- Email: [email protected]
Understanding the lipopolysaccharide induced liver proteome changes and identification of immune genes in Lampetra morii
Aquaculture and Fisheries 1 (2016) 9e14
Contents lists available at ScienceDirect
Aquaculture and Fisheries j o u r n a l h o m e p a g e : w w w . k e a i p u b l i s h i n g . c o m / e n / j o u r n a l s / a q u a c u l t u r e - a n d - fi s h e r i e s /
Original research article
Understanding the lipopolysaccharide induced liver proteome changes and identification of immune genes in Lampetra morii Yingying Li, Wenfang Xie, Qingwei Li* Lamprey Research Center, School of Life Science, Liaoning Normal University, Dalian, China
a r t i c l e i n f o
a b s t r a c t
Article history: Available online 13 October 2016
Lamprey is considered to be an excellent model for studying the origin of adaptive immunity. In the present study, three up-regulated and ten down-regulated proteins were identified in the lipopolysaccharide (LPS) induced liver proteome of Lampetra morii. Quantitative real-time PCR (qPCR) was used to characterize in the liver the abundance of transcripts encoding the differentially expressed proteins. The abundance of transcripts and the corresponding differentially expressed proteins revealed that expression of cystathionase and Zgc:112210-201 was not correlated with protein expression level. Polyl 4hydroxylase, serum lectin, Zgc:112210-201, and cofilin 1 mRNA expression was significantly upregulated in liver tissue after treatment with LPS. Transcript abundance of differentially expressed proteins in the gill, kidney, heart, intestine, liver, and supraneural body was determined. Transcripts of Zgc:112210201 were almost undetectable in the tissues while polyl 4-hydroxylase, protein disulfide isomerase family A (member 4), cystathionase, and serum lectin were low abundance unlike the protein which was easily detected. This study represents the first attempt at understanding the LPS induced liver proteome of L. morii and our findings contribute to the identification of novel immune genes in lamprey. © 2016 Shanghai Ocean University. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Keywords: Liver proteome Lipopolysaccharide Immune gene Lampetra morii
1. Introduction Lampreys are one of the most ancient vertebrates alive today and are considered to be excellent models for studying vertebrate evolution, embryo development, and the origin of adaptive immunity (Amemiya, Saha, & Zapata, 2007; Sower et al., 2006). Lampreys use variable lymphocyte receptors composed of leucinerich repeats for antigen recognition (Pancer et al., 2004). In contrast, Antigen recognition is achieved in the jawed vertebrates through Ig-based B cell receptors (BCRs) and T-cell receptors (TCRs) (Das et al., 2013). These two types of anticipatory receptors evolved as convergent solutions for specific antigen recognition in the ancestors of jawless and jawed vertebrates. In structure, the V(D)J system in mammals and the VLR system in lamprey are unrelated. In the context of lymphocytic cells, they share homology at some level (Rast & Buckley, 2013). So far, three VLR genes (VLRA, VLRB, and VLRC) have been identified in lampreys (Pancer et al., 2004). These three proteins derived from VLRA, VLRB, and
* Corresponding author. School of Life Science, Liaoning Normal University, Liushu South Street No. 1, Dalian, China. E-mail address: [email protected] (Q. Li). Peer review under responsibility of Shanghai Ocean University.
VLRC share a common structure. Unlike the mammals, lampreys have no histologically identifiable thymus. However, lymphocytelike cells are abounding in several tissues in lamprey (Amemiya et al., 2007). Still, studies on molecules participating adaptive immunity were limited in lamprey. The liver is the biggest metabolic and detoxification organ in the body and plays an important role in the immune response of many species. To establish the role of the liver in the immune response of lamprey, we analyzed proteomic changes of lamprey liver after intraperitoneal injection of lipopolysaccharide (LPS). Thirteen differently expressed proteins were identified. Comparison of the abundance of differentially expressed proteins and their respective transcripts determined using quantitative real-time PCR (qPCR) revealed these were mismatched for cystathionase and Zgc:112210. This study provides new information about LPS induced immune gene transcripts in lamprey liver. 2. Materials and methods 2.1. Collection of animals The handling of lampreys and all experimental procedures were approved by the Animal Welfare and Research Ethics
http://dx.doi.org/10.1016/j.aaf.2016.09.002 2468-550X/© 2016 Shanghai Ocean University. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
10
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
Committee of the Institute of Dalian Medical University (Permit Number:SYXK2004-0029). Lampreys were obtained from the Tongjiang Valley, a branch of the Songhua River in Heilongjiang Province in China. These lampreys were kept in Fiber Reinforced Plastic (FRP) tanks with freshwater at 4e16 C before the experiments. 2.2. Proteomic changes of the lamprey liver after injecting with LPS 2.2.1. Lamprey liver protein extraction and solubilization Lampreys (three in each group) were intraperitoneally injected with PBS, LPS (10 mg) at 3 d-intervals with 3 injections. One group was injected with PBS (control) and the other was injected with LPS (treatment). After surface sterilization using 75% ethanol, lamprey liver was dissected out and lyophilized overnight. 0.5 g of the lyophilized liver was ground in liquid nitrogen and then solubilized in 5 ml ice-cold acetone containing 10% TCA and 0.07% DTT, vortexed and then incubated at 20 C overnight. Samples were centrifuged at 11000 rpm at 4 C for 30 min, and the pellets were washed three times with 5 ml ice-cold acetone containing 0.07% DTT and dried under a vacuum to remove residual acetone. Pellets were homogenized in 500 ml of lysis buffer. Lysis buffers that was initially optimized using different concentrations of Trisbase (0 mM Tris, 20 mM Tris or 40 mM Tris), 7.0 M urea, 2 M thiourea, 0.1 M DTT, 4% CHAPS, and 1 mM PMSF were optimized. The homogenized samples were centrifuged twice at 14000 rpm at 4 C for 30 min, and the resulting supernatants were used for 2-DE analysis. 2.2.2. 2-DE The protein concentration of extracts of lamprey liver was determined using a Bio-Rad Protein Assay (Bio-Rad, USA) following the instructions of the manufacturer. In brief, 300 mg of samples from lamprey liver protein extracts were diluted to a final volume of 125 ml with the rehydration buffer containing 7.0 M urea, 2 M thiourea, 0.1 M DTT, and 4% CHAPS, and 0.25% v/v IPG buffer (BioRad). Samples were loaded on 7 cm IPG strips (Bio-Rad) for rehydration at room temperature for 12e16 h. IEF was carried out at 0.01 mA/IPG under the following program: 250 V, 30 min, linear; 500 V, 30 min, linear; 1000 V, 1 h, rapid; 4000 V, 3 h, linear; 4000 V, 28000 Vh, linear; 500 V, linear. After IEF, the IPG gel strips were equilibrated with equilibration buffer (6 M urea, 2% SDS, 0.375 M pH 8.8 Tris-HCl, 20% glycerol) containing 20 mg/ml DTT for about 15 min and then substituted with the same buffer containing 25 mg/mL iodoacetamide for about 15 min at room temperature. The second dimension separation was performed on 12% SDSpolyacrylamide gel. Electrophoresis was carried out at 5 mA per gel for 1 h, and then at 15 mA per gel for 2 h using a PowerPacTM Basic 300 V system (Bio-Rad). After the electrophoresis, gels were fixed (10% glacial acetic acid, 40% absolute ethyl alcohol, and 50% double distilled water) prior to staining with Coomassie Brilliant Blue (0.12% CBB G-250, 10% (NH4)2SO4, 11.8% phosphoric acid, 20% methanol) overnight. The stained gels were scanned using a BIORAD UNIVERSAL HOOD II. The 2D gel images were analyzed using PDQuest version 8.0. The detected protein spots showing significant differences between the livers of control and LPS treated lamprey were selected for identification. The 2-DE analysis was repeated for at least three independent biological replicates. 2.2.3. Protein identification and database search Protein spots of interest were manually excised from a CBBstained gel and subjected to in-gel trypsin digestion. After that, peptides were extracted twice with 60 ml of extract solution (5% formic acid in 50% ACN). The extracts were pooled and dried completely by Speed Vac (BT85, Millrock Technology). Peptide
mixtures were redissolved using 98% MilliQ-H2O, 2% CH3CN, 0.1% Formic acid and mixed. MS analysis of peptide was performed on an ABI 4700 TOF-TOF Proteomics system (Applied Biosystems). All acquired spectra of samples were processed using 4700 ExploreTM Software (Applied Biosystems) in the default mode. The peaklist-generating software was GPS V3.6, and MASCOT (Matrix Science) V2.4.0 was used to search the lamprey and NCBInr database. The following search parameters were used: trypsin digest with three missing cleavage, MS tolerance of 100 ppm, and MS/MS tolerance of 1.5 Da, the expectation value for accepting individual spectra was 44%, the justification of the threshold score employed was p < 0.05. 2.3. Gene cloning of the detected protein spots Total RNA was extracted from lamprey liver tissue using RNAiso plus (D9108A, TaKaRa). The concentration of extracted RNA was quantified using BioPhotometer plus (Eppendorf, Germany) and genomic DNA contaminants were removed were removed using a gDNA Eraser (Perfect Real Time) kit before synthesis ofcDNA using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) kit after quantifying the RNA concentration. The coding regions of the genes encoding the differentially expressed lamprey liver proteins were cloned into the pMD18-T simple vector and sequenced. 2.4. Quantitative RTePCR (qPCR) analysis The primers used for the quantification of the differentially expressed protein coding genes, including prolyl 4-hydroxylase, protein disulfide isomerase family A, fgg-201, serum lectin, Zgc:112210, 3-hydroxybutyrate dehydrogenase, cofilin 1, and a novel gene are listed in Table 1. Petromyzonmarinus glyceraldehyde 3-phosphate dehydrogenase (PmGAPDH) gene (GenBank accession ID AY578058) was used as the internal control. Each sample was analyzed with three biological triplicates. The expression pattern of the differentially expressed protein coding genes identified in liver were determined by qPCR in several tissues, including intestine, kidney, heart, gill, and lymphocyte-like cells. qPCR was performed using the following conditions: 95 C for 10 s, then 40 cycles (Cq) at 95 C for 5 s, 55 C for 20 s and 72 C for 20 s. Melting-curve analysis between 60 C and 95 C was performed after each PCR to check the specificity of the amplification product. The relative mRNA levels of the target genes were calculated by the 2DDCt method, where DCt is the difference between the Ct-value of the target gene and that of PmGAPDH, the internal control gene to which all expression levels were normalized. Three independent replicates were performed for each data set. 3. Results 3.1. Lamprey liver proteomic changes following injection with LPS The 2-DE gel images of lamprey liver proteins stained with CBB were analyzed using PDQuest software 8.0 (Bio-Rad) and about 400 spots were found in each profile. The gel spot patterns in the protein profiles after lysis buffer optimization are presented in Figure S1. Optimization studies revealed that lysis buffer without Tris-base was effective for liver protein extraction (Figure S1a). Protein spots with varying staining intensities between treatment of PBS (control) and LPS (treatment) were selected (Fig. 1), and three spots were up-regulated and ten spots were down-regulated (Fig. 2a). The fold-change in intensity of the differential proteins in control and LPS treatment is shown in Fig. 2b. The information of identified protein spots, including molecular weight (MW), pI value, accession number, unique peptides
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
11
Table 1 Primers used to amplify target genes in this study. Assay
Gene
Primer direction
Primer sequence 50 -30
qPCR
polyl 4-hydroxylase
qPCR
protein disulfide isomerase family A, member 4
qPCR
fgg-201
qPCR
lamprey novel gene (ENSPMAP00000011067)
qPCR
Cystathionase gene
qPCR
serum lectin
qPCR
zgc:112210-201
qPCR
3-hydroxybutyrate dehydrogenase gene
qPCR
lamprey novel gene (ENSPMAP00000009400)
qPCR
cfl1-201
qPCR
pmGAPDH
Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward
TGACATCGTGAACTGGCTAAAGAA CTTTGAGGAACACCTTAGCATCCT GGAAGGGCAAAGCGTATGACTA ACCCAGAATGACCACATCATCAC AAGGACAGCGGACTCTACTACATCA AGCCATTGCCATTCTCGATTT TGACATCAAGGAGAAGCTCTGCTA TGAATGCCACACGACTCCATT GGAAGACATCATTGCGGACAT AGGCACAGCAACAAACGTCAT GGACGCTTCAAGGTTATGTTCAC TCAGTGTTGCAATTGTCAAGCA AAATCTCACCCTCAACTCCATCTC CACAAAACACATGAAATGCCTGTAC GAGTCCTGAATGTGACGAGCAA CAAAATAGTTCCATGGTGGACAAAC ACACACGATGACTTCCCAGGTT GTATGCCATGGAGAGGTAGACGTA AGAAGAAGTTTACAGGCATCAAGCA CCAGAGTTAACCGATCTTGAATGTC ACCCCTTCATTGACCTGGAGTA TGCTTACCCCATGGGATGTT
Fig. 1. The raw 2-DE images of the proteome of PBS (a) and LPS (b) induced lamprey liver. The results were obtained by separating 300 mg of total protein extracted from liver in an IPG gel (pH 4e7, 7 cm) followed by SDS-PAGE (12% polyacrylamide gel). The numbers indicate protein spots with at least a1.5-fold change in intensity.
detected, sequence coverage, and expression pattern, are listed in Table 2. 3.2. qPCR analysis of the differentially expressed protein coding genes The changes in transcript abundance of up- and down-regulated proteins were verified by qPCR. As displayed in Fig. 3b, expression of cystathionase (spot 5), Zgc:112210-201 (spot 7), and glycine Nmethyltransferase (spot 9) transcripts in liver diverged from the protein expression level. Changes in expression at the mRNA and protein levels were consistent for the other proteins identified in the liver (Fig. 3a), the exception was 3-hydroxybutyrate dehydrogenase (spot 8) and blood plasma apolipoprotein LAL2 (spot 13), for which transcripts could not be amplified by qPCR. The proteins cystathionase (spot 5), Zgc:112210-201 (spot 7), and glycine N-methyltransferase (spot 9) were down-regulated 5.56, 1.47, and 4.76 times, respectively, in the liver of LPS treated lamprey. Transcripts for cystathionase, zgc:112210-201, and glycine N-methyltransferase in were up-regulated by 2.39, 128.79, and 3.69 times, respectively, in the liver of LPS treated lamprey. Transcripts for polyl 4-hydroxylase (spot 1), serum lectin (spot 6), Zgc:112210201 (spot 7), and glycine N-methyltransferase (spot 9) were significantly up-regulated (P < 0.05) by LPS treatment. Both
proteins and transcripts were down-regulated for protein disulfide isomerase family A (spot 2), fibrinogen gamma chain (spot 3), and two unidentified proteins (spot 4 and 10) in liver from LPS treated liver. 3.3. Expression patterns of the differentially expressed protein coding genes in lamprey various tissues The transcript abundance of up- and down-regulated proteins in various tissues of L. morii was analyzed by qPCR. Expression of Zgc:112210-201 (spot 7) at the mRNA level was almost undetectable in various tissues. Expression of polyl 4-hydroxylase (spot 1), protein disulfide isomerase family A, member 4 (spot 2), cystathionase (spot 5), and serum lectin (spot 6) at the mRNA level was in low abundance compared with other identified proteins. Expression of polyl 4-hydroxylase (spot 1) was relative higher in gill, supraneural myeloid body, and intestine relative to the other tissues analyzed (Fig. 4a). Similarly, transcripts for the two novel proteins (spot 4 and spot 10) identified were most abundant in the gill and intestine (Fig. 4d and g). Expression of cystathionase (spot 5) and serum lectin (spot 6) at the mRNA level was higher in intestine (Fig. 4e and f). The abundance of transcripts for protein disulfide isomerase family A (spot 2) and cofilin 1 (spot 12) was detected higher in the supraneural myeloid body and heart
12
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
Fig. 2. Enlarged regions of the 2-DE images of the 13 differentially expressed proteins of PBS and LPS induced lamprey liver (a); Fold change in intensity for each differential protein spot (b), the intensity of each spot in PBS treatment was used as the standard. Data are shown are the mean with the SDs (n 3).
respectively relative to the other tissues analyzed (Fig. 4b and h). In liver and kidney, higher amount of fibrinogen gamma chain (spot 3) transcripts were more abundant than in other tissues (Fig. 4c). Transcripts encoding glycine N-methyltransferase (spot 9) at the mRNA level was only detected in liver. 4. Discussion Lipopolysaccharide (LPS), a main component of Gram-negative bacteria cell walls, is an activator of Toll-like receptor 4 in mammals (Poltorak et al., 1998). LPS has previously been shown to induce an immune response in lampreys (Pang, Xiao, Liu, & Li, 2012; Tsutsui, Nakamura, & Watanabe, 2007). Stimulation of the
immune response in lamprey by administration of LPS was used as means to identify novel immune genes in lamprey. P4HB, known as protein disulphide isomerase, is a multifunctional protein that catalyses the formation and rearrangement of disulfide bonds (Sun et al., 2013). P4HB acts as a molecular chaperone of endoplasmic reticulum (ER) (Noiva, 1999). As an ER chaperone, P4HB may play a role in oncogenic signaling that regulates cancer cell survival, progression, and angiogenesis (Kern et al., 2009; Ni & Lee, 2007). Up-regulation of the ER chaperones is reported to be correlated with therapeutic resistance by bypassing the cell death mechanisms (Dong et al., 2005; Reddy et al., 2003). In our study, expression of P4HB was up-regulated at both the protein and mRNA level. The involvement of P4HB in
Table 2 Identifications of differentially expressed protein spots from the liver of control and LPS treated lamprey by MALDI-TOF-MS/MS. Spot number
MW/pI
Protein identification
Ensembl peptide ID
Unique peptides detected
Sequence coverage (%)
Expression pattern
1 2 3 4 5 6 7 8 9 10 11 12 13
21000/4.75 71400/5.05 38400/5.51 41800/5.10 44500/6.06 36400/5.30 28300/8.92 26200/5.63 7700/7.56 20300/5.04 20300/5.04 18600/7.47 20500/5.98
Polyl 4-hydroxylase Protein disulfide isomerase family A, member 4 Fibrinogen gamma chain Lamprey novel protein Cystathionase Serum lectin Zgc:112210-201 3-Hydroxybutyrate dehydrogenase Glycine N-methyltransferase Lamprey novel protein Lamprey novel protein Cofilin 1 Blood plasma apolipoprotein LAL2
ENSPMAP00000010221 ENSPMAP00000000333 ENSPMAP00000001295 ENSPMAP00000011067 ENSPMAP00000001854 gij13094239 (NCBI) ENSPMAP00000008590 ENSPMAP00000004475 ENSPMAP00000010887 ENSPMAP00000009400 ENSPMAP00000009400 ENSPMAP00000009791 gij114056 (NCBI)
10 7 5 17 2 4 6 2 2 5 11 5 6
45.6% 13.1% 15% 18% 5.1% 15% 27.6% 12.2% 42% 42.4% 57.1% 38% 27.7%
Up-regulated Down-regulated Down-regulated Down-regulated Down-regulated Up-regulated Down-regulated Down-regulated Down-regulated Down-regulated Down-regulated Up-regulated Down-regulated
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
13
Fig. 3. Amplification by qPCR of the gene transcripts encoding the differentially expressed proteins. Changes in expression of transcripts and their corresponding proteins that were consistent (a); Changes in expression of transcripts and their corresponding proteins that were not consistent (b). The columns represent mean fold change of 12 gene transcripts encoding differentially expressed proteins in the LPS vs. PBS proteome. Error bars represent the standard deviation (n 3).
Fig. 4. qPCR analysis of gene expression in different tissues. 1, gill; 2, supraneural myeloid body; 3, liver; 4, kidney; 5, heart; 6, intestine. (a) polyl 4-hydroxylase; (b) protein disulfide isomerase family A; (c) fibrinogen gamma chain; (d) lamprey novel protein; (e) cystathionase; (f) serum lectin; (g) lamprey novel protein; (h) cofilin 1.
lamprey immunity needs to be clarified. Lectins originating from intracellular, extracellular or membrane-bound sources are carbohydrate-binding proteins (Drickamer, 1988; Hirabayashi, Oda, Oohara, Yamagata, & Kasai, 1987). In lamprey, the mannose-binding lectin had been isolated and characterized. Results indicated that lectin complement pathway shown to play a pivotal role in defending the body against microorganisms (Takahashi et al., 2006). The induction by LPS of serum lectin in the lamprey liver indicates that the complement pathway, a central component of innate immunity was stimulated. Cofilin 1 had been widely studied
as a biomarker of a more aggressive phenotype of different types of cancer such as breast, gastrointestinal and non-small-cell lung cancer (NSCLC) (Wang, Eddy, & Condeelis, 2007; Yan et al., 2010; Alves Castro et al., 2010). After stimulation with LPS, expression of cofilin1 increased significantly at the mRNA level in lamprey liver but its potential role in immunity remains to be established. zgc:112210-201 is a novel gene that has not previously been reported. Interestingly, obvious difference of Zgc:112210-201 gene expression at the protein and mRNA level could be detected after stimulation with LPS. Protein disulfide isomerase (PDI) was
14
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
reported to have essential roles in health and disease, including lipid homeostasis, hemostasis, infectious disease, cancer, neurodegeneration, and infertility (Benham, 2012). PDI, which usually resides in the endoplasmic reticulum (ER), also has molecular chaperone properties (Benham, 2012). Overexpression of PDI is linked to an increase in viral membrane fusion, and it has been suggested this may allow bacteria and viruses to subvert PDI family members during infection (Jain, McGinnes, & Morrison, 2008) and it is an interesting candidate for future studies of the lamprey immune system. Fibrinogen was considered to be the markers of inflammation (Danese et al., 2008; Vaccarino et al., 2008). Fibrinogen gamma chain (FIBG) was lower in patients with major depression than in healthy controls (Huang, Sung, & Chen, 2014). As a potential marker of inflammation, functional study of FIBG in lamprey should be explored. 5. Conclusions The study of the LPS induced liver proteome has provided information about genes that may be involved in lamprey immunity. To our knowledge, this is the first study to investigate the lamprey liver proteome after induction with LPS. Several differentially expressed proteins were identified in the lamprey liver after LPS stimulation using 2-DE coupled to MALDI-TOF-MS and of the proteins identified, only polyl 4-hydroxylase (P4HB), serum lectin, Zgc:112210-201, and cofilin 1 were significantly up-regulated at the mRNA. However, these data represent only preliminary results about the role of the liver in lamprey immunity and further in depth studies will be required. Acknowledgements This study was supported by Natural Science Foundation of China (Grant No. 31500106), the Youth Foundation of Liaoning Normal University (Grant No. LS2014L009), and the Ph.D Start-up Fundation of Liaoning Province, China (Grant No. 201501107). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.aaf.2016.09.002. References Alves Castro, M. A, Dal-Pizzol, F., Zdanov, S., Soares, M., Müller, C. B., & Lopes, F. M. (2010). CFL1 expression levels as a prognostic and drug resistance marker in non-small-cell lung cancer. Cancer, 116(15), 3645e3655. Amemiya, C. T., Saha, N. R., & Zapata, A. (2007). Evolution and development of immunological structures in the lamprey. Current Opinion in Immunology, 19(5), 535e541. Benham, A. M. (2012). The protein disulfide isomerase family: Key players in health and disease. Antioxidants & Redox Singaling, 16(8), 781e789. Danese, A., Moffitt, T. E., Pariante, C. M., Ambler, A., Poulton, R., & Caspi, A. (2008). Elevated inflammation levels in depressed adults with a history of childhood maltreatment. Archives of General Psychiatry, 65(4), 409e415.
Das, S., Hirano, M., Aghaallaei, N., Bajoghli, B., Boehm, T., & Cooper, M. D. (2013). Organization of lamprey variable lymphocyte receptor C locus and repertoire development. Proceedings of the National Academy of Sciences of the United States of America, 110(15), 6043e6048. Dong, D., Ko, B., Baumeister, P., Swenson, S., Costa, F., Marklind, F., … Lee, A. S. (2005). Vascular targeting and antiangiogenesis agents induce drug resistance effector GRP78 within the tumor microenvironment. Cancer Research, 65(13), 5785e5791. Drickamer, K. (1988). Two distinct classes of carbohydrate-recognition domains in animal lectins. Journal of Biology Chemistry, 263(20), 9557e9560. Hirabayashi, J., Oda, Y., Oohara, T., Yamagata, T., & Kasai, K. (1987). Immunological cross-reactivity between b-galactoside-binding lectins of vertebrates. Possible relationship of antigenicity to oligomeric structure. Biochimica et Biophysica Acta, 916(3), 321e327. Huang, T. L., Sung, M. L., & Chen, T. Y. (2014). 2D-DIGE proteome analysis on the platelet proteins of patients with major depression. Proteome Science, 12(1), 1. Jain, S., McGinnes, L. W., & Morrison, T. G. (2008). Overexpression of thiol/disulfide isomerases enhances membrane fusion directed by the Newcastle disease virus fusion protein. Journal of Virology, 82(24), 12039e12048. Kern, J., Untergasser, G., Zenzmaier, C., Sarg, B., Gastl, G., Gunsilius, E., et al. (2009). GRP-78 secreted by tumor cells blocks the antiangiogenic activity of bortezomib. Blood, 114(18), 3960e3967. Ni, M., & Lee, A. S. (2007). ER chaperones in mammalian development and human diseases. FEBS Letters, 581(19), 3641e3651. Noiva, R. (1999). Protein disulfide isomerase: The multifunctional redox chaperone of the endoplasmic reticulum. Seminars in Cell & Developmental Biology, 10(5), 481e493. Pancer, Z., Amemiya, C. T., Ehrhardt, G. R., Ceitlin, J., Gartland, G. L., & Cooper, M. D. (2004). Somatic diversification of variable lymphocyte receptors in the agnathan sea lamprey. Nature, 430(6996), 174e180. Pang, Y., Xiao, R., Liu, X., & Li, Q. (2012). Identification and characterization of the lamprey high-mobility group box 1 gene. PLoS One, 7(4), e35755. Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Van Huffel, C., Du, X., … Beutler, B. (1998). Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: Mutations in Tlr4 gene. Science, 282(5396), 2085e2088. Rast, J. P., & Buckley, K. M. (2013). Lamprey immunity is far from primitive. Proceedings of the National Academy of Sciences of the United States of America, 110(15), 5746e5747. Reddy, R. K., Mao, C., Baumeister, P., Austin, R. C., Kaufman, R. J., & Lee, A. S. (2003). Endoplasmic reticulum chaperone protein GRP78 protects cells from apoptosis induced by topoisomerase inhibitors: Role of ATP binding site in suppression of caspase-7 activation. Journal of Biology Chemistry, 278(23), 20915e20924. Sower, S. A., Moriyama, S., Kasahara, M., Takahashi, A., Nozaki, M., Uchida, K., … Kawauchi, H. (2006). Identification of sea lamprey GTHbeta-like cDNA and its evolutionary implications. General and Comparative Endocrinology, 148(1), 22e32. Sun, S., Lee, D., Ho, A. S., Pu, J. K., Zhang, X. Q., Lee, N. P., … Leung, G. K. K. (2013). Inhibition of prolyl 4-hydroxylase, beta polypeptide (P4HB) attenuates temozolomide resistance in malignant glioma via the endoplasmic reticulum stress response (ERSR) pathways. Neuro-oncology, 15(5), 562e577. Takahashi, M., Iwaki, D., Matsushita, A., Nakata, M., Matsushita, M., Endo, Y., … Fujita, T. (2006). Cloning and characterization of mannose-binding lectin from lamprey (Agnathans). Journal of Immunology, 176(8), 4861e4868. Tsutsui, S., Nakamura, O., & Watanabe, T. (2007). Lamprey (Lethenteron japonicum) IL-17 upregulated by LPS-stimulation in the skin cells. Immunogenetics, 59(11), 873e882. Vaccarino, V., Brennan, M. L., Miller, A. H., Bremner, J. D., Ritchie, J. C., Lindau, F., … Hazen, S. L. (2008). Association of major depressive disorder with serum myeloperoxidase and other markers of inflammation: A twin study. Biological Psychiatry, 64(6), 476e483. Wang, W., Eddy, R., & Condeelis, J. (2007). The cofilin pathway in breast cancer invasion and metastasis. Nature Reviews Cancer, 7(6), 429e440. Yan, B., Yap, C. T., Wang, S., Lee, C. K., Koh, S., Omar, M. F., … Kumarasinghe, M. P. (2010). Cofilin immunolabelling correlates with depth of invasion in gastrointestinal endocrine cell tumors. Acta Histochemica, 112(1), 101e106.
Contents lists available at ScienceDirect
Aquaculture and Fisheries j o u r n a l h o m e p a g e : w w w . k e a i p u b l i s h i n g . c o m / e n / j o u r n a l s / a q u a c u l t u r e - a n d - fi s h e r i e s /
Original research article
Understanding the lipopolysaccharide induced liver proteome changes and identification of immune genes in Lampetra morii Yingying Li, Wenfang Xie, Qingwei Li* Lamprey Research Center, School of Life Science, Liaoning Normal University, Dalian, China
a r t i c l e i n f o
a b s t r a c t
Article history: Available online 13 October 2016
Lamprey is considered to be an excellent model for studying the origin of adaptive immunity. In the present study, three up-regulated and ten down-regulated proteins were identified in the lipopolysaccharide (LPS) induced liver proteome of Lampetra morii. Quantitative real-time PCR (qPCR) was used to characterize in the liver the abundance of transcripts encoding the differentially expressed proteins. The abundance of transcripts and the corresponding differentially expressed proteins revealed that expression of cystathionase and Zgc:112210-201 was not correlated with protein expression level. Polyl 4hydroxylase, serum lectin, Zgc:112210-201, and cofilin 1 mRNA expression was significantly upregulated in liver tissue after treatment with LPS. Transcript abundance of differentially expressed proteins in the gill, kidney, heart, intestine, liver, and supraneural body was determined. Transcripts of Zgc:112210201 were almost undetectable in the tissues while polyl 4-hydroxylase, protein disulfide isomerase family A (member 4), cystathionase, and serum lectin were low abundance unlike the protein which was easily detected. This study represents the first attempt at understanding the LPS induced liver proteome of L. morii and our findings contribute to the identification of novel immune genes in lamprey. © 2016 Shanghai Ocean University. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Keywords: Liver proteome Lipopolysaccharide Immune gene Lampetra morii
1. Introduction Lampreys are one of the most ancient vertebrates alive today and are considered to be excellent models for studying vertebrate evolution, embryo development, and the origin of adaptive immunity (Amemiya, Saha, & Zapata, 2007; Sower et al., 2006). Lampreys use variable lymphocyte receptors composed of leucinerich repeats for antigen recognition (Pancer et al., 2004). In contrast, Antigen recognition is achieved in the jawed vertebrates through Ig-based B cell receptors (BCRs) and T-cell receptors (TCRs) (Das et al., 2013). These two types of anticipatory receptors evolved as convergent solutions for specific antigen recognition in the ancestors of jawless and jawed vertebrates. In structure, the V(D)J system in mammals and the VLR system in lamprey are unrelated. In the context of lymphocytic cells, they share homology at some level (Rast & Buckley, 2013). So far, three VLR genes (VLRA, VLRB, and VLRC) have been identified in lampreys (Pancer et al., 2004). These three proteins derived from VLRA, VLRB, and
* Corresponding author. School of Life Science, Liaoning Normal University, Liushu South Street No. 1, Dalian, China. E-mail address: [email protected] (Q. Li). Peer review under responsibility of Shanghai Ocean University.
VLRC share a common structure. Unlike the mammals, lampreys have no histologically identifiable thymus. However, lymphocytelike cells are abounding in several tissues in lamprey (Amemiya et al., 2007). Still, studies on molecules participating adaptive immunity were limited in lamprey. The liver is the biggest metabolic and detoxification organ in the body and plays an important role in the immune response of many species. To establish the role of the liver in the immune response of lamprey, we analyzed proteomic changes of lamprey liver after intraperitoneal injection of lipopolysaccharide (LPS). Thirteen differently expressed proteins were identified. Comparison of the abundance of differentially expressed proteins and their respective transcripts determined using quantitative real-time PCR (qPCR) revealed these were mismatched for cystathionase and Zgc:112210. This study provides new information about LPS induced immune gene transcripts in lamprey liver. 2. Materials and methods 2.1. Collection of animals The handling of lampreys and all experimental procedures were approved by the Animal Welfare and Research Ethics
http://dx.doi.org/10.1016/j.aaf.2016.09.002 2468-550X/© 2016 Shanghai Ocean University. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
10
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
Committee of the Institute of Dalian Medical University (Permit Number:SYXK2004-0029). Lampreys were obtained from the Tongjiang Valley, a branch of the Songhua River in Heilongjiang Province in China. These lampreys were kept in Fiber Reinforced Plastic (FRP) tanks with freshwater at 4e16 C before the experiments. 2.2. Proteomic changes of the lamprey liver after injecting with LPS 2.2.1. Lamprey liver protein extraction and solubilization Lampreys (three in each group) were intraperitoneally injected with PBS, LPS (10 mg) at 3 d-intervals with 3 injections. One group was injected with PBS (control) and the other was injected with LPS (treatment). After surface sterilization using 75% ethanol, lamprey liver was dissected out and lyophilized overnight. 0.5 g of the lyophilized liver was ground in liquid nitrogen and then solubilized in 5 ml ice-cold acetone containing 10% TCA and 0.07% DTT, vortexed and then incubated at 20 C overnight. Samples were centrifuged at 11000 rpm at 4 C for 30 min, and the pellets were washed three times with 5 ml ice-cold acetone containing 0.07% DTT and dried under a vacuum to remove residual acetone. Pellets were homogenized in 500 ml of lysis buffer. Lysis buffers that was initially optimized using different concentrations of Trisbase (0 mM Tris, 20 mM Tris or 40 mM Tris), 7.0 M urea, 2 M thiourea, 0.1 M DTT, 4% CHAPS, and 1 mM PMSF were optimized. The homogenized samples were centrifuged twice at 14000 rpm at 4 C for 30 min, and the resulting supernatants were used for 2-DE analysis. 2.2.2. 2-DE The protein concentration of extracts of lamprey liver was determined using a Bio-Rad Protein Assay (Bio-Rad, USA) following the instructions of the manufacturer. In brief, 300 mg of samples from lamprey liver protein extracts were diluted to a final volume of 125 ml with the rehydration buffer containing 7.0 M urea, 2 M thiourea, 0.1 M DTT, and 4% CHAPS, and 0.25% v/v IPG buffer (BioRad). Samples were loaded on 7 cm IPG strips (Bio-Rad) for rehydration at room temperature for 12e16 h. IEF was carried out at 0.01 mA/IPG under the following program: 250 V, 30 min, linear; 500 V, 30 min, linear; 1000 V, 1 h, rapid; 4000 V, 3 h, linear; 4000 V, 28000 Vh, linear; 500 V, linear. After IEF, the IPG gel strips were equilibrated with equilibration buffer (6 M urea, 2% SDS, 0.375 M pH 8.8 Tris-HCl, 20% glycerol) containing 20 mg/ml DTT for about 15 min and then substituted with the same buffer containing 25 mg/mL iodoacetamide for about 15 min at room temperature. The second dimension separation was performed on 12% SDSpolyacrylamide gel. Electrophoresis was carried out at 5 mA per gel for 1 h, and then at 15 mA per gel for 2 h using a PowerPacTM Basic 300 V system (Bio-Rad). After the electrophoresis, gels were fixed (10% glacial acetic acid, 40% absolute ethyl alcohol, and 50% double distilled water) prior to staining with Coomassie Brilliant Blue (0.12% CBB G-250, 10% (NH4)2SO4, 11.8% phosphoric acid, 20% methanol) overnight. The stained gels were scanned using a BIORAD UNIVERSAL HOOD II. The 2D gel images were analyzed using PDQuest version 8.0. The detected protein spots showing significant differences between the livers of control and LPS treated lamprey were selected for identification. The 2-DE analysis was repeated for at least three independent biological replicates. 2.2.3. Protein identification and database search Protein spots of interest were manually excised from a CBBstained gel and subjected to in-gel trypsin digestion. After that, peptides were extracted twice with 60 ml of extract solution (5% formic acid in 50% ACN). The extracts were pooled and dried completely by Speed Vac (BT85, Millrock Technology). Peptide
mixtures were redissolved using 98% MilliQ-H2O, 2% CH3CN, 0.1% Formic acid and mixed. MS analysis of peptide was performed on an ABI 4700 TOF-TOF Proteomics system (Applied Biosystems). All acquired spectra of samples were processed using 4700 ExploreTM Software (Applied Biosystems) in the default mode. The peaklist-generating software was GPS V3.6, and MASCOT (Matrix Science) V2.4.0 was used to search the lamprey and NCBInr database. The following search parameters were used: trypsin digest with three missing cleavage, MS tolerance of 100 ppm, and MS/MS tolerance of 1.5 Da, the expectation value for accepting individual spectra was 44%, the justification of the threshold score employed was p < 0.05. 2.3. Gene cloning of the detected protein spots Total RNA was extracted from lamprey liver tissue using RNAiso plus (D9108A, TaKaRa). The concentration of extracted RNA was quantified using BioPhotometer plus (Eppendorf, Germany) and genomic DNA contaminants were removed were removed using a gDNA Eraser (Perfect Real Time) kit before synthesis ofcDNA using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) kit after quantifying the RNA concentration. The coding regions of the genes encoding the differentially expressed lamprey liver proteins were cloned into the pMD18-T simple vector and sequenced. 2.4. Quantitative RTePCR (qPCR) analysis The primers used for the quantification of the differentially expressed protein coding genes, including prolyl 4-hydroxylase, protein disulfide isomerase family A, fgg-201, serum lectin, Zgc:112210, 3-hydroxybutyrate dehydrogenase, cofilin 1, and a novel gene are listed in Table 1. Petromyzonmarinus glyceraldehyde 3-phosphate dehydrogenase (PmGAPDH) gene (GenBank accession ID AY578058) was used as the internal control. Each sample was analyzed with three biological triplicates. The expression pattern of the differentially expressed protein coding genes identified in liver were determined by qPCR in several tissues, including intestine, kidney, heart, gill, and lymphocyte-like cells. qPCR was performed using the following conditions: 95 C for 10 s, then 40 cycles (Cq) at 95 C for 5 s, 55 C for 20 s and 72 C for 20 s. Melting-curve analysis between 60 C and 95 C was performed after each PCR to check the specificity of the amplification product. The relative mRNA levels of the target genes were calculated by the 2DDCt method, where DCt is the difference between the Ct-value of the target gene and that of PmGAPDH, the internal control gene to which all expression levels were normalized. Three independent replicates were performed for each data set. 3. Results 3.1. Lamprey liver proteomic changes following injection with LPS The 2-DE gel images of lamprey liver proteins stained with CBB were analyzed using PDQuest software 8.0 (Bio-Rad) and about 400 spots were found in each profile. The gel spot patterns in the protein profiles after lysis buffer optimization are presented in Figure S1. Optimization studies revealed that lysis buffer without Tris-base was effective for liver protein extraction (Figure S1a). Protein spots with varying staining intensities between treatment of PBS (control) and LPS (treatment) were selected (Fig. 1), and three spots were up-regulated and ten spots were down-regulated (Fig. 2a). The fold-change in intensity of the differential proteins in control and LPS treatment is shown in Fig. 2b. The information of identified protein spots, including molecular weight (MW), pI value, accession number, unique peptides
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
11
Table 1 Primers used to amplify target genes in this study. Assay
Gene
Primer direction
Primer sequence 50 -30
qPCR
polyl 4-hydroxylase
qPCR
protein disulfide isomerase family A, member 4
qPCR
fgg-201
qPCR
lamprey novel gene (ENSPMAP00000011067)
qPCR
Cystathionase gene
qPCR
serum lectin
qPCR
zgc:112210-201
qPCR
3-hydroxybutyrate dehydrogenase gene
qPCR
lamprey novel gene (ENSPMAP00000009400)
qPCR
cfl1-201
qPCR
pmGAPDH
Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward Forward Reverse forward
TGACATCGTGAACTGGCTAAAGAA CTTTGAGGAACACCTTAGCATCCT GGAAGGGCAAAGCGTATGACTA ACCCAGAATGACCACATCATCAC AAGGACAGCGGACTCTACTACATCA AGCCATTGCCATTCTCGATTT TGACATCAAGGAGAAGCTCTGCTA TGAATGCCACACGACTCCATT GGAAGACATCATTGCGGACAT AGGCACAGCAACAAACGTCAT GGACGCTTCAAGGTTATGTTCAC TCAGTGTTGCAATTGTCAAGCA AAATCTCACCCTCAACTCCATCTC CACAAAACACATGAAATGCCTGTAC GAGTCCTGAATGTGACGAGCAA CAAAATAGTTCCATGGTGGACAAAC ACACACGATGACTTCCCAGGTT GTATGCCATGGAGAGGTAGACGTA AGAAGAAGTTTACAGGCATCAAGCA CCAGAGTTAACCGATCTTGAATGTC ACCCCTTCATTGACCTGGAGTA TGCTTACCCCATGGGATGTT
Fig. 1. The raw 2-DE images of the proteome of PBS (a) and LPS (b) induced lamprey liver. The results were obtained by separating 300 mg of total protein extracted from liver in an IPG gel (pH 4e7, 7 cm) followed by SDS-PAGE (12% polyacrylamide gel). The numbers indicate protein spots with at least a1.5-fold change in intensity.
detected, sequence coverage, and expression pattern, are listed in Table 2. 3.2. qPCR analysis of the differentially expressed protein coding genes The changes in transcript abundance of up- and down-regulated proteins were verified by qPCR. As displayed in Fig. 3b, expression of cystathionase (spot 5), Zgc:112210-201 (spot 7), and glycine Nmethyltransferase (spot 9) transcripts in liver diverged from the protein expression level. Changes in expression at the mRNA and protein levels were consistent for the other proteins identified in the liver (Fig. 3a), the exception was 3-hydroxybutyrate dehydrogenase (spot 8) and blood plasma apolipoprotein LAL2 (spot 13), for which transcripts could not be amplified by qPCR. The proteins cystathionase (spot 5), Zgc:112210-201 (spot 7), and glycine N-methyltransferase (spot 9) were down-regulated 5.56, 1.47, and 4.76 times, respectively, in the liver of LPS treated lamprey. Transcripts for cystathionase, zgc:112210-201, and glycine N-methyltransferase in were up-regulated by 2.39, 128.79, and 3.69 times, respectively, in the liver of LPS treated lamprey. Transcripts for polyl 4-hydroxylase (spot 1), serum lectin (spot 6), Zgc:112210201 (spot 7), and glycine N-methyltransferase (spot 9) were significantly up-regulated (P < 0.05) by LPS treatment. Both
proteins and transcripts were down-regulated for protein disulfide isomerase family A (spot 2), fibrinogen gamma chain (spot 3), and two unidentified proteins (spot 4 and 10) in liver from LPS treated liver. 3.3. Expression patterns of the differentially expressed protein coding genes in lamprey various tissues The transcript abundance of up- and down-regulated proteins in various tissues of L. morii was analyzed by qPCR. Expression of Zgc:112210-201 (spot 7) at the mRNA level was almost undetectable in various tissues. Expression of polyl 4-hydroxylase (spot 1), protein disulfide isomerase family A, member 4 (spot 2), cystathionase (spot 5), and serum lectin (spot 6) at the mRNA level was in low abundance compared with other identified proteins. Expression of polyl 4-hydroxylase (spot 1) was relative higher in gill, supraneural myeloid body, and intestine relative to the other tissues analyzed (Fig. 4a). Similarly, transcripts for the two novel proteins (spot 4 and spot 10) identified were most abundant in the gill and intestine (Fig. 4d and g). Expression of cystathionase (spot 5) and serum lectin (spot 6) at the mRNA level was higher in intestine (Fig. 4e and f). The abundance of transcripts for protein disulfide isomerase family A (spot 2) and cofilin 1 (spot 12) was detected higher in the supraneural myeloid body and heart
12
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
Fig. 2. Enlarged regions of the 2-DE images of the 13 differentially expressed proteins of PBS and LPS induced lamprey liver (a); Fold change in intensity for each differential protein spot (b), the intensity of each spot in PBS treatment was used as the standard. Data are shown are the mean with the SDs (n 3).
respectively relative to the other tissues analyzed (Fig. 4b and h). In liver and kidney, higher amount of fibrinogen gamma chain (spot 3) transcripts were more abundant than in other tissues (Fig. 4c). Transcripts encoding glycine N-methyltransferase (spot 9) at the mRNA level was only detected in liver. 4. Discussion Lipopolysaccharide (LPS), a main component of Gram-negative bacteria cell walls, is an activator of Toll-like receptor 4 in mammals (Poltorak et al., 1998). LPS has previously been shown to induce an immune response in lampreys (Pang, Xiao, Liu, & Li, 2012; Tsutsui, Nakamura, & Watanabe, 2007). Stimulation of the
immune response in lamprey by administration of LPS was used as means to identify novel immune genes in lamprey. P4HB, known as protein disulphide isomerase, is a multifunctional protein that catalyses the formation and rearrangement of disulfide bonds (Sun et al., 2013). P4HB acts as a molecular chaperone of endoplasmic reticulum (ER) (Noiva, 1999). As an ER chaperone, P4HB may play a role in oncogenic signaling that regulates cancer cell survival, progression, and angiogenesis (Kern et al., 2009; Ni & Lee, 2007). Up-regulation of the ER chaperones is reported to be correlated with therapeutic resistance by bypassing the cell death mechanisms (Dong et al., 2005; Reddy et al., 2003). In our study, expression of P4HB was up-regulated at both the protein and mRNA level. The involvement of P4HB in
Table 2 Identifications of differentially expressed protein spots from the liver of control and LPS treated lamprey by MALDI-TOF-MS/MS. Spot number
MW/pI
Protein identification
Ensembl peptide ID
Unique peptides detected
Sequence coverage (%)
Expression pattern
1 2 3 4 5 6 7 8 9 10 11 12 13
21000/4.75 71400/5.05 38400/5.51 41800/5.10 44500/6.06 36400/5.30 28300/8.92 26200/5.63 7700/7.56 20300/5.04 20300/5.04 18600/7.47 20500/5.98
Polyl 4-hydroxylase Protein disulfide isomerase family A, member 4 Fibrinogen gamma chain Lamprey novel protein Cystathionase Serum lectin Zgc:112210-201 3-Hydroxybutyrate dehydrogenase Glycine N-methyltransferase Lamprey novel protein Lamprey novel protein Cofilin 1 Blood plasma apolipoprotein LAL2
ENSPMAP00000010221 ENSPMAP00000000333 ENSPMAP00000001295 ENSPMAP00000011067 ENSPMAP00000001854 gij13094239 (NCBI) ENSPMAP00000008590 ENSPMAP00000004475 ENSPMAP00000010887 ENSPMAP00000009400 ENSPMAP00000009400 ENSPMAP00000009791 gij114056 (NCBI)
10 7 5 17 2 4 6 2 2 5 11 5 6
45.6% 13.1% 15% 18% 5.1% 15% 27.6% 12.2% 42% 42.4% 57.1% 38% 27.7%
Up-regulated Down-regulated Down-regulated Down-regulated Down-regulated Up-regulated Down-regulated Down-regulated Down-regulated Down-regulated Down-regulated Up-regulated Down-regulated
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
13
Fig. 3. Amplification by qPCR of the gene transcripts encoding the differentially expressed proteins. Changes in expression of transcripts and their corresponding proteins that were consistent (a); Changes in expression of transcripts and their corresponding proteins that were not consistent (b). The columns represent mean fold change of 12 gene transcripts encoding differentially expressed proteins in the LPS vs. PBS proteome. Error bars represent the standard deviation (n 3).
Fig. 4. qPCR analysis of gene expression in different tissues. 1, gill; 2, supraneural myeloid body; 3, liver; 4, kidney; 5, heart; 6, intestine. (a) polyl 4-hydroxylase; (b) protein disulfide isomerase family A; (c) fibrinogen gamma chain; (d) lamprey novel protein; (e) cystathionase; (f) serum lectin; (g) lamprey novel protein; (h) cofilin 1.
lamprey immunity needs to be clarified. Lectins originating from intracellular, extracellular or membrane-bound sources are carbohydrate-binding proteins (Drickamer, 1988; Hirabayashi, Oda, Oohara, Yamagata, & Kasai, 1987). In lamprey, the mannose-binding lectin had been isolated and characterized. Results indicated that lectin complement pathway shown to play a pivotal role in defending the body against microorganisms (Takahashi et al., 2006). The induction by LPS of serum lectin in the lamprey liver indicates that the complement pathway, a central component of innate immunity was stimulated. Cofilin 1 had been widely studied
as a biomarker of a more aggressive phenotype of different types of cancer such as breast, gastrointestinal and non-small-cell lung cancer (NSCLC) (Wang, Eddy, & Condeelis, 2007; Yan et al., 2010; Alves Castro et al., 2010). After stimulation with LPS, expression of cofilin1 increased significantly at the mRNA level in lamprey liver but its potential role in immunity remains to be established. zgc:112210-201 is a novel gene that has not previously been reported. Interestingly, obvious difference of Zgc:112210-201 gene expression at the protein and mRNA level could be detected after stimulation with LPS. Protein disulfide isomerase (PDI) was
14
Y. Li et al. / Aquaculture and Fisheries 1 (2016) 9e14
reported to have essential roles in health and disease, including lipid homeostasis, hemostasis, infectious disease, cancer, neurodegeneration, and infertility (Benham, 2012). PDI, which usually resides in the endoplasmic reticulum (ER), also has molecular chaperone properties (Benham, 2012). Overexpression of PDI is linked to an increase in viral membrane fusion, and it has been suggested this may allow bacteria and viruses to subvert PDI family members during infection (Jain, McGinnes, & Morrison, 2008) and it is an interesting candidate for future studies of the lamprey immune system. Fibrinogen was considered to be the markers of inflammation (Danese et al., 2008; Vaccarino et al., 2008). Fibrinogen gamma chain (FIBG) was lower in patients with major depression than in healthy controls (Huang, Sung, & Chen, 2014). As a potential marker of inflammation, functional study of FIBG in lamprey should be explored. 5. Conclusions The study of the LPS induced liver proteome has provided information about genes that may be involved in lamprey immunity. To our knowledge, this is the first study to investigate the lamprey liver proteome after induction with LPS. Several differentially expressed proteins were identified in the lamprey liver after LPS stimulation using 2-DE coupled to MALDI-TOF-MS and of the proteins identified, only polyl 4-hydroxylase (P4HB), serum lectin, Zgc:112210-201, and cofilin 1 were significantly up-regulated at the mRNA. However, these data represent only preliminary results about the role of the liver in lamprey immunity and further in depth studies will be required. Acknowledgements This study was supported by Natural Science Foundation of China (Grant No. 31500106), the Youth Foundation of Liaoning Normal University (Grant No. LS2014L009), and the Ph.D Start-up Fundation of Liaoning Province, China (Grant No. 201501107). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.aaf.2016.09.002. References Alves Castro, M. A, Dal-Pizzol, F., Zdanov, S., Soares, M., Müller, C. B., & Lopes, F. M. (2010). CFL1 expression levels as a prognostic and drug resistance marker in non-small-cell lung cancer. Cancer, 116(15), 3645e3655. Amemiya, C. T., Saha, N. R., & Zapata, A. (2007). Evolution and development of immunological structures in the lamprey. Current Opinion in Immunology, 19(5), 535e541. Benham, A. M. (2012). The protein disulfide isomerase family: Key players in health and disease. Antioxidants & Redox Singaling, 16(8), 781e789. Danese, A., Moffitt, T. E., Pariante, C. M., Ambler, A., Poulton, R., & Caspi, A. (2008). Elevated inflammation levels in depressed adults with a history of childhood maltreatment. Archives of General Psychiatry, 65(4), 409e415.
Das, S., Hirano, M., Aghaallaei, N., Bajoghli, B., Boehm, T., & Cooper, M. D. (2013). Organization of lamprey variable lymphocyte receptor C locus and repertoire development. Proceedings of the National Academy of Sciences of the United States of America, 110(15), 6043e6048. Dong, D., Ko, B., Baumeister, P., Swenson, S., Costa, F., Marklind, F., … Lee, A. S. (2005). Vascular targeting and antiangiogenesis agents induce drug resistance effector GRP78 within the tumor microenvironment. Cancer Research, 65(13), 5785e5791. Drickamer, K. (1988). Two distinct classes of carbohydrate-recognition domains in animal lectins. Journal of Biology Chemistry, 263(20), 9557e9560. Hirabayashi, J., Oda, Y., Oohara, T., Yamagata, T., & Kasai, K. (1987). Immunological cross-reactivity between b-galactoside-binding lectins of vertebrates. Possible relationship of antigenicity to oligomeric structure. Biochimica et Biophysica Acta, 916(3), 321e327. Huang, T. L., Sung, M. L., & Chen, T. Y. (2014). 2D-DIGE proteome analysis on the platelet proteins of patients with major depression. Proteome Science, 12(1), 1. Jain, S., McGinnes, L. W., & Morrison, T. G. (2008). Overexpression of thiol/disulfide isomerases enhances membrane fusion directed by the Newcastle disease virus fusion protein. Journal of Virology, 82(24), 12039e12048. Kern, J., Untergasser, G., Zenzmaier, C., Sarg, B., Gastl, G., Gunsilius, E., et al. (2009). GRP-78 secreted by tumor cells blocks the antiangiogenic activity of bortezomib. Blood, 114(18), 3960e3967. Ni, M., & Lee, A. S. (2007). ER chaperones in mammalian development and human diseases. FEBS Letters, 581(19), 3641e3651. Noiva, R. (1999). Protein disulfide isomerase: The multifunctional redox chaperone of the endoplasmic reticulum. Seminars in Cell & Developmental Biology, 10(5), 481e493. Pancer, Z., Amemiya, C. T., Ehrhardt, G. R., Ceitlin, J., Gartland, G. L., & Cooper, M. D. (2004). Somatic diversification of variable lymphocyte receptors in the agnathan sea lamprey. Nature, 430(6996), 174e180. Pang, Y., Xiao, R., Liu, X., & Li, Q. (2012). Identification and characterization of the lamprey high-mobility group box 1 gene. PLoS One, 7(4), e35755. Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Van Huffel, C., Du, X., … Beutler, B. (1998). Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: Mutations in Tlr4 gene. Science, 282(5396), 2085e2088. Rast, J. P., & Buckley, K. M. (2013). Lamprey immunity is far from primitive. Proceedings of the National Academy of Sciences of the United States of America, 110(15), 5746e5747. Reddy, R. K., Mao, C., Baumeister, P., Austin, R. C., Kaufman, R. J., & Lee, A. S. (2003). Endoplasmic reticulum chaperone protein GRP78 protects cells from apoptosis induced by topoisomerase inhibitors: Role of ATP binding site in suppression of caspase-7 activation. Journal of Biology Chemistry, 278(23), 20915e20924. Sower, S. A., Moriyama, S., Kasahara, M., Takahashi, A., Nozaki, M., Uchida, K., … Kawauchi, H. (2006). Identification of sea lamprey GTHbeta-like cDNA and its evolutionary implications. General and Comparative Endocrinology, 148(1), 22e32. Sun, S., Lee, D., Ho, A. S., Pu, J. K., Zhang, X. Q., Lee, N. P., … Leung, G. K. K. (2013). Inhibition of prolyl 4-hydroxylase, beta polypeptide (P4HB) attenuates temozolomide resistance in malignant glioma via the endoplasmic reticulum stress response (ERSR) pathways. Neuro-oncology, 15(5), 562e577. Takahashi, M., Iwaki, D., Matsushita, A., Nakata, M., Matsushita, M., Endo, Y., … Fujita, T. (2006). Cloning and characterization of mannose-binding lectin from lamprey (Agnathans). Journal of Immunology, 176(8), 4861e4868. Tsutsui, S., Nakamura, O., & Watanabe, T. (2007). Lamprey (Lethenteron japonicum) IL-17 upregulated by LPS-stimulation in the skin cells. Immunogenetics, 59(11), 873e882. Vaccarino, V., Brennan, M. L., Miller, A. H., Bremner, J. D., Ritchie, J. C., Lindau, F., … Hazen, S. L. (2008). Association of major depressive disorder with serum myeloperoxidase and other markers of inflammation: A twin study. Biological Psychiatry, 64(6), 476e483. Wang, W., Eddy, R., & Condeelis, J. (2007). The cofilin pathway in breast cancer invasion and metastasis. Nature Reviews Cancer, 7(6), 429e440. Yan, B., Yap, C. T., Wang, S., Lee, C. K., Koh, S., Omar, M. F., … Kumarasinghe, M. P. (2010). Cofilin immunolabelling correlates with depth of invasion in gastrointestinal endocrine cell tumors. Acta Histochemica, 112(1), 101e106.