAATTA TTCTTCTTCTTCCTCTTCTTCTTC GGGGCACTTTAAATTTTACATA AAGCACTTGTAATTTGATTGTTCA ATAGAATATGCCCTTGCCCAC CTCTTCTTCATGATAAACAACAAT GTTCTAACCGGCATTTGTCCT CCAAAACCATCAACAACAACC TGTTTGTATTGGACATGAATGC TCATAAAACAAACAAGTGTGTAGA AAGCACTGTGTGCGTTGTGT TCTAAGTCAACTCTCTCTCTCTCG GAAAAACCACCCACCCATTAT TGGAGAATCCAATGAGGAAAC TCTCTTATCTGATCAATTTCCAG AAGCTCAACAGCATCTGCG CGGTGTGTACCTATCTCGCTC CCCATTTGTTTGGAATTGTGT CAAACCACAATGACATTTTCC TTCCTAAGGAGGTTCCAACTGA GAGAAAGAGAAGAGGAAAGGGAA AAATCAGAGGACCCGAGAGAA GAGACAAACCCATCAACCAAC AAGAGTCGCAGCACTTGAGAG CCAAGCTCCACCAGATCAC GGAAAATCCAGAGGAATCGAG AAAGACGACCTTTTTCTTGCC CATATTGGCCCATCATCAATC AGTCGACGGTACCGGACATA TCCATACAACATATTTTCTTTCAC GACTCACACACAGAGCGAGC GGGGACTGCTTCTTTTCATTC
GAAGCACCCAAATAGGTCACA CGATTTGGTTTCCAACAGAGA GGCTTAGATTGACAGAGCCTTT CGGAACTGTGACTTAACCCAA GGCTTAGATTGACAGAGCCTTT CGACATGAAAGACCTTACCCA CGATGCAGGACAAAAATGAAG TATTTGAGAGCAGATTTGGGC TCTGGACTCAAAATTCCTAGTGG CATATCAAGGACACAATGGCA ACATGATATGGCAGTGAAGGC AGCCTTCTAGCCAAATCTCCA GGTCGGTCAAAAATAGGGTGT GCAGACTTGGCACTGGTAAAG TTTTCATCCTCATCTTCATGCTT GTAGTCAGAGGGAAGATGGGG ATGGTTCCAACACTGCTTCTG TAATTGCGAGGCTGTACCATC ACCTAGTTGTGATCGTGGTGC TGGAAATGAAGTCGAATGAGG GTCTTGCTCTGAATTTCGTCG CCTGCAGCAGACTGATCAAAT GTAGACGATGCCGATGACATT AGAGTGGTGGAGATTGGGAGT CTGAGAAGCCATTCGACCAG GTCGAGTCCAGAGTCGATCC CTGCTGCAGAACTCATCATTG AATAAGCATTCCCAACAACCC CCCAAATCAAGACGAATCAAA GACGTCGAGGAGGAGAAGAGT CTCAATCGTTTTTATAATTTCCTT GGGAATGAGAGAAGAGATGGG GATGGGAACCGTTGGATTACT
TG AG CT TG CAT TCT TTC CTT AAG TTC CA TG CT CT AAG TC CTC CGCTG TTA TCT AG GA GA TC CAACA CAC CTC CT TC CT CCG AG TC
60 60 61 60.3 59.5 60 60.2 59.8 59 59.5 60 60 60 55 54.5 54.8 54.5 54.8 54 55.2 54.4 54.4 54.4 54.6 54.3 53.8 54.8 53.9 54.5 57.2 54.1 54.9 52.8
2.4. Capillary fragment analysis
4.5) healthy tender tea leaves using a commercial DNA extraction kit (QuiagenDNeasy® plant mini kit, USA). The quality and the quantity of the extracted DNA was determined by UV–vis spectrophotometer (Biospec-nano, Shimadzu, Japan).
PCR products were analyzed by capillary electrophoresis on an ABI 3500dx genetic analyzer (Applied Biosystems). Samples were prepared by pooling together at a ratio of 1:3:1:4 for FAM:NED:VIC:PET to a final volume of 15 μl and the DNA pool was mixed and centrifuged. One microliter of the pooled DNA was added in to a mixture of 8.75 μl of HIDI formamide (Applied Biosystems), 0.25 μl of Genescan 600-LIZ size standard (Applied Biosystems) followed by mixing and centrifugation. The 96-well plate was placed on an Applied Biosystems Veriti ™ Thermal Cycler for 5 min at 95 °C and then on ice slurry for 5 min before data recording in the genetic analyzer. Raw data files from the ABI3500dx were imported in to Gene mapper® software version 4.1 for fragment analysis.
2.3. PCR amplification A total of 20 EST-SSRs and 13 Genomic-SSRs (GMT-SSR were used for genotyping (Table 1). Each 25 μl PCR reaction consisted of the following ingredients, 20–30 ng of genomic DNA, 1x Go Taq buffer (Promega), 2.5 mM MgCl2, 0.2 mM dNTPs, 0.25 units of GoTaq polymerase (Promega), 2.0 pmol of reverse primer and 1 pmol of M13 tailed forward primer (5′-CAC GAC GTT GTA AAA CGA C + microsatellite sequence-3′). Applied Biosystems Veriti™ Thermal Cycler was programmed as; initial denaturation at 94 °C for 1 min following denaturation at 94 °C for 45 s, annealing at relevant temperatures mentioned in Table 1 for 30 s, extension at 72 for 1 min with 30 repeating cycles followed by another 10 cycles with additional 0.75 pmol of labeled M13 primer with one of the following fluorescent dyes: 6-FAM (6-FAM-TGTAAAACGACGGCCAGT), NED (NED-TGTAAAACGACGGCCAGT), PET (PET-TGTAAAACGACGG CCAGT) or VIC (VIC-TGTAAAACGACGGCCAGT) (Applied Biosystems) with denaturation at 95 °C for 30 s, annealing at 53 °C for 45 s, extension at 72 °C for 45 s with a final extension at 72 °C for 10 min.
2.5. Statistical analysis of genotypic data The genotypic data were analyzed using Power Marker v 3.25 software (Liu and Muse, 2005) to derive summary statistics and a dendrogram was constructed using MEGA 4 software. The model-based program STRUCTURE 2.3.4 (Pritchard et al., 2000) was used to infer the population structure of the tea cultivars. In order to identify the number of populations (K) the capturing of the major structure in the data, was set up at a burn-in period of 10,000 Markov Chain Monte Carlo iterations and 100,000 run length, with an admixture model following Hardy-Weinberg equilibrium and correlated allele frequencies as well as independent loci for each run. Ten
74
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Table 2 Genetic diversity parameters of SSR markers used for genotyping of 64 tea cultivars (PIC = Polymorphic information content; FIS = Inbreeding coefficient). Marker
No, of alleles
Frequency of major allele
No. of genotypes
Gene Diversity
Heterozygosity
PIC
FIS
EST006 EST011 EST015 EST016 EST022 EST055 EST060 EST062 EST086 EST096 EST101 EST128 EST021 EST052 EST058 EST116 EST166 EST168 EST178 EST073 GMT019 GMT050 GMT075 GMT084 GMT119 GMT128 GMT135 GMT143 GMT115 GMT136 GMT026 GMT061 GMT022 Total Mean
2 2 10 12 3 4 4 4 10 8 15 10 16 2 14 6 13 11 3 12 8 13 17 9 21 5 9 4 6 7 11 4 13 291 8.8
0.60 0.95 0.34 0.32 0.62 0.85 0.69 0.36 0.77 0.50 0.18 0.44 0.21 0.97 0.46 0.51 0.22 0.45 0.83 0.33 0.43 0.30 0.32 0.47 0.34 0.60 0.58 0.97 0.45 0.55 0.47 0.67 0.32 – 17.078
2 2 20 28 4 5 4 7 12 16 30 18 27 2 16 7 20 16 3 22 16 31 26 10 35 10 11 4 9 7 22 8 17 467 14.15
0.48 0.09 0.77 0.80 0.49 0.27 0.49 0.67 0.40 0.69 0.88 0.71 0.89 0.05 0.66 0.58 0.87 0.73 0.29 0.80 0.71 0.84 0.82 0.70 0.85 0.58 0.62 0.05 0.64 0.61 0.71 0.49 0.79 – 0.608
0.00 0.09 0.89 0.86 0.52 0.10 0.12 0.71 0.30 0.46 0.59 0.79 0.75 0.05 0.91 0.94 0.85 0.73 0.17 0.98 0.55 0.76 0.89 1.00 0.70 0.51 0.71 0.05 0.73 0.90 0.52 0.51 0.90 – 0.594
0.365 0.085 0.744 0.780 0.395 0.256 0.458 0.599 0.384 0.653 0.875 0.668 0.887 0.048 0.605 0.499 0.861 0.698 0.272 0.773 0.675 0.824 0.803 0.662 0.842 0.539 0.592 0.050 0.575 0.560 0.679 0.428 0.769 – 0.573
1.0 −0.049 −0.149 −0.069 −0.052 0.628 0.746 −0.061 0.258 0.329 0.329 −0.121 0.162 −0.024 −0.386 −0.616 0.023 −0.008 0.428 −0234 0.231 0.092 −0.089 −0.429 0.177 0.122 −0.150 −0.018 −0.141 −0.472 0.264 −0.050 −0.136 – 0.024
the majority of marker loci as expected in a naturally cross pollinating crop species.
independent runs were performed for each simulated value of K, ranging from 1 to 7. Subsequently, the optimal K was determined using STRUCTURE HARVESTER (Earl and vonHoldt, 2012).
3.2. Genetic distances and phylogenetic relationships 3. Results Genetic similarity data obtained from SSR markers were used for cluster analysis and the resulted UPGMA dendrogram revealed three major clusters within the collection of 64 tea cultivars (Fig. 2). The group I (G–I) was the smallest including only five out of the 64 cultivars. Cluster two was the largest comprising of 38 individuals within four sub-clusters (II-A to II-D) while cluster three included 21 individuals within two (III-A and III-B) sub-clusters.
3.1. Summary statistics of genotypic data The capillary electrophoresis conducted in ABI 3500dx provided high detection sensitivity of amplified DNA fragments and no differences were observed between the two independent replicates, indicating the stability and the reproducibility of the technique. The fragment analysis revealed the PCR amplified SSR alleles varying in the range of 92–439 bp in size. Polymorphic genotypes were scored at all the 33 genomic and ESTSSR loci for the 64 recommended Sri Lankan tea cultivars. A total of 288 alleles were amplified varying in the range of 2–21, with a mean of 8.8 alleles per locus (Table 2). The marker locus GMT 119 was the most informative amplifying 21 alleles while the lowest number of alleles were recorded by the markers EST 006, EST 011 and EST 052 amplifying only two alleles at each locus. Heterozygosity values ranged from zero for EST 006 (complete homozygosity) to one (complete heterozygosity) for GMT 084. Sixty four tea cultivars recorded a total of 467 genotypes at the 33 SSR loci with a mean of 14 genotypes per marker locus. Furthermore, relatively high heterozygosity values (mean of 0.5938) and low inbreeding coefficient (FIS) values were observed at
3.3. Population structure analysis Population structure of the 64 recommended tea cultivars was analyzed by Bayesian based approach for different values of k ranged between 1 and 6 based on correlated allele frequency (Fig. 3). The log likelihood revealed by structure showed the optimum value as 2 (K = 2) with both the subpopulations having an admixture of alleles. For the discussion of data we considered three subpopulations (K = 3) within the tea cultivars studied. (Fig. 4). Structure groups; ST 1 to ST 3 and a mosaic group mostly comprising of specific genotypes with two or all the three sub-populations were identified at K = 3. The results of the cluster and structure analyses of the 64
75
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Fig. 2. Dendrogram showing the clustering pattern of the 64 tea cultivars.
compared to the total population (FST) derived by the structure software are presented in Table 5. The allele frequency divergence of subpopulations identified ST 3, which included only ASM based cultivars, to be more divergent from ST 1 and ST 2. Also, the highest FST and the lowest expected heterozygosity were recorded by ST 3 indicating fixing of alleles due to breeding within the cultivar.
recommended tea cultivars in Sri Lanka were compared with the origins of the breeding lines of these cultivars and the results are presented in Table 3. Based on the origin, the 64 tea cultivars were grouped into four as; hybrids (open pollinated or artificially hand pollinated) of a single base population (ASM), introduced and selected Shan Bansang and Shan cho-Long cultivars (SB) selections of old estate seedling tea (OST) and the hybrids between ASM and OST (HT). These groups were represented by 32, 02, 18 and 12 cultivars respectively. Of them, all the ASM cultivars grouped into ST 2 or the mosaic group, while they distributed in all the groups in the dendrogram mainly concentrating in groups IID and IIIB. The two individuals of SB, grouped in ST 1 separating themselves into groups IIC and IID in the dendrogram. All the cultivars except one in the OST group were located in ST1 or the mosaic group while they distributed in groups IIC and IIB except for TRI 4079 which grouped in IID in the dendrogram. The majority of cultivars in HT group were located in ST 2 while four cultivars grouped in the mosaic group and they scattered in groups IIIA, IIA and IIB in the dendrogram. Allele frequency divergence among the three sub-populations computed using point estimates of P (Nei’s minimum distance) in structure analysis is given in Table 4. The average distances between individuals of the same cluster and the effect of sub-populations
4. Discussion 4.1. Diversity and population structure of tea germplasm Tea is naturally out-breeding and thus are represented by heterozygous individuals and heterogenous populations. Genotypic data was in accordance with this phenomenon recording a relatively high number of alleles (291) and genotypes (467) in the 64 tea cultivars at the 33 SSR loci. To date published information on SSR based genetic diversity of tea cultivars grown in Sri Lanka are scarce preventing any comparison with the current study. A previous study on 450 Chinese tea cultivars, collected from different ecological regions in China and analyzed at 96 SSR loci (Yao et al., 2011) recorded, average PIC and gene diversity values of 0.61 and 0.64 respectively. The present study revealed similar values (0.61
76
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Fig. 3. Population structure of recommended tea cultivars for K = 2 to K = 6.
A recent study conducted to assess the genetic diversity of East African tea germplasm of 193 accessions conserved ex-situ, revealed a mean of 7.88 alleles over 23 nuclear SSR loci and three plastid DNA regions (Wambulwa et al. (2016a). Wambulwa et al. (2016b) further studied 280 tea accessions collected from across Africa at the same
and 0.57 respectively) for the same parameters for only 64 recommended tea cultivars at 33 SSR loci. This reflects the discriminating power and the informativeness of the SSR primers used in the current study when compared with the higher number of accessions evaluated in the Chinese collection.
77
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Fig. 4. Population structure of 64 tea cultivars recommended in Sri Lanka at K = 3.
1833. As the records indicate the ancestral parent of majority of the tea cultivars is the single plant ASM4/10. Although a lot of open pollination events of ASM progeny have been allowed during tea breeding, our study indicate that the open pollination has not resulted in sufficient levels of cross pollination with OSTs as is evidenced by the separate genetic identity of the eight intentional hybrids between ASM and OST. Therefore, in the event of utilizing open pollinated progeny as breeding lines in clonal multiplication of tea, the vicinity of diverse material as pollen donors and their compatibilities need to be seriously considered. Furthermore, the artificial hand pollination between selected parents can be highly recommended in this scenario to include required genetic diversity into cultivated material in a targeted manner. Ranatunga et al. (2017) determining the diversity of ex-situ conserved germplasm in Sri Lanka using morphological descriptors concluded the conserved germplasm to represent 20% Assam type and 68% Cambod type tea accessions. With Cambod type now being considered as hybrids, this study gives evidence for the predominance of Assam type among the conserved germplasm in Sri Lanka confirming the findings of the current study. Therefore, it is apparent that not only the cultivated tea, but also the conserved material are lacking the required diversity. Therefore, there is an imperative need to take measures to include the required diversity to achieve maximum productivity and to ensure the sustainability of the tea cultivation. Wambulwa et al. (2017) assessing the origin and the diversity of tea germplasm in Africa concluded a narrow genetic base in African tea, which has been introduced in early 1900’s from India and Sri Lanka to Africa. Combining the information generated in our study it can be stated that throughout Africa and in Sri Lanka, cultivated and conserved tea consist of narrow genetic base comprising of Indian Assam type tea and the countries concerned should urge for diversification of both the conserved and cultivated tea with genetic material from different origins, mainly the China type tea.
marker loci, the group used earlier, and generated a mean of 12.9 alleles per locus. In comparison we report 8.8 alleles per marker locus at 11 nuclear and 22 expressed SSR marker loci for the 64 recommended tea cultivars in Sri Lanka. Although we used 22 expressed SSRs, none of these loci are annotated as yet, thus preventing the studying functional diversity of the studied material. 4.2. Origin of tea breeding material used in Sri Lanka Of the 64 recommended tea cultivars we studied, 32, 18, 12 and 02 numbers of individuals respectively represented origins of, ASM, OST, hybrids between OST and ASM (HT) and SB. In population structure analysis OST and SB represented ST 1, while ASM x OST and ASM represented ST 2 and ST 3 respectively. However, majority of recommended cultivars of ASM origin represented mosaic group indicating widespread natural and intentional cross pollination in the breeding history of tea in Sri Lanka. The current study did not include pure genetic material of different origins. Such material would have facilitated direct insights into the origins of cultivated tea in Sri Lanka. Despite this drawback, the results provide clear evidence for the narrow genetic base of the recommended tea cultivars in Sri Lanka. Majority of the tea cultivars have been originated from the single Indo China type ASM 4/10 plant as indicated in the structure analysis. As a result of cross pollination, mosaic groups have been developed but still maintaining the narrow genetic base of Indo-China (Assam) tea types. The OST and the hybrids between ASM and OST formed two unique subpopulations while all the remaining recommended tea cultivars were mosaic groups of the above subpopulations. ASM 4/10 is considered as Cambod type tea but the recent molecular evidence suggested Cambod type tea cultivars to be hybrids between China type and Assam type tea. Accordingly, considering the various introductions of tea into Sri Lanka, C. sinensis var. assamica that occurs in India as ‘Indian Assam type tea’ is identified as the predominant genetic base of the cultivated tea in Sri Lanka. Consequently, the current research identifies an urgent need for the incorporation of China type tea, C. sinensis var. sinensis in the cultivated material of tea in Sri Lanka. In addition, more targeted hybridizations using OST would be useful to enhance the genetic base of cultivated tea. OST has clustered separately and it can be hypothesized that at least some of these OST may be the descendants from the poorly established Chinese tea imported at the inception of tea cultivation in Sri Lanka during 1824-
5. Conclusions The current study provides molecular evidence for the narrow genetic base of the cultivated tea in Sri Lanka, which is the second largest exporter and the third largest producer of tea in the world. The vast majority of tea cultivars were found to have originated from Indian type assamica tea (Camellia sinensis var. assamica). A minor portion of cultivated material consists of selections from old seedling tea, which is
78
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Table 3 Grouping of tea cultivars based on genetic diversity, population structure and origin (ASM = originated from ASM4/10; SB = originated from San Bansang & Shan Cho-Long; OST = Old seedling tea; HT= Hybrids between ASM and OST; OP = open pollinated). Cultivar
62/5 62/6 62/9 777 TRI 2022 TRI 2023 TRI 2024 TRI 2025 TRI 2026 TRI 2027 TRI 2043 TRI 3013 TRI 3014 TRI 3015 TRI 3016 TRI 3017 TRI 3018 TRI 3019 TRI 3020 TRI 3022 TRI 3025 TRI 3035 TRI 3047 TRI 3051 TRI 3052 TRI 3055 TRI 3069 TRI 3072 TRI 3073 TRI 4004 TRI 4006 TRI 4014 TRI 4024 TRI 4034 TRI 4042 TRI 4043 TRI 4046 TRI 4047 TRI 4049 TRI 4052 TRI 4053 TRI 4054 TRI 4055 TRI 4059 TRI 4061 TRI 4067 TRI 4071 TRI 4078 TRI 4079 TRI 4085 CH13 CY9 DG39 DG7 DN DT1 H158 K145 KEN163 KP204 N2 NAY3 PK2 S106
Cluster in dendrogram
I IID I IIC IID IIIB IID IIIB IIIB IIIB IID IIB IIIB IIB IIA IIA I IIA IIB IIIB I IIIB IIIA IID IID I IIIB IID IID IIC IIIA IIIB IIIB IIC IIIB IIIB IIIB IIIA IIIA IIIA IIIA IIIA IIIA IIA IIA IIC IIB IIB IID IIB IIC IIC IIC IIC IIB IIC IIC IIC IIC IIC IIB IIC IIB IIB
Structure group
Genetic base
Mosaic Mosaic Mosaic ST 1 Mosaic ST 3 Mosaic ST 3 ST 3 ST 3 ST 1 Mosaic ST 3 Mosaic ST 2 ST 2 Mosaic Mosaic Mosaic Mosaic Mosaic ST 3 Mosaic Mosaic Mosaic Mosaic ST 3 Mosaic Mosaic Mosaic ST 3 ST 3 ST 3 Mosaic ST 3 ST 3 ST 3 ST 2 ST 2 ST 2 ST 2 ST 2 ST 2 Mosaic Mosaic Mosaic Mosaic Mosaic Mosaic Mosaic ST 1 ST 2 Mosaic ST 1 ST 1 ST 1 ST 1 ST 1 ST 1 Mosaic ST 1 ST 1 ST 1 ST 1
79
Parentage
Origin
ASM4/10 (OP) (ASM) ASM4/10 (OP) ASM4/10 (OP) Shan Bansang & Shan Cho-Long (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) Shan Bansang & Shan Cho-Long (OP) TRI 2024 × OP TRI 2025 × OP TRI 2026 × OP ASM 4/10 × DT 95 ASM 4/10 × DT 95 TRI 2024 × DT1 ASM 4/10 × DT 95 TRI 2025 × OP TRI 2026 × TRI 2023 TRI 2025 OP TRI 2025 × OP ASM 4/10 × OP ASM 4/10 × OP ASM 4/10 × OP ASM 4/10 OP Induced tetraploid of TRI2025 TRI 2025 × OP TRI 2025 × OP Estate Selection of old seedling tea TRI 2026 × TRI 2023 TRI 2023 × TRI 2026 TRI 2023 × TRI 2026 TRI 2026 × TRI 2023 TRI 2026 × TRI 2023 TRI 2023 × TRI 2026 TRI 2023 × TRI 2026 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 TRI 2023 OP TRI 2023 OP CY 9 × NAY 3 N2 × 2024 N2 self N2 self DN X TRI 2024 Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea
ASM ASM ASM SB ASM ASM ASM ASM ASM ASM SB ASM ASM ASM HT HT HT HT ASM ASM ASM ASM ASM ASM ASM ASM ASM ASM ASM N ASM ASM ASM ASM ASM ASM ASM HT HT HT HT HT HT ASM ASM OST HT B B HT OST OST OST OST OST OST OST OST OST OST OST OST OST OST
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Part 01 (Abstracts) 57thAnnual Session. Sri Lanka. p 83. Huang, F.P., Liang, Y.R., Lu, J.L., Chen, R.B., Mamati, G., 2004. Evaluation of genetic diversity in Oolong tea germplasms by AFLP fingerprinting. J. Tea Sci. 24, 183–189. Liu, K., Muse, S.V., 2005. Power marker: an integrated analysis environment for genetic marker analysis. Bioinformatics 2128–2129. Liyanage, A.C., Fernando, W.M.U., Wickremesinghe, I.P., Pathirana, K.P.S.K., Abeykoon, A.M.A., 1999. Development and application of Isozyme technique for the identification of tea clones. In: Abstract of Paper, Sri Lanka Association for the Advancement of Science Proceedings. Colombo, Sri Lanka 1997. pp. 123. Ma, J.Q., Yao, M.Z., Ma, C.L., Wang, X.C., Jin, J.Q., et al., 2014. Construction of a SSRbased genetic map and identification of QTLs for catechins content in tea plant (Camellia sinensis). PLoS One 9 (3), e93131. http://dx.doi.org/10.1371/journal.pone. 0093131. Matsumoto, S., Takeuchi, A., Hayatsu, M., Kondo, S., 1994. Molecular cloning of phenylalanine ammonia-lyase cDNA and classification of varieties and cultivars of tea plants (Camellia sinensis) using the tea PAL cDNA probe. Theor. Appl. Genet. 89, 671–675. Mewan, K.M., JMDT, Everard, Liynage, A.C., Gunasekare, M.T.K., Tirimanne, T.L.S., Karunanayake, E.H., 2005. Studying genetic relationship among tea (Camellia sinensis L) cultivars using RAPD markers. Tea Sci. 70 (1), 10–17. Ming, T.L., 2000. Monograph of the Genus Camellia. Yunnan Science and Technology Press, Kunming. Mondal, T.K., 2002. Assessment of genetic diversity of tea (Camellia sinensis L. O. Kuntze) by inter-simple sequence repeat polymerase chain reaction. Euphytica 128, 307–315. Paul, S., Wachira, F.N., Powell, W., Waugh, R., 1997. Diversity and genetic differentiation among population of Indian and Kenyan tea (Camellia sinensis (L.) O. Kuntze) revealed by AFLP markers. Theor. Appl. Genet. 94, 255–263. Piyasundara, J.H.M., Gunasekara, M.T.K., Pereis, P.U.S., Wickramasinghe, I.B., 2006. Phenotypical diversity of Sri Lankan tea (Camellia sinensis L) germplasm based on morphological descriptors. Trop. Agric. Res. 18, 237–243. Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of population structure using multi locus genotype data. Genetics 155, 945–959. Ranatunga, M.A.B., Gunesekera, M.T.K., 2008. Assembling a preliminary core collection of tea (Camellia sinensis (L.) O. Kuntze) genetic resources in Sri Lanka. Plant Genet. Resour. Newsl. 155, 41–45. Ranatunga, M.A.B., Kottawaarachchi, J.D., Gunasekare, K., Yakandawala, D., 2017. Floral diversity and genetic structure of tea germplasm of Sri Lanka. Int. J. Biodivers. 2017. http://dx.doi.org/10.1155/2017/2957297. Richards, A.V., 1965. The origin of popular TRI clones. Tea Q. 36, 183–188. Sealy, J., 1958. A version of the genus Camellia. J. R. Hortic. Soc. 62 (I), 934–940. Tan, L.Q., Wang, L.Y., Wei, K., Zhang, C.C., Wu, L.Y., et al., 2013. Floral transcriptome sequencing for SSR marker development and linkage map construction in the tea plant (Camellia sinensis). PLoS One 8 (11), e81611. http://dx.doi.org/10.1371/ journal.pone.0081611. Tanaka, J.I., Yamaguchi, S., 1996. Use of RAPD markers for the identification of parentage of tea cultivars. Bulletin of the National Research Institute of Vegetables. Ornam. Plants Tea (Ser. B) 9, 31–36. Tanskley, S.D., Yong, N.D., Paterson, A.H., Bonierbals, M.W., 1989. RFLP mapping in plant breeding: new tools for an old science. Biotechnology 7, 257–264. Wachira, F.N., Waugh, R., Powell, W., Hackett, C.A., 1995. Detection of genetic diversity in tea (Camellia sinensis) using RAPD markers. Genome 38, 201–210. http://dx.doi. org/10.1139/g95-025. Wambulwa, M.C., Meegahakumbura, M.K., Chalo, R., Kamunya, S., Muchugi, A., Xu, J.C., et al., 2016a. Nuclear microsatellites reveal the genetic architecture and breeding history of tea germplasm of East Africa. Tree Genet. Genomes 12, 11. http://dx.doi. org/10.1007/s11295-015-0963-x. Wambulwa, M.C., Meegahakumbura, M.K., Kamunya, S., Muchugi, A., Möller, M., Liu, J., et al., 2016b. Insights into genetic relationships and breeding patterns of African tea germplasm based on nSSR and markers and cpDNA sequences. Front. Plant Sci. 7, 1244. http://dx.doi.org/10.3389/fpls.2016.01244. Wambulwa, M.C., Meegahakumbura, M.K., Kamunya, S., Muchugi, A., Möller, M., Liu, J., et al., 2017. Multiple origins and narrow genepool characterize the African tea germplasm: concordant patterns revealed by nuclear and plastid DNA markers. Sci. Rep. 7, 4053. http://dx.doi.org/10.1038/s41598-s017-04228-0. Wickramaratne, M.R., 1981. Variation in some leaf characteristics in tea (Camellia sinensis) and their use in the identification of tea clones. Tea Q. Ceylon 50, 183–189. Wight, W., 1959. Nomenclature and classification of the tea plant. Nature 183, 1726–1728. Wight, W., 1962. Tea classification revised. Curr. Sci. 31, 298–299. Wright, L.P., Apostolides, Z., Louw, A.I., 1996. Blantyre, Malawi. 22–23 March. 1995. Whittle, A.M., Khumalo, F.R.B. (Eds.), DNA Finger Printing of Clones. Proceedings of the 1st Regional Tea Research Seminar 44–50. Yao, M., Ma, C., Qiao, T., Jin, J., Chen, L., 2011. Diversity distribution and population structure of tea germplasms in China revealed by EST-SSR markers. Tree Genet. Genomes 8 (1), 205–220.
Table 4 Allele frequency divergence among clusters.
ST1 ST2 ST3
ST1
ST2
ST3
– 0.0238 0.0540
– 0.0564
–
Table 5 Expected heterozygosity (average distance between individuals of the same cluster) and FST of clusters. Cluster
Expected heterozygosity
FST
ST1 ST2 ST3
0.6769 0.6126 0.4993
0.0038 0.1493 0.2552
genetically distinct from the former group. We conclude stressing the urgent need for broadening the genetic base of cultivated tea in Sri Lanka, by introducing China type tea (Camellia sinensis var. sinensis) and incorporating selected old seedling tea in the breeding programme. Declaration of interests None. Acknowledgements This work was financially supported by the National Research Council, Sri Lanka (Grant No: NRC 09-066). Authors thank emeritus Professor EH Karunanayake and Professor Kamani H Tennekoon for their guidance. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2018.05.051. References Anon, 2002. Suitability of tea clones for the different regions for recommended tea cultivars. T.R.I advisory circular no PN: 1. Tea Research Institute of Sri Lanka, Sri Lanka. Annual ITC Bulletin of Statistics. International Tea Committee, pp. 51–61. Banerjee, B., 1992. Botanical classification of tea. In: Wilson, K., Clifford, N. (Eds.), Tea: Cultivation and Consumption. Chapman and Hall, London, pp. 25–51. Chase, M.R., Kesseli, R., Bawa, K.S., 1996. Microsatellite markers for population and conservation genetics of tropical trees. Am. J. Bot. 83, 51–57. Chen, L., Yang, Y.J., Yu FL, Gao Q.K., Chen, D.M., 1998. Genetic diversity of 15 tea (Camellia sinensis (L.) O. Kuntze) cultivars using RAPD markers. J. Tea Sci. 18, 21–27. Earl, D.A., vonHoldt, B.M., 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 4, 359–361. http://dx.doi.org/10.1007/s12686-011-9548-7. Fan, L., Reynolds, B., Liu, M., Stork, M., Kjelleberge, S., Webster, N.S., Thomas, T., 2012. Functional equivalence and evolutionary convergence I complex communities of microbial sponge symbionts. Proc. Natl. Acad. Sci. 109 (27), E1878–E1887. Goonetilleke, W.A.S.N.S.T., Priyantha, P.G.C., Mewan, K.M., Gunasekare, 2006. Genetic diversity in tea (Camellia sinensis L, O. Kuntze) as revealed by RAPD-PCR markers. In: International Symposium on Issues and Challenges of the 21st Century. University of Sabaragamuwa, Sri Lanka. 04–08 July 2006. Gunasekare, M.T.K., Kottawaarachchige, J.D., Mudalige, K., Pieris, T.U.S., 2001. Morphological diversity of Camellia sinensis (Tea) genotypes in Sri Lanka. In: Abstract of Papers of Proceedings of the Sri Lanka Association for the Advancement of Science,
80
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Understanding the genetic relationships and breeding patterns of Sri Lankan tea cultivars with genomic and EST-SSR markers
T
⁎
K.H.T. Karunarathnaa, K.M. Mewanb, O.V.D.S.J. Weerasenaa, S.A.C.N. Pererac, , E.N.U. Edirisingheb, A.A. Jayasomaa a
Institute of Biochemistry, Molecular Biology and Biotechnology, University of Colombo, Colombo, Sri Lanka Biochemistry Division, Tea Research Institute of Sri Lanka, Thalawakelle, Sri Lanka c Department of Agricultural Biology, Faculty of Agriculture, University of Peradeniya, Peradeniya, 20400, Sri Lanka b
A R T I C LE I N FO
A B S T R A C T
Keywords: Camellia sinensis Genetic diversity Improved cultivars Plant breeding Population structure Selection
Sri Lanka is the second largest global tea exporter. Genetically diverse planting material are vital in adjusting for biotic and abiotic stresses. Accordingly, sixty four tea cultivars, which represent the entirety of the recommended cultivars consisting of 50 improved cultivars and 14 Estate selections were analyzed at 33 Genomic and EST-SSR loci with the objective of assessing the genetic diversity and population structure of cultivated tea in Sri Lanka. Genotypic data were subjected to cluster and population structure analysis using power marker and Structure software. The results revealed three groups in the dendrogram and the population structure was described at the level of three sub-populations; the main sub-populations deriving from a single Assam type tea plant and the other two from old seedling teas and the hybrids between the above sub-populations. The cultivated tea in Sri Lanka were thus revealed to be of vary narrow genetic base dominated by the Assam type tea of Indo-Chinese origin. In conclusion, it is urged for enhancing the genetic diversity of the cultivated tea by incorporating exotic China type tea germplasm and more parents from old seedling teas grown in Sri Lanka in the breeding programme.
1. Introduction
earlier recorded as a separate type is currently considered to be a hybrid between the China and Assam type teas based on molecular evidence (Wambulwa et al., 2016a). Due to cross pollinating breeding behaviour, tea populations are highly heterogeneous and all the above types freely interbreed resulting in a cline varying from ‘China’ types to ‘Assam’ types and intermediates (Wight, 1959).
Tea, Camellia sinensis (L.) O. Kuntze, is the oldest, mildly stimulating, caffeine containing non-alcoholic beverage which is favoured as a daily drink by billions of people world-over. It is an economically important tree crop, grown in over 52 countries in Asia and Africa. Globally, Sri Lanka is the third largest producer and the 2nd largest exporter of tea, playing a vital role in the economy of the country and occupying a prominent place in the world trade of tea with its popular brand ‘Ceylon Tea’. The tea plant is a woody ever-green perennial which belongs to the family Theaceae. It is recorded to be native to Yunnan and Sichuan provinces in China and northern part of Myanmar (Wight, 1959). Based on morphological features, several taxonomic classifications have been proposed for cultivated tea (Sealy, 1958; Wight, 1962; Banerjee, 1992; Ming, 2000). The latest information reveal two distinct varieties of cultivated tea; C. sinensis var. sinensis (China type) and C. sinensis var. assamica (Masters) Chang (Assam type). The Assam type tea is further sub divided into Indian Assam and Chinese Assam types. Cambod type tea, Camellia assamica ssp. Lasiocalyx (Planchon ex Watt) which was
⁎
Corresponding author. E-mail address: [email protected] (S.A.C.N. Perera).
https://doi.org/10.1016/j.scienta.2018.05.051 Received 13 March 2018; Received in revised form 29 May 2018; Accepted 31 May 2018 0304-4238/ © 2018 Elsevier B.V. All rights reserved.
1.1. Progress of tea cultivation in Sri Lanka Cultivated tea has been introduced to Sri Lanka in 1800’s and by the 20th century, tea industry boomed in the country. At the initial establishment of tea cultivation (1824–1833) in Sri Lanka, mainly China type seeds have been introduced for mass cultivation (Ranatunga and Gunesekera, 2008). However, the establishment of these seeds have been very poor and later, Indo-China type seeds imported from Northeast India have been successfully established. These seedlings are of C. sinensis var. assamica and subsequent seedling tea populations (OST) have been derived by wide scale hybridizations among the individuals of these populations owing to tea being a naturally outcrossing plant. In 1937, thirty seeds from a single tree (designated as
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
1.2. Genetic diversity of tea To-date, very little is known about the pattern of genetic variation of cultivated tea in Sri Lanka. Accordingly, there is an urgent need for the accurate estimation of the genetic diversity and relationships of recommended teas using an informative and precise system of characterization. Until recently assessing of tea germplasm and breeding lines in Sri Lanka, has entirely been dependent on the phenotypic evaluations using descriptor states defined for various leaf and bush characters (Gunasekare et al., 2001; Piyasundara et al., 2006) and isozyme techniques (Liyanage et al., 1999). However, these methods, due to their inherent limitations and the effect of the environment can inflict a high degree of plasticity (Wickramaratne, 1981) resulting in vague and ambiguous assessments and inaccurate conclusions. 1.3. Use of molecular markers to assess the genetic diversity of tea At the beginning of molecular era, RFLP (Tanskley et al., 1989; Matsumoto et al., 1994) RAPD (Wachira et al., 1995; Wright et al., 1996; Tanaka and Yamaguchi, 1996; Chen et al., 1998), AFLP (Paul et al., 1997; Huang et al., 2004) and ISSR (Mondal, 2002) techniques have been used to assess genetic diversity of tea in a number of countries. These initial attempts, though hinted at the levels of diversity did not provide sufficient information for a comprehensive analysis of the genetic diversity or for determining population structures. Out of the common molecular marker systems, SSRs have the advantages of the ubiquitous distribution in the genome, high polymorphism over both nuclear and expressed DNA, co-dominant inheritance and transferability across related species (Chase et al., 1996; Fan et al., 2012) and as such have been widely used in many organisms in genetic diversity studies. In tea, recent studies using a set of nuclear SSR revealed a significant amount of useful information on the breeding history and genetic relationships of tea germplasm in Africa (Wambulwa et al., 2016a,b, 2017). Furthermore, SSR markers have recently been successfully used for linkage map construction (Tan et al., 2013) and identification of QTL for biochemical traits (Ma et al., 2014). In Sri Lanka, DNA marker based characterization of tea was initiated with RAPD markers (Mewan et al., 2005; Goonetilleke et al., 2006) for a selected set of ex-situ conserved tea accessions. Results of these studies revealed rather narrow genetic diversity of the cultivars and accessions, but reflected the importance of the use of a more informative DNA marker system which is sufficiently powerful to study closely related individuals. As described above, the most appropriate choice of a marker system under current situation is SSR. With the above background, in the current study, we use 20 ESTSSR and 13 Genomic-SSR markers to genotype the entirety of 64 currently recommended tea cultivars in Sri Lanka with the objectives of elucidating the genetic relationships and the diversity of cultivated tea to make recommendations for effective use of genetic resources in breeding tea for the sustainability of tea cultivation.
Fig. 1. Geographical distribution of 64 recommended tea cultivars in Sri Lanka.
ASM 4/10 and recorded to represent Cambod type tea) have been introduced and widely used in hybridization among themselves and with old seedling tea to develop many of the clonally propagated improved tea cultivars of today. Another introduction of Indo-Chinese type tea (Shan Bansang No 777 and Shan Cho Lang No 777) has been made in 1950’s and has been utilized as parents in breeding in very limited scale. In Sri Lanka, the current recommendation of the Tea Research Institute of Sri Lanka (TRISL) includes a total of 64 tea cultivars, which comprise of 50 ‘TRI cultivars’ and 14 ‘estate cultivars’ (selections made from estate plantations) recommended for cultivation in the 11 agroecological regions (Fig. 1) (Anon., 2002). Majority of the recommended ‘TRI cultivars’ are selections made from open pollinated progenies of a single parental line ASM 4/10 (Richards, 1965). About 55% of the replanted teas are of recommended types which are confined to a very few cultivars, originated from a limited number of parental lines. Reliance on such a few selected and genetically related group of materials for planting would limit the diversity of cultivated tea. Low diversity of cultivated material lower their potential for adjusting to increasing biotic and abiotic stresses which are being enhanced due to global climate change, ultimately questioning the sustenance of tea cultivation.
2. Materials and methods 2.1. Plant material A total of 64 tea cultivars recommended by the TRISL, and established in tea germplasm collection of up country wet zone (Agro-ecological region, AER-U1; 1382 m amsl) at St. Coombs estate, Thalawakelle, Sri Lanka, were studied in the current research. 2.2. DNA extraction and quantification DNA of the 64 TRI recommended tea accessions was extracted from 50 to 100 mg of freeze-dried (Labconco freeze dry system/Freezone®
73
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Table 1 Details of SSR markers used for genotyping (Forward primer (M-13 tail attached to 5′end), Tm- Annealing temperature °C). SSR Loci
Size (bp)
Forward primer sequence (5’-3’)
Reverse primer sequence (5’-3’)
Motif
Tm
GMT 019 GMT 050 GMT 075 GMT 084 GMT 119 GMT 128 GMT 135 GMT 143 GMT 115 GMT 136 GMT 026 GMT 061 GMT 022 EST 073 EST 011 EST 015 EST 006 EST 016 EST 022 EST 055 EST 060 EST 062 EST 086 EST 128 EST 021 EST 052 EST 058 EST 116 EST 166 EST 178 EST 101 EST 096 EST 168
157-185 115-313 113-233 126-172 259-302 302-343 183-276 131-161 148-369 131-156 111-137 154-160 101-189 171-209 216-219 191-167 204-207 92-134 237-243 179-305 203-439 120-150 149-169 151-172 195-280 173-179 282-315 158-190 167-239 134-152 151-172 245-263 206-238
TGATGATGGCAATTAAGATAACA TTGTGAGATGCCATCAAATTA TTCTTCTTCTTCCTCTTCTTCTTC GGGGCACTTTAAATTTTACATA AAGCACTTGTAATTTGATTGTTCA ATAGAATATGCCCTTGCCCAC CTCTTCTTCATGATAAACAACAAT GTTCTAACCGGCATTTGTCCT CCAAAACCATCAACAACAACC TGTTTGTATTGGACATGAATGC TCATAAAACAAACAAGTGTGTAGA AAGCACTGTGTGCGTTGTGT TCTAAGTCAACTCTCTCTCTCTCG GAAAAACCACCCACCCATTAT TGGAGAATCCAATGAGGAAAC TCTCTTATCTGATCAATTTCCAG AAGCTCAACAGCATCTGCG CGGTGTGTACCTATCTCGCTC CCCATTTGTTTGGAATTGTGT CAAACCACAATGACATTTTCC TTCCTAAGGAGGTTCCAACTGA GAGAAAGAGAAGAGGAAAGGGAA AAATCAGAGGACCCGAGAGAA GAGACAAACCCATCAACCAAC AAGAGTCGCAGCACTTGAGAG CCAAGCTCCACCAGATCAC GGAAAATCCAGAGGAATCGAG AAAGACGACCTTTTTCTTGCC CATATTGGCCCATCATCAATC AGTCGACGGTACCGGACATA TCCATACAACATATTTTCTTTCAC GACTCACACACAGAGCGAGC GGGGACTGCTTCTTTTCATTC
GAAGCACCCAAATAGGTCACA CGATTTGGTTTCCAACAGAGA GGCTTAGATTGACAGAGCCTTT CGGAACTGTGACTTAACCCAA GGCTTAGATTGACAGAGCCTTT CGACATGAAAGACCTTACCCA CGATGCAGGACAAAAATGAAG TATTTGAGAGCAGATTTGGGC TCTGGACTCAAAATTCCTAGTGG CATATCAAGGACACAATGGCA ACATGATATGGCAGTGAAGGC AGCCTTCTAGCCAAATCTCCA GGTCGGTCAAAAATAGGGTGT GCAGACTTGGCACTGGTAAAG TTTTCATCCTCATCTTCATGCTT GTAGTCAGAGGGAAGATGGGG ATGGTTCCAACACTGCTTCTG TAATTGCGAGGCTGTACCATC ACCTAGTTGTGATCGTGGTGC TGGAAATGAAGTCGAATGAGG GTCTTGCTCTGAATTTCGTCG CCTGCAGCAGACTGATCAAAT GTAGACGATGCCGATGACATT AGAGTGGTGGAGATTGGGAGT CTGAGAAGCCATTCGACCAG GTCGAGTCCAGAGTCGATCC CTGCTGCAGAACTCATCATTG AATAAGCATTCCCAACAACCC CCCAAATCAAGACGAATCAAA GACGTCGAGGAGGAGAAGAGT CTCAATCGTTTTTATAATTTCCTT GGGAATGAGAGAAGAGATGGG GATGGGAACCGTTGGATTACT
TG AG CT TG CAT TCT TTC CTT AAG TTC CA TG CT CT AAG TC CTC CGCTG TTA TCT AG GA GA TC CAACA CAC CTC CT TC CT CCG AG TC
60 60 61 60.3 59.5 60 60.2 59.8 59 59.5 60 60 60 55 54.5 54.8 54.5 54.8 54 55.2 54.4 54.4 54.4 54.6 54.3 53.8 54.8 53.9 54.5 57.2 54.1 54.9 52.8
2.4. Capillary fragment analysis
4.5) healthy tender tea leaves using a commercial DNA extraction kit (QuiagenDNeasy® plant mini kit, USA). The quality and the quantity of the extracted DNA was determined by UV–vis spectrophotometer (Biospec-nano, Shimadzu, Japan).
PCR products were analyzed by capillary electrophoresis on an ABI 3500dx genetic analyzer (Applied Biosystems). Samples were prepared by pooling together at a ratio of 1:3:1:4 for FAM:NED:VIC:PET to a final volume of 15 μl and the DNA pool was mixed and centrifuged. One microliter of the pooled DNA was added in to a mixture of 8.75 μl of HIDI formamide (Applied Biosystems), 0.25 μl of Genescan 600-LIZ size standard (Applied Biosystems) followed by mixing and centrifugation. The 96-well plate was placed on an Applied Biosystems Veriti ™ Thermal Cycler for 5 min at 95 °C and then on ice slurry for 5 min before data recording in the genetic analyzer. Raw data files from the ABI3500dx were imported in to Gene mapper® software version 4.1 for fragment analysis.
2.3. PCR amplification A total of 20 EST-SSRs and 13 Genomic-SSRs (GMT-SSR were used for genotyping (Table 1). Each 25 μl PCR reaction consisted of the following ingredients, 20–30 ng of genomic DNA, 1x Go Taq buffer (Promega), 2.5 mM MgCl2, 0.2 mM dNTPs, 0.25 units of GoTaq polymerase (Promega), 2.0 pmol of reverse primer and 1 pmol of M13 tailed forward primer (5′-CAC GAC GTT GTA AAA CGA C + microsatellite sequence-3′). Applied Biosystems Veriti™ Thermal Cycler was programmed as; initial denaturation at 94 °C for 1 min following denaturation at 94 °C for 45 s, annealing at relevant temperatures mentioned in Table 1 for 30 s, extension at 72 for 1 min with 30 repeating cycles followed by another 10 cycles with additional 0.75 pmol of labeled M13 primer with one of the following fluorescent dyes: 6-FAM (6-FAM-TGTAAAACGACGGCCAGT), NED (NED-TGTAAAACGACGGCCAGT), PET (PET-TGTAAAACGACGG CCAGT) or VIC (VIC-TGTAAAACGACGGCCAGT) (Applied Biosystems) with denaturation at 95 °C for 30 s, annealing at 53 °C for 45 s, extension at 72 °C for 45 s with a final extension at 72 °C for 10 min.
2.5. Statistical analysis of genotypic data The genotypic data were analyzed using Power Marker v 3.25 software (Liu and Muse, 2005) to derive summary statistics and a dendrogram was constructed using MEGA 4 software. The model-based program STRUCTURE 2.3.4 (Pritchard et al., 2000) was used to infer the population structure of the tea cultivars. In order to identify the number of populations (K) the capturing of the major structure in the data, was set up at a burn-in period of 10,000 Markov Chain Monte Carlo iterations and 100,000 run length, with an admixture model following Hardy-Weinberg equilibrium and correlated allele frequencies as well as independent loci for each run. Ten
74
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Table 2 Genetic diversity parameters of SSR markers used for genotyping of 64 tea cultivars (PIC = Polymorphic information content; FIS = Inbreeding coefficient). Marker
No, of alleles
Frequency of major allele
No. of genotypes
Gene Diversity
Heterozygosity
PIC
FIS
EST006 EST011 EST015 EST016 EST022 EST055 EST060 EST062 EST086 EST096 EST101 EST128 EST021 EST052 EST058 EST116 EST166 EST168 EST178 EST073 GMT019 GMT050 GMT075 GMT084 GMT119 GMT128 GMT135 GMT143 GMT115 GMT136 GMT026 GMT061 GMT022 Total Mean
2 2 10 12 3 4 4 4 10 8 15 10 16 2 14 6 13 11 3 12 8 13 17 9 21 5 9 4 6 7 11 4 13 291 8.8
0.60 0.95 0.34 0.32 0.62 0.85 0.69 0.36 0.77 0.50 0.18 0.44 0.21 0.97 0.46 0.51 0.22 0.45 0.83 0.33 0.43 0.30 0.32 0.47 0.34 0.60 0.58 0.97 0.45 0.55 0.47 0.67 0.32 – 17.078
2 2 20 28 4 5 4 7 12 16 30 18 27 2 16 7 20 16 3 22 16 31 26 10 35 10 11 4 9 7 22 8 17 467 14.15
0.48 0.09 0.77 0.80 0.49 0.27 0.49 0.67 0.40 0.69 0.88 0.71 0.89 0.05 0.66 0.58 0.87 0.73 0.29 0.80 0.71 0.84 0.82 0.70 0.85 0.58 0.62 0.05 0.64 0.61 0.71 0.49 0.79 – 0.608
0.00 0.09 0.89 0.86 0.52 0.10 0.12 0.71 0.30 0.46 0.59 0.79 0.75 0.05 0.91 0.94 0.85 0.73 0.17 0.98 0.55 0.76 0.89 1.00 0.70 0.51 0.71 0.05 0.73 0.90 0.52 0.51 0.90 – 0.594
0.365 0.085 0.744 0.780 0.395 0.256 0.458 0.599 0.384 0.653 0.875 0.668 0.887 0.048 0.605 0.499 0.861 0.698 0.272 0.773 0.675 0.824 0.803 0.662 0.842 0.539 0.592 0.050 0.575 0.560 0.679 0.428 0.769 – 0.573
1.0 −0.049 −0.149 −0.069 −0.052 0.628 0.746 −0.061 0.258 0.329 0.329 −0.121 0.162 −0.024 −0.386 −0.616 0.023 −0.008 0.428 −0234 0.231 0.092 −0.089 −0.429 0.177 0.122 −0.150 −0.018 −0.141 −0.472 0.264 −0.050 −0.136 – 0.024
the majority of marker loci as expected in a naturally cross pollinating crop species.
independent runs were performed for each simulated value of K, ranging from 1 to 7. Subsequently, the optimal K was determined using STRUCTURE HARVESTER (Earl and vonHoldt, 2012).
3.2. Genetic distances and phylogenetic relationships 3. Results Genetic similarity data obtained from SSR markers were used for cluster analysis and the resulted UPGMA dendrogram revealed three major clusters within the collection of 64 tea cultivars (Fig. 2). The group I (G–I) was the smallest including only five out of the 64 cultivars. Cluster two was the largest comprising of 38 individuals within four sub-clusters (II-A to II-D) while cluster three included 21 individuals within two (III-A and III-B) sub-clusters.
3.1. Summary statistics of genotypic data The capillary electrophoresis conducted in ABI 3500dx provided high detection sensitivity of amplified DNA fragments and no differences were observed between the two independent replicates, indicating the stability and the reproducibility of the technique. The fragment analysis revealed the PCR amplified SSR alleles varying in the range of 92–439 bp in size. Polymorphic genotypes were scored at all the 33 genomic and ESTSSR loci for the 64 recommended Sri Lankan tea cultivars. A total of 288 alleles were amplified varying in the range of 2–21, with a mean of 8.8 alleles per locus (Table 2). The marker locus GMT 119 was the most informative amplifying 21 alleles while the lowest number of alleles were recorded by the markers EST 006, EST 011 and EST 052 amplifying only two alleles at each locus. Heterozygosity values ranged from zero for EST 006 (complete homozygosity) to one (complete heterozygosity) for GMT 084. Sixty four tea cultivars recorded a total of 467 genotypes at the 33 SSR loci with a mean of 14 genotypes per marker locus. Furthermore, relatively high heterozygosity values (mean of 0.5938) and low inbreeding coefficient (FIS) values were observed at
3.3. Population structure analysis Population structure of the 64 recommended tea cultivars was analyzed by Bayesian based approach for different values of k ranged between 1 and 6 based on correlated allele frequency (Fig. 3). The log likelihood revealed by structure showed the optimum value as 2 (K = 2) with both the subpopulations having an admixture of alleles. For the discussion of data we considered three subpopulations (K = 3) within the tea cultivars studied. (Fig. 4). Structure groups; ST 1 to ST 3 and a mosaic group mostly comprising of specific genotypes with two or all the three sub-populations were identified at K = 3. The results of the cluster and structure analyses of the 64
75
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Fig. 2. Dendrogram showing the clustering pattern of the 64 tea cultivars.
compared to the total population (FST) derived by the structure software are presented in Table 5. The allele frequency divergence of subpopulations identified ST 3, which included only ASM based cultivars, to be more divergent from ST 1 and ST 2. Also, the highest FST and the lowest expected heterozygosity were recorded by ST 3 indicating fixing of alleles due to breeding within the cultivar.
recommended tea cultivars in Sri Lanka were compared with the origins of the breeding lines of these cultivars and the results are presented in Table 3. Based on the origin, the 64 tea cultivars were grouped into four as; hybrids (open pollinated or artificially hand pollinated) of a single base population (ASM), introduced and selected Shan Bansang and Shan cho-Long cultivars (SB) selections of old estate seedling tea (OST) and the hybrids between ASM and OST (HT). These groups were represented by 32, 02, 18 and 12 cultivars respectively. Of them, all the ASM cultivars grouped into ST 2 or the mosaic group, while they distributed in all the groups in the dendrogram mainly concentrating in groups IID and IIIB. The two individuals of SB, grouped in ST 1 separating themselves into groups IIC and IID in the dendrogram. All the cultivars except one in the OST group were located in ST1 or the mosaic group while they distributed in groups IIC and IIB except for TRI 4079 which grouped in IID in the dendrogram. The majority of cultivars in HT group were located in ST 2 while four cultivars grouped in the mosaic group and they scattered in groups IIIA, IIA and IIB in the dendrogram. Allele frequency divergence among the three sub-populations computed using point estimates of P (Nei’s minimum distance) in structure analysis is given in Table 4. The average distances between individuals of the same cluster and the effect of sub-populations
4. Discussion 4.1. Diversity and population structure of tea germplasm Tea is naturally out-breeding and thus are represented by heterozygous individuals and heterogenous populations. Genotypic data was in accordance with this phenomenon recording a relatively high number of alleles (291) and genotypes (467) in the 64 tea cultivars at the 33 SSR loci. To date published information on SSR based genetic diversity of tea cultivars grown in Sri Lanka are scarce preventing any comparison with the current study. A previous study on 450 Chinese tea cultivars, collected from different ecological regions in China and analyzed at 96 SSR loci (Yao et al., 2011) recorded, average PIC and gene diversity values of 0.61 and 0.64 respectively. The present study revealed similar values (0.61
76
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Fig. 3. Population structure of recommended tea cultivars for K = 2 to K = 6.
A recent study conducted to assess the genetic diversity of East African tea germplasm of 193 accessions conserved ex-situ, revealed a mean of 7.88 alleles over 23 nuclear SSR loci and three plastid DNA regions (Wambulwa et al. (2016a). Wambulwa et al. (2016b) further studied 280 tea accessions collected from across Africa at the same
and 0.57 respectively) for the same parameters for only 64 recommended tea cultivars at 33 SSR loci. This reflects the discriminating power and the informativeness of the SSR primers used in the current study when compared with the higher number of accessions evaluated in the Chinese collection.
77
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Fig. 4. Population structure of 64 tea cultivars recommended in Sri Lanka at K = 3.
1833. As the records indicate the ancestral parent of majority of the tea cultivars is the single plant ASM4/10. Although a lot of open pollination events of ASM progeny have been allowed during tea breeding, our study indicate that the open pollination has not resulted in sufficient levels of cross pollination with OSTs as is evidenced by the separate genetic identity of the eight intentional hybrids between ASM and OST. Therefore, in the event of utilizing open pollinated progeny as breeding lines in clonal multiplication of tea, the vicinity of diverse material as pollen donors and their compatibilities need to be seriously considered. Furthermore, the artificial hand pollination between selected parents can be highly recommended in this scenario to include required genetic diversity into cultivated material in a targeted manner. Ranatunga et al. (2017) determining the diversity of ex-situ conserved germplasm in Sri Lanka using morphological descriptors concluded the conserved germplasm to represent 20% Assam type and 68% Cambod type tea accessions. With Cambod type now being considered as hybrids, this study gives evidence for the predominance of Assam type among the conserved germplasm in Sri Lanka confirming the findings of the current study. Therefore, it is apparent that not only the cultivated tea, but also the conserved material are lacking the required diversity. Therefore, there is an imperative need to take measures to include the required diversity to achieve maximum productivity and to ensure the sustainability of the tea cultivation. Wambulwa et al. (2017) assessing the origin and the diversity of tea germplasm in Africa concluded a narrow genetic base in African tea, which has been introduced in early 1900’s from India and Sri Lanka to Africa. Combining the information generated in our study it can be stated that throughout Africa and in Sri Lanka, cultivated and conserved tea consist of narrow genetic base comprising of Indian Assam type tea and the countries concerned should urge for diversification of both the conserved and cultivated tea with genetic material from different origins, mainly the China type tea.
marker loci, the group used earlier, and generated a mean of 12.9 alleles per locus. In comparison we report 8.8 alleles per marker locus at 11 nuclear and 22 expressed SSR marker loci for the 64 recommended tea cultivars in Sri Lanka. Although we used 22 expressed SSRs, none of these loci are annotated as yet, thus preventing the studying functional diversity of the studied material. 4.2. Origin of tea breeding material used in Sri Lanka Of the 64 recommended tea cultivars we studied, 32, 18, 12 and 02 numbers of individuals respectively represented origins of, ASM, OST, hybrids between OST and ASM (HT) and SB. In population structure analysis OST and SB represented ST 1, while ASM x OST and ASM represented ST 2 and ST 3 respectively. However, majority of recommended cultivars of ASM origin represented mosaic group indicating widespread natural and intentional cross pollination in the breeding history of tea in Sri Lanka. The current study did not include pure genetic material of different origins. Such material would have facilitated direct insights into the origins of cultivated tea in Sri Lanka. Despite this drawback, the results provide clear evidence for the narrow genetic base of the recommended tea cultivars in Sri Lanka. Majority of the tea cultivars have been originated from the single Indo China type ASM 4/10 plant as indicated in the structure analysis. As a result of cross pollination, mosaic groups have been developed but still maintaining the narrow genetic base of Indo-China (Assam) tea types. The OST and the hybrids between ASM and OST formed two unique subpopulations while all the remaining recommended tea cultivars were mosaic groups of the above subpopulations. ASM 4/10 is considered as Cambod type tea but the recent molecular evidence suggested Cambod type tea cultivars to be hybrids between China type and Assam type tea. Accordingly, considering the various introductions of tea into Sri Lanka, C. sinensis var. assamica that occurs in India as ‘Indian Assam type tea’ is identified as the predominant genetic base of the cultivated tea in Sri Lanka. Consequently, the current research identifies an urgent need for the incorporation of China type tea, C. sinensis var. sinensis in the cultivated material of tea in Sri Lanka. In addition, more targeted hybridizations using OST would be useful to enhance the genetic base of cultivated tea. OST has clustered separately and it can be hypothesized that at least some of these OST may be the descendants from the poorly established Chinese tea imported at the inception of tea cultivation in Sri Lanka during 1824-
5. Conclusions The current study provides molecular evidence for the narrow genetic base of the cultivated tea in Sri Lanka, which is the second largest exporter and the third largest producer of tea in the world. The vast majority of tea cultivars were found to have originated from Indian type assamica tea (Camellia sinensis var. assamica). A minor portion of cultivated material consists of selections from old seedling tea, which is
78
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Table 3 Grouping of tea cultivars based on genetic diversity, population structure and origin (ASM = originated from ASM4/10; SB = originated from San Bansang & Shan Cho-Long; OST = Old seedling tea; HT= Hybrids between ASM and OST; OP = open pollinated). Cultivar
62/5 62/6 62/9 777 TRI 2022 TRI 2023 TRI 2024 TRI 2025 TRI 2026 TRI 2027 TRI 2043 TRI 3013 TRI 3014 TRI 3015 TRI 3016 TRI 3017 TRI 3018 TRI 3019 TRI 3020 TRI 3022 TRI 3025 TRI 3035 TRI 3047 TRI 3051 TRI 3052 TRI 3055 TRI 3069 TRI 3072 TRI 3073 TRI 4004 TRI 4006 TRI 4014 TRI 4024 TRI 4034 TRI 4042 TRI 4043 TRI 4046 TRI 4047 TRI 4049 TRI 4052 TRI 4053 TRI 4054 TRI 4055 TRI 4059 TRI 4061 TRI 4067 TRI 4071 TRI 4078 TRI 4079 TRI 4085 CH13 CY9 DG39 DG7 DN DT1 H158 K145 KEN163 KP204 N2 NAY3 PK2 S106
Cluster in dendrogram
I IID I IIC IID IIIB IID IIIB IIIB IIIB IID IIB IIIB IIB IIA IIA I IIA IIB IIIB I IIIB IIIA IID IID I IIIB IID IID IIC IIIA IIIB IIIB IIC IIIB IIIB IIIB IIIA IIIA IIIA IIIA IIIA IIIA IIA IIA IIC IIB IIB IID IIB IIC IIC IIC IIC IIB IIC IIC IIC IIC IIC IIB IIC IIB IIB
Structure group
Genetic base
Mosaic Mosaic Mosaic ST 1 Mosaic ST 3 Mosaic ST 3 ST 3 ST 3 ST 1 Mosaic ST 3 Mosaic ST 2 ST 2 Mosaic Mosaic Mosaic Mosaic Mosaic ST 3 Mosaic Mosaic Mosaic Mosaic ST 3 Mosaic Mosaic Mosaic ST 3 ST 3 ST 3 Mosaic ST 3 ST 3 ST 3 ST 2 ST 2 ST 2 ST 2 ST 2 ST 2 Mosaic Mosaic Mosaic Mosaic Mosaic Mosaic Mosaic ST 1 ST 2 Mosaic ST 1 ST 1 ST 1 ST 1 ST 1 ST 1 Mosaic ST 1 ST 1 ST 1 ST 1
79
Parentage
Origin
ASM4/10 (OP) (ASM) ASM4/10 (OP) ASM4/10 (OP) Shan Bansang & Shan Cho-Long (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) ASM4/10 (OP) Shan Bansang & Shan Cho-Long (OP) TRI 2024 × OP TRI 2025 × OP TRI 2026 × OP ASM 4/10 × DT 95 ASM 4/10 × DT 95 TRI 2024 × DT1 ASM 4/10 × DT 95 TRI 2025 × OP TRI 2026 × TRI 2023 TRI 2025 OP TRI 2025 × OP ASM 4/10 × OP ASM 4/10 × OP ASM 4/10 × OP ASM 4/10 OP Induced tetraploid of TRI2025 TRI 2025 × OP TRI 2025 × OP Estate Selection of old seedling tea TRI 2026 × TRI 2023 TRI 2023 × TRI 2026 TRI 2023 × TRI 2026 TRI 2026 × TRI 2023 TRI 2026 × TRI 2023 TRI 2023 × TRI 2026 TRI 2023 × TRI 2026 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 ASM 4/10 × CY 9 TRI 2023 OP TRI 2023 OP CY 9 × NAY 3 N2 × 2024 N2 self N2 self DN X TRI 2024 Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea Estate selection of old seedling tea
ASM ASM ASM SB ASM ASM ASM ASM ASM ASM SB ASM ASM ASM HT HT HT HT ASM ASM ASM ASM ASM ASM ASM ASM ASM ASM ASM N ASM ASM ASM ASM ASM ASM ASM HT HT HT HT HT HT ASM ASM OST HT B B HT OST OST OST OST OST OST OST OST OST OST OST OST OST OST
Scientia Horticulturae 240 (2018) 72–80
K.H.T. Karunarathna et al.
Part 01 (Abstracts) 57thAnnual Session. Sri Lanka. p 83. Huang, F.P., Liang, Y.R., Lu, J.L., Chen, R.B., Mamati, G., 2004. Evaluation of genetic diversity in Oolong tea germplasms by AFLP fingerprinting. J. Tea Sci. 24, 183–189. Liu, K., Muse, S.V., 2005. Power marker: an integrated analysis environment for genetic marker analysis. Bioinformatics 2128–2129. Liyanage, A.C., Fernando, W.M.U., Wickremesinghe, I.P., Pathirana, K.P.S.K., Abeykoon, A.M.A., 1999. Development and application of Isozyme technique for the identification of tea clones. In: Abstract of Paper, Sri Lanka Association for the Advancement of Science Proceedings. Colombo, Sri Lanka 1997. pp. 123. Ma, J.Q., Yao, M.Z., Ma, C.L., Wang, X.C., Jin, J.Q., et al., 2014. Construction of a SSRbased genetic map and identification of QTLs for catechins content in tea plant (Camellia sinensis). PLoS One 9 (3), e93131. http://dx.doi.org/10.1371/journal.pone. 0093131. Matsumoto, S., Takeuchi, A., Hayatsu, M., Kondo, S., 1994. Molecular cloning of phenylalanine ammonia-lyase cDNA and classification of varieties and cultivars of tea plants (Camellia sinensis) using the tea PAL cDNA probe. Theor. Appl. Genet. 89, 671–675. Mewan, K.M., JMDT, Everard, Liynage, A.C., Gunasekare, M.T.K., Tirimanne, T.L.S., Karunanayake, E.H., 2005. Studying genetic relationship among tea (Camellia sinensis L) cultivars using RAPD markers. Tea Sci. 70 (1), 10–17. Ming, T.L., 2000. Monograph of the Genus Camellia. Yunnan Science and Technology Press, Kunming. Mondal, T.K., 2002. Assessment of genetic diversity of tea (Camellia sinensis L. O. Kuntze) by inter-simple sequence repeat polymerase chain reaction. Euphytica 128, 307–315. Paul, S., Wachira, F.N., Powell, W., Waugh, R., 1997. Diversity and genetic differentiation among population of Indian and Kenyan tea (Camellia sinensis (L.) O. Kuntze) revealed by AFLP markers. Theor. Appl. Genet. 94, 255–263. Piyasundara, J.H.M., Gunasekara, M.T.K., Pereis, P.U.S., Wickramasinghe, I.B., 2006. Phenotypical diversity of Sri Lankan tea (Camellia sinensis L) germplasm based on morphological descriptors. Trop. Agric. Res. 18, 237–243. Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of population structure using multi locus genotype data. Genetics 155, 945–959. Ranatunga, M.A.B., Gunesekera, M.T.K., 2008. Assembling a preliminary core collection of tea (Camellia sinensis (L.) O. Kuntze) genetic resources in Sri Lanka. Plant Genet. Resour. Newsl. 155, 41–45. Ranatunga, M.A.B., Kottawaarachchi, J.D., Gunasekare, K., Yakandawala, D., 2017. Floral diversity and genetic structure of tea germplasm of Sri Lanka. Int. J. Biodivers. 2017. http://dx.doi.org/10.1155/2017/2957297. Richards, A.V., 1965. The origin of popular TRI clones. Tea Q. 36, 183–188. Sealy, J., 1958. A version of the genus Camellia. J. R. Hortic. Soc. 62 (I), 934–940. Tan, L.Q., Wang, L.Y., Wei, K., Zhang, C.C., Wu, L.Y., et al., 2013. Floral transcriptome sequencing for SSR marker development and linkage map construction in the tea plant (Camellia sinensis). PLoS One 8 (11), e81611. http://dx.doi.org/10.1371/ journal.pone.0081611. Tanaka, J.I., Yamaguchi, S., 1996. Use of RAPD markers for the identification of parentage of tea cultivars. Bulletin of the National Research Institute of Vegetables. Ornam. Plants Tea (Ser. B) 9, 31–36. Tanskley, S.D., Yong, N.D., Paterson, A.H., Bonierbals, M.W., 1989. RFLP mapping in plant breeding: new tools for an old science. Biotechnology 7, 257–264. Wachira, F.N., Waugh, R., Powell, W., Hackett, C.A., 1995. Detection of genetic diversity in tea (Camellia sinensis) using RAPD markers. Genome 38, 201–210. http://dx.doi. org/10.1139/g95-025. Wambulwa, M.C., Meegahakumbura, M.K., Chalo, R., Kamunya, S., Muchugi, A., Xu, J.C., et al., 2016a. Nuclear microsatellites reveal the genetic architecture and breeding history of tea germplasm of East Africa. Tree Genet. Genomes 12, 11. http://dx.doi. org/10.1007/s11295-015-0963-x. Wambulwa, M.C., Meegahakumbura, M.K., Kamunya, S., Muchugi, A., Möller, M., Liu, J., et al., 2016b. Insights into genetic relationships and breeding patterns of African tea germplasm based on nSSR and markers and cpDNA sequences. Front. Plant Sci. 7, 1244. http://dx.doi.org/10.3389/fpls.2016.01244. Wambulwa, M.C., Meegahakumbura, M.K., Kamunya, S., Muchugi, A., Möller, M., Liu, J., et al., 2017. Multiple origins and narrow genepool characterize the African tea germplasm: concordant patterns revealed by nuclear and plastid DNA markers. Sci. Rep. 7, 4053. http://dx.doi.org/10.1038/s41598-s017-04228-0. Wickramaratne, M.R., 1981. Variation in some leaf characteristics in tea (Camellia sinensis) and their use in the identification of tea clones. Tea Q. Ceylon 50, 183–189. Wight, W., 1959. Nomenclature and classification of the tea plant. Nature 183, 1726–1728. Wight, W., 1962. Tea classification revised. Curr. Sci. 31, 298–299. Wright, L.P., Apostolides, Z., Louw, A.I., 1996. Blantyre, Malawi. 22–23 March. 1995. Whittle, A.M., Khumalo, F.R.B. (Eds.), DNA Finger Printing of Clones. Proceedings of the 1st Regional Tea Research Seminar 44–50. Yao, M., Ma, C., Qiao, T., Jin, J., Chen, L., 2011. Diversity distribution and population structure of tea germplasms in China revealed by EST-SSR markers. Tree Genet. Genomes 8 (1), 205–220.
Table 4 Allele frequency divergence among clusters.
ST1 ST2 ST3
ST1
ST2
ST3
– 0.0238 0.0540
– 0.0564
–
Table 5 Expected heterozygosity (average distance between individuals of the same cluster) and FST of clusters. Cluster
Expected heterozygosity
FST
ST1 ST2 ST3
0.6769 0.6126 0.4993
0.0038 0.1493 0.2552
genetically distinct from the former group. We conclude stressing the urgent need for broadening the genetic base of cultivated tea in Sri Lanka, by introducing China type tea (Camellia sinensis var. sinensis) and incorporating selected old seedling tea in the breeding programme. Declaration of interests None. Acknowledgements This work was financially supported by the National Research Council, Sri Lanka (Grant No: NRC 09-066). Authors thank emeritus Professor EH Karunanayake and Professor Kamani H Tennekoon for their guidance. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2018.05.051. References Anon, 2002. Suitability of tea clones for the different regions for recommended tea cultivars. T.R.I advisory circular no PN: 1. Tea Research Institute of Sri Lanka, Sri Lanka. Annual ITC Bulletin of Statistics. International Tea Committee, pp. 51–61. Banerjee, B., 1992. Botanical classification of tea. In: Wilson, K., Clifford, N. (Eds.), Tea: Cultivation and Consumption. Chapman and Hall, London, pp. 25–51. Chase, M.R., Kesseli, R., Bawa, K.S., 1996. Microsatellite markers for population and conservation genetics of tropical trees. Am. J. Bot. 83, 51–57. Chen, L., Yang, Y.J., Yu FL, Gao Q.K., Chen, D.M., 1998. Genetic diversity of 15 tea (Camellia sinensis (L.) O. Kuntze) cultivars using RAPD markers. J. Tea Sci. 18, 21–27. Earl, D.A., vonHoldt, B.M., 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 4, 359–361. http://dx.doi.org/10.1007/s12686-011-9548-7. Fan, L., Reynolds, B., Liu, M., Stork, M., Kjelleberge, S., Webster, N.S., Thomas, T., 2012. Functional equivalence and evolutionary convergence I complex communities of microbial sponge symbionts. Proc. Natl. Acad. Sci. 109 (27), E1878–E1887. Goonetilleke, W.A.S.N.S.T., Priyantha, P.G.C., Mewan, K.M., Gunasekare, 2006. Genetic diversity in tea (Camellia sinensis L, O. Kuntze) as revealed by RAPD-PCR markers. In: International Symposium on Issues and Challenges of the 21st Century. University of Sabaragamuwa, Sri Lanka. 04–08 July 2006. Gunasekare, M.T.K., Kottawaarachchige, J.D., Mudalige, K., Pieris, T.U.S., 2001. Morphological diversity of Camellia sinensis (Tea) genotypes in Sri Lanka. In: Abstract of Papers of Proceedings of the Sri Lanka Association for the Advancement of Science,
80