- Email: [email protected]
Universal primers for rapid detection of hytrosaviruses
Journal of Virological Methods 171 (2011) 280–283
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Universal primers for rapid detection of hytrosaviruses Adly M.M. Abd-Alla a,∗ , Tamer Z. Salem c,d , Andrew G. Parker a , Yongjie Wang b,1 , Johannes A. Jehle b , Marc J.B. Vreysen a , Drion Boucias c a
Insect Pest Control Laboratory, Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture, Vienna, Austria Agricultural Service Center Palatinate, Breitenweg 71, 67435 Neustadt/Wstr, Germany c Entomology and Nematology Department, PO Box 110620, University of Florida, Gainesville, FL 32611-0620, USA d Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, 9 Gamaa Street, Giza 12619, Egypt b
a b s t r a c t Article history: Received 6 July 2010 Received in revised form 23 September 2010 Accepted 27 September 2010 Available online 12 October 2010 Keywords: Diptera Glossina Musca domestica Merodon equestris Glossinidae Salivary gland hypertrophy virus Muscidae Syrphidae
Hytrosaviridae is a proposed virus family encompassing viruses that cause salivary gland hypertrophy (SGH) syndrome in infected insects and reduce the fertility in their dipteran insect hosts. They contain a large, double stranded DNA genome of 120–190 kbp. To date, these viruses have been detected only in adult Diptera. These include hytrosaviruses detected in various tsetse fly species (Glossina spp.), the narcissus bulb fly Merodon equestris and the house fly Musca domestica. The limited number of hytrosaviruses reported to date may be a reflection of the frequent absence of external symptoms in infected adult flies and the fact that the virus does not cause rapid mortality. Based on the complete genome sequence of Glossinia pallidipes (GpSGHV) and Musca domestica (MdSGHV) salivary gland hypertrophy viruses, a PCR based methodology was developed to detect the viruses in these species. To be able to detect hytrosaviruses in other Diptera, five degenerate primer pairs were designed and tested on GpSGHV and MdSGHV DNA using gradient PCR with annealing temperatures from 37 to 61 ◦ C. Two pairs of primers were selected from p74, two pairs from PIF-1 and one pair from ODV-e66 homologous proteins. Four primer pairs generated a virus specific PCR product on both MdSGHV and GpSGHV at all tested annealing temperatures, while the ODV-e66 based primers did not generate a virus specific product with annealing temperatures higher that 47 ◦ C. No non-specific PCR product was found when using genomic DNA of infected flies as template DNA. These results offer new sets of primers that could be used to detect hytrosaviruses in other insects. © 2010 Elsevier B.V. All rights reserved.
The hytrosaviruses constitute a unique group of entomopathogenic viruses for which a new family has recently been proposed to the International Committee on Taxonomy of Viruses (ICTV) (Abd-Alla et al., 2009; Lietze et al., in press). These viruses possess a large (approximately 120–190 kbp), circular, doublestranded DNA genome that is packaged in long, enveloped, rod-shaped virions. The salient feature of hytrosavirus infection is the hypertrophy of adult salivary glands, that can increase four-fold in diameter compared to uninfected salivary glands. This syndrome is therefore designated as “salivary gland hypertrophy” (SGH) (Burtt, 1945). The SGH syndrome was first described in wild populations of the tsetse fly Glossina pallidipes (Diptera: Glossinidae)
∗ Corresponding author at: Insect Pest Control Laboratory, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Wagramer Straße 5, A-1400 Vienna, Austria. Tel.: +43 1 2600 28425; fax: +43 1 2600 28447. E-mail addresses: [email protected] (A.M.M. Abd-Alla), [email protected] (Y. Wang). 1 Present address: Laboratory for Marine Virology, College of Food Science and Technology, Shanghai Ocean University, Shanghai, China. 0166-0934/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2010.09.025
(Burtt, 1945; Whitnall, 1934), but later detected in many tsetse species and in different African regions (see references in AbdAlla et al., 2009). Jaenson (1978) identified a nuclear rod-shaped enveloped DNA virus averaging 70 nm × 640 nm in size as the causative agent of SGH. The SGH syndrome was also described in populations of adult narcissus bulb fly, Merodon equestris (Diptera: Syrphidae) (Amargier et al., 1979; Lyon, 1973). It was speculated that long, rod-shaped virus particles isolated from the hypertrophied salivary glands were causing gland hypertrophy (Amargier et al., 1979). Finally, SGH symptoms were also described in adult house flies, Musca domestica (Diptera: Muscidae) (Coler et al., 1993). Although the number of described hytrosaviruses is limited, these viruses are currently considered very important in view of (i) the negative impact caused by these viruses on the mass-rearing of tsetse flies for use in an area-wide integrated pest management programme with a sterile insect technique (SIT) component and (ii) the potential use of these viruses as a biocontrol agent for house fly pest populations. Prior studies demonstrated that hytrosavirus infections reduced the fertility of females, reduced mating efficiency of infected males and shortened their life span (Jaenson, 1986; Lietze et al., 2007; Sang et al., 1997).
A.M.M. Abd-Alla et al. / Journal of Virological Methods 171 (2011) 280–283
281
Table 1 Degenerate and specific oligonucleotide primers for hytrosaviruses. Target gene
Degenerate p74
PIF-1
ODV-e66 Specific GpSGHV MdSGHV
Primer name
Primer sequence (5 -3 )
Target position in GpSGHV gene
p74-1F p74-1R p74-2F p74-2R pif1-1F pif1-1R pif1-2F pif1-2R odv-e66-R odv-e66-F
TATMGWCCSGAGATWATGTCRCAC MACRTTYGGATCRATAAARAAMGC TGTCARATWAATTATCCMCGYGGTAA AARTCATCGCAATARTAYTTRTT GGSAARTAYGCGAATGCMATG WCCAGGMGGWGTYGGATA AACGAYGAYTATYTRATWGGTAA GGTATRGTRCCRTTGTAGACWCG GCAATWATWWTTATMGCRAT WGGATAWGTTATWGARAA
94–117 826–849 232–257 583–605 1027–1047 1480–1497 999–1021 1380–1402 67–86 517–534
ORF05F ORF05R ORF106F ORF106R
GCATTCACAGCATCCCAATTTT CTTGTCAGCGCCACGTACAT CGGCAGCAACCTTATTCATT CGTCGTCTCCTCCTCTTCAG
121–142 502–521 – –
PCR product size (bp) from GpSGHV
Target position in MdSGHV gene 103–126 898–921 238–263 655–677 983–1003 1457–1475 956–978 1373–1395 65–84 506–523
708 373 432 403 430
– – 71–90 659–678
400
PCR product size (bp) from MdSGHV
Degeneracy*
458
32 32 16 16 16 16 32 16 32 16
608
0 0 0 0
818 439 519 439
M = A or C; R = A or G; S = C or G; W = A or T; Y = C or T. * Number of primer permutations (2n , where n is the number of variable bases in the primer).
A high incidence of SGH in a tsetse colony makes it difficult to maintain this colony, let alone expand it for mass-rearing purposes. Moreover, the consequences of releasing sterile males with SGH might be detrimental for the efficacy of the SIT. Therefore, novel strategies are required to manage the virus in G. pallidipes colonies. After completing the GpSGHV genome sequence, various strategies were proposed to manage the virus infection in tsetse colonies such as the neutralization of virus infection by virus-specific antibodies and targeting the DNA replication by silencing virus specific genes by RNAi. To maximize the benefit of these strategies, common regions in the genome of multiple strains of the virus will be selected by screening for strains in tsetse flies of different species collected from various locations. Using GpSGHV specific primers was inefficient as negative samples indicate only the absence of one specific virus strain (Abd-Alla et al., 2010; Kariithi et al., in press). The ability of hytrosavirus to sterilize the house fly, Musca domestica, makes the MdSGHV a potential biocontrol agent for house fly. The global distribution of the house fly prompted a study of the distribution of MdSGHV to explore the genetic diversity of this virus and to find in each geographical region local isolates that could be used for biocontrol. As with GpSGHV, the use of MdSGHV specific primers for screening will be unsuitable to detect new
P74
(94-117)
1F 2F
(232-257)
(583-605)
373 bp
2R
(826-849)
1R
708 bp (136140-136162)
PIF-1
(94-117)
1F ODV-e66
homologous viruses replicating in other dipterans (Geden et al., 2008; Prompiboon et al., 2010). Degenerate primers were therefore designed in an attempt to identify the presence of other species and strains of hytrosavirus. Five degenerate primer pairs were designed based on the sequence of GpSGHV (NC 010356.1) and MdSGHV (NC 010671) by selecting and comparing conserved amino acid sequences or similar nucleotide sequences. It should be noted that, although the GpSGHV and MdSGHV are presently grouped together, collinearity analysis showed much disparity in genetic content (Abd-Alla et al., 2008; Garcia-Maruniak et al., 2009). From the homologous regions, five degenerate primer pairs were synthesized (Eurofins MWG Operon, Ebersberg Germany, Table 1). These included two primer pairs from putative p74, two pairs from putative PIF-1 and one pair from putative ODV-e66 protein coding sequences (Fig. 1). The DNA of GpSGHV and MdSGHV was extracted from purified virus as previously described (Abd-Alla et al., 2007; Garcia-Maruniak et al., 2008) and used as DNA template for PCR reactions. Gradient PCR reactions were carried out with Taq DNA polymerase according to the manufacturer’s instructions (Thermo) with a final primer concentration of 0.2 M. PCR cycling conditions were 94 ◦ C for 45 s, 37–61 ◦ C for 45 s, and 72 ◦ C for 1 min for 35 cycles, with an initial template denaturation step at 94 ◦ C for 5 min. To optimize the PCR,
2F 1F (136168-136187)
(136521-136543)
432 bp
2R
1R (136620-136637) 403 bp
(4906-4923)
1R
(5354-5373)
430bp Fig. 1. Schematic representation of degenerate primer positions, PCR product length estimated for GpSGHV genes.
282
A.M.M. Abd-Alla et al. / Journal of Virological Methods 171 (2011) 280–283
Fig. 2. Optimization of annealing temperature for degenerate primers in PCR reaction using (A) the viral DNA as template, (B) the genomic DNA of infected tsetse flies and genomic DNA of house fly contaminated with GpSGHV and MdSGHV DNA respectively as template.
several annealing temperatures of the primers were tested using a plasmid containing the selected viral DNA sequence as template. PCR products were analyzed on 1% agarose gels. The results indicate that all degenerate primers were able to detect the viral DNA of both GpSGHV and MdSGHV using PCR with a wide range of annealing temperature from 37 to 61 ◦ C and give one specific PCR product (Fig. 2A). With the exception of the ODV-e66 primer pair, all primer pairs amplified the expected length of their respective PCR product over the complete range of annealing temperatures as predicted from the genome sequence of each virus (see Table 1). The ODV-e66 primer pair seems to have a lower annealing temperature and no PCR product was detected when the annealing temperature was higher than 47 ◦ C (Fig. 2A).
To assess the specificity of the degenerate primers, the genomic DNA of infected and uninfected (determined by PCR with GpSGHV specific primers) tsetse flies was extracted as previously described (Abd-Alla et al., 2007) and used as DNA template for PCR reaction. Due to the absence of infected house flies, the healthy house fly DNA was extracted and spiked with extracted MdSGHV DNA, the mixed and non-mixed DNA being used as template for the PCR reaction (Fig. 2B). The results showed similar PCR products to those found with the PCR reaction carried out using the extracted viral DNA and no non-specific PCR products were found. With the exception of the pif1-1 primer set, no PCR product was observed with any other degenerate primer at any annealing temperature using healthy house fly DNA. Slight PCR amplification was found with pif1-1 pairs with annealing temperatures ranging from 39.1 to
A.M.M. Abd-Alla et al. / Journal of Virological Methods 171 (2011) 280–283
54.9 ◦ C. With uninfected tsetse flies, several non-specific PCR products were observed at annealing temperatures lower than 47 ◦ C with the primer pairs of p74-1, pif1-1 and pif1-2, while with the p74-2 primer set a unique PCR band, with the similar size as the band found with the viral DNA, was observed at all tested annealing temperatures. No non-specific band was observed with the odv-e66 primer pair. The presence of a non-specific product with uninfected tsetse flies indicates that the primers match with tsetse genomic DNA or with DNA from another viral strain that is not amplified by the standard GpSGHV primers used to select uninfected flies. Analysing the nature of the non-specific PCR product will be the subject of further studies. To avoid the non-specific PCR products with tsetse flies an annealing temperature of 58 ◦ C for p74-1, pif1-1, and pif1-2 and 45 ◦ C for odv-e66 is recommended. For p74-2, 60 ◦ C is recommended as the annealing temperature combined with sequencing the PCR product. Although non-specific PCR products were observed with the uninfected house flies and tsetse flies, only one dominant PCR product was observed with infected flies. These results indicate the high specificity of the primer for the hytrosavirus genomes. These results were expected as p74, pif-1 and odv-e66 are insect virus-specific genes which play an important role in oral infection by these viruses and are not expected to be found in the insect genome (Faulkner et al., 1997; Kikhno et al., 2002; Kuzio et al., 1989; Slack et al., 2001). The result presented in this note offer for the first time the sequence of several degenerate primer sets with the optimal conditions to detect hytrosavirus in tsetse flies and house flies. Due to the importance of the p74, pif-1 and odv-e66 genes for hytrosavirus and other insect viruses it is expected that these genes will be conserved in these viruses. The presence of these genes enables the degenerate primers to detect hytrosaviruses carrying these genes not only in tsetse and house flies, but in all Diptera and probably in other insect orders. The availability of these primers will facilitate detection of hytrosavirus in a wide range of insects and is expected to result in the discovery of other hytroviruses in other insects. It is worth noting that many tsetse flies carry asymptomatic infection with GpSGHV and even dissections cannot detect symptoms. In such cases the degenerate primers will greatly assist in the detection of different virus strains even if in these asymptomatic flies. Acknowledgments We thank Abdul Hasim Mohamed, and Carmen Marin for their help with DNA extraction and tsetse fly rearing respectively. References Abd-Alla, A., Bossin, H., Cousserans, F., Parker, A., Bergoin, M., Robinson, A., 2007. Development of a non-destructive PCR method for detection of the salivary gland hypertrophy virus (SGHV) in tsetse flies. J. Virol. Methods 139, 143–149. Abd-Alla, A.M.M., Kariithi, H., Parker, A.G., Robinson, A.S., Kiflom, M., Bergoin, M., Vreysen, M.J.B., 2010. Dynamics of the salivary gland hypertrophy virus in lab-
283
oratory colonies of Glossina pallidipes (Diptera: Glossinidae). Virus Res. 150, 103–110. Abd-Alla, A.M.M., Cousserans, F., Parker, A.G., Jehle, J.A., Parker, N.J., Vlak, J.M., Robinson, A.S., Bergoin, M., 2008. Genome analysis of a Glossina pallidipes salivary gland hypertrophy virus (GpSGHV) reveals a novel large double-stranded circular DNA virus. J. Virol. 82, 4595–4611. Abd-Alla, A.M.M., Vlak, J.M., Bergoin, M., Maruniak, J.E., Parker, A.G., Burand, J.P., Jehle, J.A., Boucias, D.G., 2009. Hytrosaviridae: a proposal for classification and nomenclature of a new insect virus family. Arch. Virol. 154, 909–918. Amargier, A., Lyon, J.P., Vago, C., Meynadier, G., Veyrunes, J.C., 1979. Mise en evidence et purification d’un virus dans la proliferation monstrueuse glandulaire d’insectes. Etude sur Merodon equestris F. (Diptere, Syrphidae). C. R. Acad. Sci. D 289, 481–484. Burtt, E., 1945. Hypertrophied salivary glands in Glossina: evidence that G. pallidipes with this abnormality is particularly suited to trypanosome infection. Ann. Trop. Med. Parasitol. 39, 11–13. Coler, R.R., Boucias, D.G., Frank, J.H., Maruniak, J.E., Garcia-Canedo, A., Pendland, J.C., 1993. Characterization and description of a virus causing salivary gland hyperplasia in the housefly, Musca domestica. Med. Vet. Entomol. 7, 275–282. Faulkner, P., Kuzio, J., Williams, G.V., Wilson, J.A., 1997. Analysis of p74, a PDV envelope protein of Autographa californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. J. Gen. Virol. 78, 3091–3100. Garcia-Maruniak, A., Abd-Alla, A.M.M., Salem, T.Z., Parker, A.G., van Oers, M.M., Maruniak, J.E., Kim, W., Burand, J.P., Cousserans, F., Robinson, A.S., Vlak, J.M., Bergoin, M., Boucias, D.G., 2009. Two viruses that cause salivary gland hypertrophy in Glossina pallidipes and Musca domestica are related and form a distinct phylogenetic clade. J. Gen. Virol. 90, 334–346. Garcia-Maruniak, A., Maruniak, J.E., Farmerie, W., Boucias, D.G., 2008. Sequence analysis of a non-classified, non-occluded DNA virus that causes salivary gland hypertrophy of Musca domestica, MdSGHV. Virology 377, 184–196. Geden, C.J., Lietze, V.U., Boucias, D.G., 2008. Seasonal prevalence and transmission of salivary gland hypertrophy virus of house flies (Diptera: Muscidae). J. Med. Entomol. 45, 42–51. Jaenson, T.G.T., 1978. Virus-like rods associated with salivary gland hyperplasia in tsetse, Glossina pallidipes. Trans. R. Soc. Trop. Med. Hyg. 72, 234–238. Jaenson, T.G.T., 1986. Sex ratio distortion and reduced lifespan of Glossina pallidipes infected with the virus causing salivary gland hyperplasia. Entomol. Exp. Appl. 41, 256–271. Kariithi, H.M., Ince, A.I., Boerren, S., Vervoort, J., Bergoin, M., van Oers, M.M., AbdAlla, A., Vlak, J.M., 2010. Proteomic analysis of Glossina pallidipes salivary gland hypertrophy virus virions for immune intervention in tsetse fly colonies. J. Gen. Virol. (in press). Kikhno, I., Gutierrez, S., Croizier, L., Croizier, G., Ferber, M.L., 2002. Characterization of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. J. Gen. Virol. 83, 3013–3022. Kuzio, J., Jaques, R., Faulkner, P., 1989. Identification of p74, a gene essential for virulence of baculovirus occlusion bodies. Virology 173, 759–763. Lietze, V.U., Abd-Alla, A.M., Vreysen, M.J., Geden, C.J., Boucias, D.G., 2011. Salivary gland hypertrophy viruses: A novel group of insect pathogenic viruses. Ann. Rev. Entomol. (in press). Lietze, V.U., Geden, C.J., Blackburn, P., Boucias, D.G., 2007. Effects of salivary gland hypertrophy virus on the reproductive behavior of the housefly, Musca domestica. Appl. Environ. Microbiol. 73, 6811–6818. Lyon, J.P., 1973. La mouche des Narcisses (Merodon equestris F., Diptere Syrphidae). I. Identification de l’insecte et de ses degats et biologie dans le sud-est de la France. Rev. Zool. Agric. Pathol. Veg. 72, 65–92. Prompiboon, P., Lietze, V.-U., Denton, J.S.S., Geden, C.J., Steenberg, T., Boucias, D.G., 2010. The Musca domestica salivary gland hypertrophy virus: an insect virus that globally infects and sterilizes female house flies. Appl. Environ. Microbiol. 76, 994–998. Sang, R.C., Jura, W.G.Z.O., Otieno, L.H., Tukei, P.M., Mwangi, R.W., 1997. Effects of tsetse DNA virus infection on the survival of a host fly Glossina morsitans centralis (Diptera: Glossinidae). J. Invertebr. Pathol. 69, 253–260. Slack, J.M., Dougherty, E.M., Lawrence, S.D., 2001. A study of the Autographa californica multiple nucleopolyhedrovirus ODV envelope protein p74 using a GFP tag. J. Gen. Virol. 82, 2279–2287. Whitnall, A.B.M., 1934. The trypanosome infections of Glossina pallidipes in the Umfolosi Game Reserve, Zululand. Onderstepoort. J. Vet. Sci. Anim. Ind. 2, 7–21.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Universal primers for rapid detection of hytrosaviruses Adly M.M. Abd-Alla a,∗ , Tamer Z. Salem c,d , Andrew G. Parker a , Yongjie Wang b,1 , Johannes A. Jehle b , Marc J.B. Vreysen a , Drion Boucias c a
Insect Pest Control Laboratory, Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture, Vienna, Austria Agricultural Service Center Palatinate, Breitenweg 71, 67435 Neustadt/Wstr, Germany c Entomology and Nematology Department, PO Box 110620, University of Florida, Gainesville, FL 32611-0620, USA d Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, 9 Gamaa Street, Giza 12619, Egypt b
a b s t r a c t Article history: Received 6 July 2010 Received in revised form 23 September 2010 Accepted 27 September 2010 Available online 12 October 2010 Keywords: Diptera Glossina Musca domestica Merodon equestris Glossinidae Salivary gland hypertrophy virus Muscidae Syrphidae
Hytrosaviridae is a proposed virus family encompassing viruses that cause salivary gland hypertrophy (SGH) syndrome in infected insects and reduce the fertility in their dipteran insect hosts. They contain a large, double stranded DNA genome of 120–190 kbp. To date, these viruses have been detected only in adult Diptera. These include hytrosaviruses detected in various tsetse fly species (Glossina spp.), the narcissus bulb fly Merodon equestris and the house fly Musca domestica. The limited number of hytrosaviruses reported to date may be a reflection of the frequent absence of external symptoms in infected adult flies and the fact that the virus does not cause rapid mortality. Based on the complete genome sequence of Glossinia pallidipes (GpSGHV) and Musca domestica (MdSGHV) salivary gland hypertrophy viruses, a PCR based methodology was developed to detect the viruses in these species. To be able to detect hytrosaviruses in other Diptera, five degenerate primer pairs were designed and tested on GpSGHV and MdSGHV DNA using gradient PCR with annealing temperatures from 37 to 61 ◦ C. Two pairs of primers were selected from p74, two pairs from PIF-1 and one pair from ODV-e66 homologous proteins. Four primer pairs generated a virus specific PCR product on both MdSGHV and GpSGHV at all tested annealing temperatures, while the ODV-e66 based primers did not generate a virus specific product with annealing temperatures higher that 47 ◦ C. No non-specific PCR product was found when using genomic DNA of infected flies as template DNA. These results offer new sets of primers that could be used to detect hytrosaviruses in other insects. © 2010 Elsevier B.V. All rights reserved.
The hytrosaviruses constitute a unique group of entomopathogenic viruses for which a new family has recently been proposed to the International Committee on Taxonomy of Viruses (ICTV) (Abd-Alla et al., 2009; Lietze et al., in press). These viruses possess a large (approximately 120–190 kbp), circular, doublestranded DNA genome that is packaged in long, enveloped, rod-shaped virions. The salient feature of hytrosavirus infection is the hypertrophy of adult salivary glands, that can increase four-fold in diameter compared to uninfected salivary glands. This syndrome is therefore designated as “salivary gland hypertrophy” (SGH) (Burtt, 1945). The SGH syndrome was first described in wild populations of the tsetse fly Glossina pallidipes (Diptera: Glossinidae)
∗ Corresponding author at: Insect Pest Control Laboratory, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Wagramer Straße 5, A-1400 Vienna, Austria. Tel.: +43 1 2600 28425; fax: +43 1 2600 28447. E-mail addresses: [email protected] (A.M.M. Abd-Alla), [email protected] (Y. Wang). 1 Present address: Laboratory for Marine Virology, College of Food Science and Technology, Shanghai Ocean University, Shanghai, China. 0166-0934/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2010.09.025
(Burtt, 1945; Whitnall, 1934), but later detected in many tsetse species and in different African regions (see references in AbdAlla et al., 2009). Jaenson (1978) identified a nuclear rod-shaped enveloped DNA virus averaging 70 nm × 640 nm in size as the causative agent of SGH. The SGH syndrome was also described in populations of adult narcissus bulb fly, Merodon equestris (Diptera: Syrphidae) (Amargier et al., 1979; Lyon, 1973). It was speculated that long, rod-shaped virus particles isolated from the hypertrophied salivary glands were causing gland hypertrophy (Amargier et al., 1979). Finally, SGH symptoms were also described in adult house flies, Musca domestica (Diptera: Muscidae) (Coler et al., 1993). Although the number of described hytrosaviruses is limited, these viruses are currently considered very important in view of (i) the negative impact caused by these viruses on the mass-rearing of tsetse flies for use in an area-wide integrated pest management programme with a sterile insect technique (SIT) component and (ii) the potential use of these viruses as a biocontrol agent for house fly pest populations. Prior studies demonstrated that hytrosavirus infections reduced the fertility of females, reduced mating efficiency of infected males and shortened their life span (Jaenson, 1986; Lietze et al., 2007; Sang et al., 1997).
A.M.M. Abd-Alla et al. / Journal of Virological Methods 171 (2011) 280–283
281
Table 1 Degenerate and specific oligonucleotide primers for hytrosaviruses. Target gene
Degenerate p74
PIF-1
ODV-e66 Specific GpSGHV MdSGHV
Primer name
Primer sequence (5 -3 )
Target position in GpSGHV gene
p74-1F p74-1R p74-2F p74-2R pif1-1F pif1-1R pif1-2F pif1-2R odv-e66-R odv-e66-F
TATMGWCCSGAGATWATGTCRCAC MACRTTYGGATCRATAAARAAMGC TGTCARATWAATTATCCMCGYGGTAA AARTCATCGCAATARTAYTTRTT GGSAARTAYGCGAATGCMATG WCCAGGMGGWGTYGGATA AACGAYGAYTATYTRATWGGTAA GGTATRGTRCCRTTGTAGACWCG GCAATWATWWTTATMGCRAT WGGATAWGTTATWGARAA
94–117 826–849 232–257 583–605 1027–1047 1480–1497 999–1021 1380–1402 67–86 517–534
ORF05F ORF05R ORF106F ORF106R
GCATTCACAGCATCCCAATTTT CTTGTCAGCGCCACGTACAT CGGCAGCAACCTTATTCATT CGTCGTCTCCTCCTCTTCAG
121–142 502–521 – –
PCR product size (bp) from GpSGHV
Target position in MdSGHV gene 103–126 898–921 238–263 655–677 983–1003 1457–1475 956–978 1373–1395 65–84 506–523
708 373 432 403 430
– – 71–90 659–678
400
PCR product size (bp) from MdSGHV
Degeneracy*
458
32 32 16 16 16 16 32 16 32 16
608
0 0 0 0
818 439 519 439
M = A or C; R = A or G; S = C or G; W = A or T; Y = C or T. * Number of primer permutations (2n , where n is the number of variable bases in the primer).
A high incidence of SGH in a tsetse colony makes it difficult to maintain this colony, let alone expand it for mass-rearing purposes. Moreover, the consequences of releasing sterile males with SGH might be detrimental for the efficacy of the SIT. Therefore, novel strategies are required to manage the virus in G. pallidipes colonies. After completing the GpSGHV genome sequence, various strategies were proposed to manage the virus infection in tsetse colonies such as the neutralization of virus infection by virus-specific antibodies and targeting the DNA replication by silencing virus specific genes by RNAi. To maximize the benefit of these strategies, common regions in the genome of multiple strains of the virus will be selected by screening for strains in tsetse flies of different species collected from various locations. Using GpSGHV specific primers was inefficient as negative samples indicate only the absence of one specific virus strain (Abd-Alla et al., 2010; Kariithi et al., in press). The ability of hytrosavirus to sterilize the house fly, Musca domestica, makes the MdSGHV a potential biocontrol agent for house fly. The global distribution of the house fly prompted a study of the distribution of MdSGHV to explore the genetic diversity of this virus and to find in each geographical region local isolates that could be used for biocontrol. As with GpSGHV, the use of MdSGHV specific primers for screening will be unsuitable to detect new
P74
(94-117)
1F 2F
(232-257)
(583-605)
373 bp
2R
(826-849)
1R
708 bp (136140-136162)
PIF-1
(94-117)
1F ODV-e66
homologous viruses replicating in other dipterans (Geden et al., 2008; Prompiboon et al., 2010). Degenerate primers were therefore designed in an attempt to identify the presence of other species and strains of hytrosavirus. Five degenerate primer pairs were designed based on the sequence of GpSGHV (NC 010356.1) and MdSGHV (NC 010671) by selecting and comparing conserved amino acid sequences or similar nucleotide sequences. It should be noted that, although the GpSGHV and MdSGHV are presently grouped together, collinearity analysis showed much disparity in genetic content (Abd-Alla et al., 2008; Garcia-Maruniak et al., 2009). From the homologous regions, five degenerate primer pairs were synthesized (Eurofins MWG Operon, Ebersberg Germany, Table 1). These included two primer pairs from putative p74, two pairs from putative PIF-1 and one pair from putative ODV-e66 protein coding sequences (Fig. 1). The DNA of GpSGHV and MdSGHV was extracted from purified virus as previously described (Abd-Alla et al., 2007; Garcia-Maruniak et al., 2008) and used as DNA template for PCR reactions. Gradient PCR reactions were carried out with Taq DNA polymerase according to the manufacturer’s instructions (Thermo) with a final primer concentration of 0.2 M. PCR cycling conditions were 94 ◦ C for 45 s, 37–61 ◦ C for 45 s, and 72 ◦ C for 1 min for 35 cycles, with an initial template denaturation step at 94 ◦ C for 5 min. To optimize the PCR,
2F 1F (136168-136187)
(136521-136543)
432 bp
2R
1R (136620-136637) 403 bp
(4906-4923)
1R
(5354-5373)
430bp Fig. 1. Schematic representation of degenerate primer positions, PCR product length estimated for GpSGHV genes.
282
A.M.M. Abd-Alla et al. / Journal of Virological Methods 171 (2011) 280–283
Fig. 2. Optimization of annealing temperature for degenerate primers in PCR reaction using (A) the viral DNA as template, (B) the genomic DNA of infected tsetse flies and genomic DNA of house fly contaminated with GpSGHV and MdSGHV DNA respectively as template.
several annealing temperatures of the primers were tested using a plasmid containing the selected viral DNA sequence as template. PCR products were analyzed on 1% agarose gels. The results indicate that all degenerate primers were able to detect the viral DNA of both GpSGHV and MdSGHV using PCR with a wide range of annealing temperature from 37 to 61 ◦ C and give one specific PCR product (Fig. 2A). With the exception of the ODV-e66 primer pair, all primer pairs amplified the expected length of their respective PCR product over the complete range of annealing temperatures as predicted from the genome sequence of each virus (see Table 1). The ODV-e66 primer pair seems to have a lower annealing temperature and no PCR product was detected when the annealing temperature was higher than 47 ◦ C (Fig. 2A).
To assess the specificity of the degenerate primers, the genomic DNA of infected and uninfected (determined by PCR with GpSGHV specific primers) tsetse flies was extracted as previously described (Abd-Alla et al., 2007) and used as DNA template for PCR reaction. Due to the absence of infected house flies, the healthy house fly DNA was extracted and spiked with extracted MdSGHV DNA, the mixed and non-mixed DNA being used as template for the PCR reaction (Fig. 2B). The results showed similar PCR products to those found with the PCR reaction carried out using the extracted viral DNA and no non-specific PCR products were found. With the exception of the pif1-1 primer set, no PCR product was observed with any other degenerate primer at any annealing temperature using healthy house fly DNA. Slight PCR amplification was found with pif1-1 pairs with annealing temperatures ranging from 39.1 to
A.M.M. Abd-Alla et al. / Journal of Virological Methods 171 (2011) 280–283
54.9 ◦ C. With uninfected tsetse flies, several non-specific PCR products were observed at annealing temperatures lower than 47 ◦ C with the primer pairs of p74-1, pif1-1 and pif1-2, while with the p74-2 primer set a unique PCR band, with the similar size as the band found with the viral DNA, was observed at all tested annealing temperatures. No non-specific band was observed with the odv-e66 primer pair. The presence of a non-specific product with uninfected tsetse flies indicates that the primers match with tsetse genomic DNA or with DNA from another viral strain that is not amplified by the standard GpSGHV primers used to select uninfected flies. Analysing the nature of the non-specific PCR product will be the subject of further studies. To avoid the non-specific PCR products with tsetse flies an annealing temperature of 58 ◦ C for p74-1, pif1-1, and pif1-2 and 45 ◦ C for odv-e66 is recommended. For p74-2, 60 ◦ C is recommended as the annealing temperature combined with sequencing the PCR product. Although non-specific PCR products were observed with the uninfected house flies and tsetse flies, only one dominant PCR product was observed with infected flies. These results indicate the high specificity of the primer for the hytrosavirus genomes. These results were expected as p74, pif-1 and odv-e66 are insect virus-specific genes which play an important role in oral infection by these viruses and are not expected to be found in the insect genome (Faulkner et al., 1997; Kikhno et al., 2002; Kuzio et al., 1989; Slack et al., 2001). The result presented in this note offer for the first time the sequence of several degenerate primer sets with the optimal conditions to detect hytrosavirus in tsetse flies and house flies. Due to the importance of the p74, pif-1 and odv-e66 genes for hytrosavirus and other insect viruses it is expected that these genes will be conserved in these viruses. The presence of these genes enables the degenerate primers to detect hytrosaviruses carrying these genes not only in tsetse and house flies, but in all Diptera and probably in other insect orders. The availability of these primers will facilitate detection of hytrosavirus in a wide range of insects and is expected to result in the discovery of other hytroviruses in other insects. It is worth noting that many tsetse flies carry asymptomatic infection with GpSGHV and even dissections cannot detect symptoms. In such cases the degenerate primers will greatly assist in the detection of different virus strains even if in these asymptomatic flies. Acknowledgments We thank Abdul Hasim Mohamed, and Carmen Marin for their help with DNA extraction and tsetse fly rearing respectively. References Abd-Alla, A., Bossin, H., Cousserans, F., Parker, A., Bergoin, M., Robinson, A., 2007. Development of a non-destructive PCR method for detection of the salivary gland hypertrophy virus (SGHV) in tsetse flies. J. Virol. Methods 139, 143–149. Abd-Alla, A.M.M., Kariithi, H., Parker, A.G., Robinson, A.S., Kiflom, M., Bergoin, M., Vreysen, M.J.B., 2010. Dynamics of the salivary gland hypertrophy virus in lab-
283
oratory colonies of Glossina pallidipes (Diptera: Glossinidae). Virus Res. 150, 103–110. Abd-Alla, A.M.M., Cousserans, F., Parker, A.G., Jehle, J.A., Parker, N.J., Vlak, J.M., Robinson, A.S., Bergoin, M., 2008. Genome analysis of a Glossina pallidipes salivary gland hypertrophy virus (GpSGHV) reveals a novel large double-stranded circular DNA virus. J. Virol. 82, 4595–4611. Abd-Alla, A.M.M., Vlak, J.M., Bergoin, M., Maruniak, J.E., Parker, A.G., Burand, J.P., Jehle, J.A., Boucias, D.G., 2009. Hytrosaviridae: a proposal for classification and nomenclature of a new insect virus family. Arch. Virol. 154, 909–918. Amargier, A., Lyon, J.P., Vago, C., Meynadier, G., Veyrunes, J.C., 1979. Mise en evidence et purification d’un virus dans la proliferation monstrueuse glandulaire d’insectes. Etude sur Merodon equestris F. (Diptere, Syrphidae). C. R. Acad. Sci. D 289, 481–484. Burtt, E., 1945. Hypertrophied salivary glands in Glossina: evidence that G. pallidipes with this abnormality is particularly suited to trypanosome infection. Ann. Trop. Med. Parasitol. 39, 11–13. Coler, R.R., Boucias, D.G., Frank, J.H., Maruniak, J.E., Garcia-Canedo, A., Pendland, J.C., 1993. Characterization and description of a virus causing salivary gland hyperplasia in the housefly, Musca domestica. Med. Vet. Entomol. 7, 275–282. Faulkner, P., Kuzio, J., Williams, G.V., Wilson, J.A., 1997. Analysis of p74, a PDV envelope protein of Autographa californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. J. Gen. Virol. 78, 3091–3100. Garcia-Maruniak, A., Abd-Alla, A.M.M., Salem, T.Z., Parker, A.G., van Oers, M.M., Maruniak, J.E., Kim, W., Burand, J.P., Cousserans, F., Robinson, A.S., Vlak, J.M., Bergoin, M., Boucias, D.G., 2009. Two viruses that cause salivary gland hypertrophy in Glossina pallidipes and Musca domestica are related and form a distinct phylogenetic clade. J. Gen. Virol. 90, 334–346. Garcia-Maruniak, A., Maruniak, J.E., Farmerie, W., Boucias, D.G., 2008. Sequence analysis of a non-classified, non-occluded DNA virus that causes salivary gland hypertrophy of Musca domestica, MdSGHV. Virology 377, 184–196. Geden, C.J., Lietze, V.U., Boucias, D.G., 2008. Seasonal prevalence and transmission of salivary gland hypertrophy virus of house flies (Diptera: Muscidae). J. Med. Entomol. 45, 42–51. Jaenson, T.G.T., 1978. Virus-like rods associated with salivary gland hyperplasia in tsetse, Glossina pallidipes. Trans. R. Soc. Trop. Med. Hyg. 72, 234–238. Jaenson, T.G.T., 1986. Sex ratio distortion and reduced lifespan of Glossina pallidipes infected with the virus causing salivary gland hyperplasia. Entomol. Exp. Appl. 41, 256–271. Kariithi, H.M., Ince, A.I., Boerren, S., Vervoort, J., Bergoin, M., van Oers, M.M., AbdAlla, A., Vlak, J.M., 2010. Proteomic analysis of Glossina pallidipes salivary gland hypertrophy virus virions for immune intervention in tsetse fly colonies. J. Gen. Virol. (in press). Kikhno, I., Gutierrez, S., Croizier, L., Croizier, G., Ferber, M.L., 2002. Characterization of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. J. Gen. Virol. 83, 3013–3022. Kuzio, J., Jaques, R., Faulkner, P., 1989. Identification of p74, a gene essential for virulence of baculovirus occlusion bodies. Virology 173, 759–763. Lietze, V.U., Abd-Alla, A.M., Vreysen, M.J., Geden, C.J., Boucias, D.G., 2011. Salivary gland hypertrophy viruses: A novel group of insect pathogenic viruses. Ann. Rev. Entomol. (in press). Lietze, V.U., Geden, C.J., Blackburn, P., Boucias, D.G., 2007. Effects of salivary gland hypertrophy virus on the reproductive behavior of the housefly, Musca domestica. Appl. Environ. Microbiol. 73, 6811–6818. Lyon, J.P., 1973. La mouche des Narcisses (Merodon equestris F., Diptere Syrphidae). I. Identification de l’insecte et de ses degats et biologie dans le sud-est de la France. Rev. Zool. Agric. Pathol. Veg. 72, 65–92. Prompiboon, P., Lietze, V.-U., Denton, J.S.S., Geden, C.J., Steenberg, T., Boucias, D.G., 2010. The Musca domestica salivary gland hypertrophy virus: an insect virus that globally infects and sterilizes female house flies. Appl. Environ. Microbiol. 76, 994–998. Sang, R.C., Jura, W.G.Z.O., Otieno, L.H., Tukei, P.M., Mwangi, R.W., 1997. Effects of tsetse DNA virus infection on the survival of a host fly Glossina morsitans centralis (Diptera: Glossinidae). J. Invertebr. Pathol. 69, 253–260. Slack, J.M., Dougherty, E.M., Lawrence, S.D., 2001. A study of the Autographa californica multiple nucleopolyhedrovirus ODV envelope protein p74 using a GFP tag. J. Gen. Virol. 82, 2279–2287. Whitnall, A.B.M., 1934. The trypanosome infections of Glossina pallidipes in the Umfolosi Game Reserve, Zululand. Onderstepoort. J. Vet. Sci. Anim. Ind. 2, 7–21.