Urotensin II, urotensin-related peptide, and their receptor in aortic valve stenosis

Khan et al

Basic Science

Urotensin II, urotensin-related peptide, and their receptor in aortic valve stenosis Kashif Khan, BSc,a Isabella Albanese, MD, MSc, BSc,a Bin Yu, PhD,a Yousif Shalal,a Hamood Al-Kindi, MD, FRCSC,a Hossney Alaws, BSc,a Jean-Claude Tardif, MD,b Ophelie Gourgas, MSc, BSc,c Marta Cerutti, PhD,c and Adel Schwertani, DM, PhDa ABSTRACT Objectives: Aortic valve stenosis (AVS) is the most common cause of surgical valve replacement worldwide. The vasoactive peptide urotensin II (UII) is upregulated in atherosclerosis and several other cardiovascular diseases; however, its role in the pathogenesis of AVS remains to be determined. Here, we investigated the expression of UII, urotensin-related peptide (URP), and the urotensin receptor (UT) and the role this system plays in AVS.

Results: The mRNA expression of UII, URP, and UT was significantly greater in patients with AVS. There was abundant presence of UII, URP, and UT immunostaining in diseased compared with nondiseased valves and correlated significantly with presence of calcification (P < .0001) and fibrosis (P < .0001). Treating human aortic valve interstitial cells with UII or URP significantly increased cell proliferation (P < .0001) and decreased cholesterol efflux (P ¼ .0011 and P ¼ .0002, respectively). UII also significantly reduced ABCA1 protein expression (P ¼ .0457) and increased b-catenin nuclear translocation (P <.0001) and mineral deposition (P <.0001). Conclusions: Together, these data suggest that the urotensin system plays a role in the pathogenesis of AVS and warrants further investigation. (J Thorac Cardiovasc Surg 2019;-:1-13)

Immunostaining of UII (brown) in calcified regions of stenotic aortic valves. Central Message This study supports the identification of the urotensin system as a key player in the pathogenesis of AVS, using human valve tissues and cells derived from these tissues.

BS

Methods: Immunohistochemistry and reverse-transcriptase polymerase chain reaction were used to examine the cellular localization and mRNA expression, of UII, URP, and UT in calcified and noncalcified aortic valves. Human aortic valve interstitial cells were isolated from normal valves and treated with UII or URP, and changes in cell proliferation, cholesterol efflux, calcium deposition, and b-catenin translocation were assessed.

Perspective There are currently no medical therapies available for patients with AVS. We found that UII, URP, and UT were associated with calcification and fibrosis in diseased valves. Human aortic valve interstitial cells treated with UII or URP decreased cholesterol efflux and promoted calcification. These data suggest that the urotensin system may be a novel therapeutic target to treat patients with AVS.

See Commentary on page XXX.

From the aCardiology and Cardiac Surgery, McGill University Health Center; bMontreal Heart Institute; and cDepartment of Materials Engineering, McGill University, Montreal, Quebec, Canada. This work was supported by the Canadian Institute of Health Research and Natural Sciences and Engineering Research Council (RGPIN-2017-05328). Kashif Khan and Isabella Albanese contributed equally to this article. Received for publication May 29, 2019; revisions received Sept 8, 2019; accepted for publication Sept 9, 2019. Address for reprints: Adel Schwertani, DM, PhD, McGill University Health Centre, Glen EM12224, 1001 Boulevard Decarie, Montreal, H4A 3J1, Quebec, Canada (E-mail: [email protected]). 0022-5223/$36.00 Copyright Ó 2019 by The American Association for Thoracic Surgery https://doi.org/10.1016/j.jtcvs.2019.09.029

Aortic valve stenosis (AVS) is the most common heart valve pathology in North America and is the single most common indicator for surgical valve replacement.1,2 In patients older than the age of 65 years, atherosclerotic plaque formation and the associated risk factors are the primary causes of

Scanning this QR code will take you to the article title page to access supplementary information.

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

1

Basic Science

Abbreviations and Acronyms ARS ¼ Alizarin Red Sirius AVS ¼ aortic valve stenosis HA ¼ hydroxyapatite HAVIC ¼ human aortic valve interstitial cell MGP ¼ matrix Gla-protein Pmax ¼ the maximum pressure across the valve Pmean ¼ the mean pressure across the valve UII ¼ urotensin II URP ¼ urotensin-related peptide UT ¼ urotensin receptor

BS

AVS.3,4 The process of valve stenosis is mediated by a series of biological processes triggered by endothelial cell injury leading to lipid infiltration, inflammation, fibrosis, and calcification.5-9 AVS is associated with serious morbidity and mortality worldwide; therefore, identifying a marker or a mediator of the disease process is of significant interest. Urotensin II (UII), urotensin-related peptide (URP), and the urotensin receptor (UT) (together known as the UII system) are a family of vasoactive mediators with a significant role in cardiovascular diseases such as atherosclerosis and heart failure.10-13 UII and UT are expressed in the heart and vasculature system.14 For example, UII is expressed in human vascular smooth muscle cells,12 endothelial cells,15,16 and rat cardiac fibroblasts.17 UT expression is localized to the heart atria and ventricles, endothelial cells across the vasculature, and arterial but not venous smooth muscle cells.10,18 We had previously reported elevated levels of UII mRNA and protein in atherosclerotic coronary arteries compared with normal coronary arteries, with the strongest UII expression in endothelial cells underlined by inflammatory or fibrofatty lesions.19 Others have also reported that UII expression is evident in areas of macrophage infiltration in atherosclerotic coronary arteries and is elevated in the plasma of patients with atherosclerosis.20,21 Besides its well-established vasoactive properties,13 UII alone, and synergistically with oxidized low-density lipoprotein and serotonin, enhanced vascular smooth muscle cell proliferation.22,23 UII has also been shown to increase collagen production, and vascular and cardiac remodeling.13 A previous study had reported elevated levels of UII in the plasma of patients with rheumatic valve disease and showed that UII levels were directly associated with the severity of regurgitation, New York Heart Association functional class, and increased pulmonary artery pressure.24 To date, there is no information on the tissue expression or the role of the UII system in AVS. Here, we hypothesized that UII, URP, and UT receptor expression are upregulated in stenotic human aortic valves and that the UII system plays a role in the pathogenesis of AVS. We therefore examined 2

Khan et al

the cellular localization of UII, URP, and UT proteins in normal and diseased human aortic valves by immunohistochemistry. We also examined the relative mRNA expression of UII, URP, and UT in fibrotic (early disease) compared with advanced (calcified) aortic valves, and assessed UT receptor protein expression by Western blotting in diseased human aortic valves. Finally, we isolated human aortic valve interstitial cells (HAVICs) from normal human aortic valves, exposed them to UII or URP, and examined changes in cellular proliferation, cholesterol efflux, b-catenin nuclear translocation, mineralization, and the expression of markers of cellular remodeling and lipid metabolism. MATERIALS AND METHODS Tissue Collection Archived human aortic valve tissue blocks (fixed in formalin and embedded in paraffin) were obtained in accordance with the McGill University Health Centre guidelines. These valves were originally obtained from aortic valve replacement surgeries between 2009 and 2012 at the McGill University Health Centre. A total of 61 tissue blocks (36 calcified and 25 normal aortic valve leaflets from patients with AVS) were collected for examination along with detailed clinical history (Table 1) and used for the histology studies entirely. Normal valves are defined as having no significant calcification and an aortic valve area of>1.5 cm2.25 List of medications, lipid profile, the velocity of the regurgitant jet through the aortic valve in cm/s (jet), the maximum pressure across the valve (Pmax), the mean pressure across the valve (Pmean) were all noted. An additional 5 normal human aortic valves (from unused donor hearts; mean age 53  19 years; 3 male) and calcified aortic valves (n ¼ 31) were also collected freshly at surgery from unused donor hearts (normal) or valve replacement (diseased) and used for the reverse transcriptase polymerase chain reaction and Western blot studies (Table 2). Five normal valves were collected from unused donor hearts (mean age 53  19; 3 male). Small segments of 100 to 200 mg of the valves were snap frozen in liquid nitrogen and stored at –80 C, whereas the remaining segments from the same valves were stored directly in RNAlater RNA stabilization reagent (QIAGEN, Hilden, Germany) at 4 C for subsequent protein and RNA analyses, respectively. Freshly obtained normal valves were also used to generate HAVIC lines. The study was approved by the McGill University Health Centre ethics committee, and proper written consents were obtained from all participating patients.

Isolation and Culture of HAVICs Primary HAVICs were generated from healthy subjects as previously described.26,27 Cultured HAVICs showed positive staining for a-smooth muscle actin, indicating myofibroblast phenotype after 2 passages. HAVICs at passages 3 to 5 were used for all experiments in triplicates or quadruplicates.

Immunohistochemistry The paraffin-embedded tissue blocks were cut into 4-mm sections using a microtome. Six sections (first one of each 5 continued sections) were examined per lesion (for each antiserum) at ~20-mm intervals, and a total of 6 images were analyzed per section for histological scoring. Primary antibody used was rabbit anti-URP (H-071-17 at 1/50; Phoenix Pharmaceuticals, Inc, Burlingame, Calif); this antibody has no cross reaction with UII, and antiserum against UII and UT both has been described previously.27 Additional sections were stained for a-smooth muscle actin (CLT9000 at 1/500; Cedarlane Laboratories, Burlington, Canada) and rabbit anti-CD68 (HPA048982 at 1/1000; Sigma-Aldrich, St Louis, Mo).

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al

Basic Science

TABLE 1. Clinical history of patients included in histology studies Clinical parameter

Control (N ¼ 25), mean ± SD

AVS (N ¼ 36), mean ± SD

Significance

Age, y

59.8  13.1

66.7  11.7

NS

Female, n

10 (40.0%)

9 (26.0%)

NS

HbA1c, %

5.65  1.01

6.22  1.41

NS

Total cholesterol, mmol/L

3.88  1.55

3.78  0.97

NS

LDL, mmol/L

2.19  1.17

2.01  0.82

NS

HDL, mmol/L

0.98  0.38

0.99  0.19

NS

Triglycerides, mmol/L

1.52  0.64

2.17  2.63

NS

Aortic valve area, cm2

2.13  0.81

0.72  0.15

P <.0001

190.3  93.9

439.11  44.1

P <.0001

17.8  20.1

77.8  15.5

P <.0001

Pmean, mm Hg

9.91  13.1

43.70  16.4

P <.0001

Ejection fraction, %

61.5  6.25

55.0  13.3

NS

Jet velocity, cm/s Pmax, mm Hg

SD, Standard deviation; AVS, aortic valve stenosis; NS, not significant; HbA1c, glycated hemoglobin; LDL, low-density lipoprotein; HDL, high-density lipoprotein; Pmax, max pressure across the aortic valve; Pmean, mean pressure across the aortic valve.

TABLE 2. Clinical history of patients included in reverse transcriptase polymerase chain reaction and Western blotting studies Clinical parameter Age, y Female, n

Mean ± SD (N ¼ 31) 72.1  13.09 8 (40%)

HbA1c, %

6.5  0.01

Total cholesterol, mmol/L

3.8  0.69

LDL, mmol/L

1.9  0.57

HDL, mmol/L

1.0  0.07

Triglycerides, mmol/L

1.4  0.59

Aortic valve area, cm2

1.2  0.66

Jet velocity, cm/s

330.7  156.08

Pmax, mm Hg

52.6  40.6

Pmean, mm Hg

28.1  25.66

Ejection fraction, %

61.8  7.83

SD, Standard deviation; HbA1c, glycated hemoglobin; LDL, low-density lipoprotein; HDL, high-density lipoprotein; Pmax, max pressure across the aortic valve; Pmean, mean pressure across the aortic valve.

Real-Time Quantitative Polymerase Chain Reaction Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, Calif) combined with RNeasy Mini Kit (QIAGEN) from frozen human aortic valve tissue. First-strand cDNAs were synthesized using SuperScript III First-Strand Synthesis System (Invitrogen) using 1 mg of total RNA. Gene-specific primers were obtained from Invitrogen and described in Table E1. Quantitative real-Time PCRs were performed with QuantiFast SYBR Green PCR kit (QIAGEN) on LightCycler 1.5 (Roche Diagnostics, Basel, Switzerland). The relative mRNA expressions of genes were calculated using standard curves generated from housekeeping gene GAPDH, and then normalized to GAPDH expression and compared between calcified and noncalcified aortic valves. Effects of UII and URP on the mRNA expression of mediators of remodeling and lipid uptake and release in HAVICs were also assessed by qPCR.

Western Blot Small segments of 100 to 200 mg of freshly collected heart valves were snap frozen in liquid nitrogen for subsequent protein extraction. The frozen human aortic valve tissues were homogenized on ice in a protein lysis buffer containing 300 mM Tris-HCl (pH ¼ 8), Triton-X-100 (1%), NaCl (150 mM), Na3VO3 (1 mM), NaF (1 mM), iodoacetamide (1 mM), deoxycholic acid Na þ salt (0.1%), and protease inhibitors cocktail. Samples were then centrifuged at 20,000g at 4 C for 10 minutes, and supernatants were collected. Total proteins were also extracted using RIPA buffer from previously generated HAVICs28 and used for UT Western blot detection. Equal amounts of protein were mixed with Laemmli Sample Buffer and boiled at 100 C for 5 minutes before being loaded on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel. The protein was then transferred onto a nitrocellulose membrane at 100V for 1 hour at 4 C. The membrane was blotted with rabbit anti-UT antibody (anti-human GPR14, sc-28998; Santa Cruz Biotechnology, Santa Cruz, Calif), followed by bovine anti-rabbit IgG-HRP (sc-2370 at 1/5000; Santa Cruz Biotechnology). Lumi-Light Western Blotting Substrate (Roche) was used to visualize the immunoreaction according to the manufacturer’s instructions.

Cell Proliferation HAVICs were treated with 50 nM, 100 nM, and 200 nM of UII or URP for 48 hours. Cell proliferation was determined using MTT protocol (Thiazolyl Blue Tetrazolium Blue; Sigma-Aldrich) according to the

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

3

BS

Sections were incubated with the primary antibodies at 4 C overnight, followed by incubation with the corresponding biotinylated secondary antibodies (goat against rabbit or mouse IgG at 1/200; Vector Labs, Burlingame, Calif) and ABC complex (Vectastain ABC Elite Kit; Vector Labs) according to the manufacturer instructions. The immunoreaction was then developed in diaminobenzidine and H2O2 solution. Sections were subsequently counterstained with hematoxylin. Negative control experiments included the use of a nonimmune serum in place of the primary antisera and immunoabsorption of the primary antisera with their respective antigens. Calcium and collagen detection analyses were also performed using Alizarin Red Sirius (ARS) staining, respectively. Cardiac valves were also assessed for overall level of calcification, fibrosis, inflammation, and lipid deposition, as previously described.28 Aortic valves were semiquantitatively scored for overall immunostaining (intensity and distribution) in segments of fibrosis, calcified foci, and surrounding extracellular matrix, as previously described.28

Basic Science

Cholesterol Efflux HAVICs were treated with 200 nM UII or URP peptides for 48 hours in serum-free DMEM medium. Treated cells were loaded with 25 mM TopFluor Cholesterol (Avanti Polar Lipids, Alabaster, Ala) for overnight. Cholesterol efflux was assayed using 10 mg/mL APOA1 after 6 hours. Cholesterol efflux was also assayed in M2 macrophages treated with 200 nM UII or URP peptides for 48 hours in serum-free DMEM medium. M2 macrophages were generated through treatment of THP1 cells (ATCC) with 100 nM phorbol myristate acetate (Sigma-Aldrich) and 20 ng/mL human IL-4 (Sino Biological, Wayne, Pa) for 72 hours.29,30

b-Catenin Nuclear Translocation HAVICs were treated with 200 nM UII or URP peptides for 24 hours in osteogenic medium. Cells were washed with cold phosphate-buffered saline, fixed with 4% paraformaldehyde at room temperature for 15 minutes, stained with rabbit anti-CTNNB1 antibody (1:200; Sigma-Aldrich), followed by Alexa Fluor488 Donkey anti-rabbit IgG (1:400; ThermoFisher Scientific, Waltham, Mass), and nuclear stained with NucBlue (ThermoFisher). High content screening images were taken using ImageXpress Micro XLS (Molecular Devices, LLC, San Jose, Calif) and analyzed using MetaXpress. Average integrated intensity of nuclear CTNNB1 stain was presented.

BS

Calcium Measurements and Ramen Spectroscopy ARS staining was used to visualize and quantify the calcium deposition and calcification nodule formation. To summarize, HAVICs treated with 50 nM, 100 nM, or 200 nM of UII or URP peptides in osteogenic medium for 3 weeks. Cells were fixed and incubated with ARS stain solution (40 mM, pH ¼ 4.2) at room temperature. Phase-contrast images were taken with inverted microscopy. After image capture, calcium-bound ARS was extracted by incubating with 10% cetylpyridinium chloride (Sigma-Aldrich). Extracts were aliquoted in 96-well reading plate for OD 405-nm reading on Spectra Photometer (BioTek, Winooski, Vt). Calcium measurements were normalized against total Crystal Violet (Sigma-Aldrich) stain. Raman spectra were collected on dried pellets from cell lysates. The lysates were centrifuged at 16,000g for 10 minutes; then, the supernatants were removed and the pellets were dried in vacuum overnight. The dried pellets were analyzed using a Raman spectrophotometer (Senterra, Bruker, Germany) equipped with a 785-nm diode laser of 100 mW power coupled with an Olympus optical microscope. Raman spectra were acquired using a 403 objective, in a spectral range from 400 to 1800 cm1 at a resolution of 3.5 cm1. Three different spots were scanned for each sample with an integration time of 40 seconds and 4 co-additions. The data were analyzed using OPUS software (OPUS 7.0.0; Bruker, Karlsruhe, Germany).

Statistical Analysis Spearman correlation analysis was used to test the association between UII, URP, and UT immunohistochemical staining with the histologic (overall level of calcification, fibrosis, inflammation, lipid score) and clinical parameters. One-way analysis of variance (ANOVA) test, followed by Dunnett’s post-hoc multiple comparisons test, were used to assess UII, URP and UT immunostainings in normal aortic valves and normal segments of diseased valves combined compared with intensity of staining in segments of fibrosis, actively calcifying cells and surrounding extracellular matrix, areas of mature calcification, and inflammatory cells of diseased valves. Unpaired t tests (Mann–Whitney tests) were performed for comparing mRNA expression in calcified aortic valves (fibrotic with focal calcification and severely calcified) and normal valves. One-way ANOVA tests were used to compare the levels of mineralization after Raman spectroscopy. Statistical analyses were performed using GraphPad

4

Prism software, version 6.0 (GraphPad Software Inc, San Diego, Calif). P values of <.05 were considered statistically significant for all studies except the histology studies, where a P value of <.01 was considered significant due to multiple statistical testing.

RESULTS mRNA Expression of UII, URP, and UT in Human Aortic Valves There was significantly elevated mRNA expression of UII (P ¼ .0027), URP (P ¼ .0003), and UT (P ¼ .0044) in calcified valves compared with normal valves (Figure 1). Signals for UII, URP, and UT mRNAs were seen in all cases. Isolated HAVICs also expressed URP and UT mRNAs but not UII mRNA (data not shown). Localization of UII Immunoreactivity in Normal and Diseased Human Aortic Valves UII immunoreactivity was lowest in normal aortic valves and in normal leaflets of diseased valves (with no evidence of calcification). In these tissues, there was weak expression in valve interstitial cells (Figure 2, A). UII immunostaining was most abundant in endothelial cells of diseased valves (Figure 2, D) and myofibroblasts of aortic valves with significant fibrosis (Figure 2, E), identified by a-SMA colocalization (Figure 2, H). UII immunoreactivity was also found in mononuclear inflammatory cells surrounding areas 30 Relative Normalized Gene Expression

manufacturer’s instructions. Relative proliferation rate was calculated against Dulbecco’s Modified Eagle Medium (DMEM) controls.

Khan et al

P = .0027

25 20 15 P = .0003 10 P = .0044

6 4 2 0 UII

URP Control

UT AVS

FIGURE 1. UII, URP, and UT mRNA expression in human aortic valves. For box plots, the middle horizontal line represents the median, the boxes represent the IQR, and the whiskers represent the range of values within 1.5 times the IQR. Extra dots represent outliers and are values greater than 1.5 times the IQR. UII, URP, and UT mRNA expression (normalized to glyceraldehyde 3-phosphate dehydrogenase) was found to be significantly elevated in calcified human aortic valves compared with normal aortic valves. UII, Urotensin II; URP, urotensin-related peptide; UT, urotensin receptor; AVS, aortic valve stenosis.

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Basic Science

BS

Khan et al

FIGURE 2. Immunohistochemical localization of UII, URP, and UT in human aortic valves. Low UII (A), URP (B), and UT (C) immunoreactivity observed in valve interstitial cells of histologically normal leaflet (arrows indicate weak immunostaining in valve interstitial cells). D, UII immunoreactivity in the diseased aortic valve endothelium. Co-localization of UII (E), URP (F), and UT (G) immunoreactivity with activated valve interstitial cells and proliferating myointima cells in the thickened fibrosa (arrows), indicated by alpha-smooth muscle actin staining (H). Co-localization of UII (I), URP (J), and UT (K) with macrophages (L) in calcified regions (arrows), indicated by CD68 immunostaining. Protein immunostaining is show in brown and nuclei in purple, *Indicates calcification.

of calcification (Figure 2, I), identified by CD68 colocalization (Figure 2, L). Semiquantitative analyses showed that UII immunostaining intensity in areas of fibrosis was significantly elevated compared with that in normal segments of aortic valves (4.07  0.057; P <.0001). UII immunostaining intensity was also significantly elevated in the foci (4.04  0.095; P < .0001), extracellular matrix (4.00  0.066; P ¼ .0001), and valve interstitial cells (3.90  0.074; P ¼ .0013) in areas of active calcification (3.98  0.053; P <.0001) and surrounding fibrous regions (4.16  0.060; P <.0001) of mature calcification. Multivariate Spearman correlation analyses revealed strong positive correlations between UII overall immunostaining score and calcification (r ¼ 0.5570; P <.0001), fibrosis (r ¼ 0.3646; P ¼ .0026), lipids (r ¼ 0.4299; P ¼ .0008), URP score (r ¼ 0.8034; P <.0001), and UT score (r ¼ 0.5631; P <.0001). There was a trend toward significance in the correlations between UII immunostaining and inflammation (r ¼ 0.2828, P ¼ .0224).

Localization of URP Immunoreactivity in Normal and Diseased Human Aortic Valves URP immunoreactivity was lowest in normal aortic valves or those with little to no calcification (Figure 2, B). There was very strong URP immunoreactivity in valves with significant fibrosis, particularly in activated valve interstitial cells (myofibroblasts) on both aortic and ventricular sides of the leaflet (Figure 2, F and H). URP immunoreactivity was also found in mononuclear cells surrounding calcified lesions (Figure 2, J and L). URP immunostaining was strongest in areas of active calcification and in large developed calcification nodes. One-way ANOVA test showed that URP immunostaining intensity in areas of fibrosis was significantly greater compared with that in normal segments of diseased valves (4.06  0.049; P <.0001). URP immunostaining intensity was significantly greater in the foci (4.14  0.096; P < .0001), extracellular matrix (4.09  0.069; P < .0001), and valve interstitial cells (3.97  0.033; P < .0001) in areas of active calcification. URP

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

5

Basic Science

immunostaining intensity was also significantly elevated in the foci (3.94  0.054; P < .0001) and surrounding fibrous region (4.12  0.063; P <.0001) of mature calcification. URP immunostaining intensity was also significantly elevated in monocytes and macrophages (3.68  0.102; P <.0001) compared with that in normal segments of valves. Spearman correlation analyses revealed a significant correlation between URP overall score and calcification (r ¼ 0.5798; P < .0001), fibrosis (r ¼ 0.3826; P ¼ .0015), lipids (r ¼ 0.5029; P <.0001), and UT score (r ¼ 0.6256; P <.0001). There was a trend toward significance in the correlations between UII immunostaining and inflammation (r ¼ 0.2661, P ¼ .0322).

BS

Localization of UT Immunoreactivity in Normal and Diseased Human Aortic Valves UT immunoreactivity was lowest in normal aortic valves and nondiseased leaflets. In these tissues, weak-to-moderate UT immunoreactivity was seen in valve interstitial cells on both aortic and ventricular sides of the leaflet (Figure 2, C). In areas of fibrosis, UT immunoreactivity was strong in activated valve interstitial cells surrounding calcification (Figure 2, G and H). Moderate UT immunoreactivity was seen in monocytes surrounding developed calcification nodes (Figure 2, K and L). One-way ANOVA test showed that UT immunostaining intensity in areas of fibrosis was significantly elevated compared with that seen in normal segments of diseased valves (3.20  0.097; P <.0001). UT immunostaining intensity was strongest in valve interstitial cells in active calcification (3.78  0.087; P<.0001). UT immunostaining intensity was also significantly elevated in the foci (3.19  0.120; P <.0001) and surrounding fibrous region (3.46  0.111; P<.0001) of mature calcification. Spearman correlation analyses revealed strong positive correlations between UT overall score and calcification (r ¼ 0.4444; P ¼ .0002) and fibrosis (r ¼ 0.3523; P ¼ .0035). There was no significant correlation between UT overall score and inflammation (r ¼ 0.2168; P ¼ .0804). Clinical Correlations With UII and URP Immunostaining There were no significant correlations between UII immunostaining and any echocardiographic parameters. URP immunostaining showed significant correlations with jet velocity (r ¼ 0.4975; P ¼ .0114), Pmax (r ¼ 0.4975; P ¼ .0114), and Pmean (r ¼ 0.5124; P ¼ .0088) and a significant inverse correlation with aortic valve area (r ¼ –0.4242; P ¼ .0275). There were no other significant correlations found between UII, URP, or UT and left ventricular ejection fraction, diabetes, or hypercholesterolemia. 6

Khan et al

Presence of UT Protein in Stenotic Human Aortic Valves and HAVICs Western blot analyses confirmed the expression of UT receptors in 4 different HAVIC lines extracted from calcified aortic valves (Figure 3, A and B). There was a greater expression of glycosylated UT in calcified leaflets from patients with AVS compared with normal leaflets (Figure 3, C and D; P ¼ .0473). No obvious detection of deglycosylated UT was found in stenotic aortic valves. Our positive control cell lysate from HEK293 cells revealed a similar pattern of UT protein expression to what was observed in valve tissues (data not shown).

UII and URP Increases Proliferation of HAVICs Treatment of HAVICs with 100 nM, 200 nM, and 300 nM of UII or URP for 48 hours significantly increased cellular proliferation compared with DMEM media alone (Figure 4, A, P <.0001). There was no significant difference in the extent of cell proliferation between the 3 doses of UII or URP used in the study indicating that the effects plateau at 100 nM.

Effects of UII and URP on Cholesterol Efflux in HAVICs and M2 Macrophages HAVICs isolated from healthy human aortic valves treated with 200 nM of UII or URP for 48 hours exhibited a significant decrease in cholesterol efflux (Figure 4, B, P ¼ .0011 and P ¼ .0002, respectively). M2-induced macrophages treated with 200 nM of UII displayed significant reductions in APOA1-dependent cholesterol efflux (Figure 4, C, P ¼ .0371). There were no significant changes seen in macrophages treated with 200 nM URP.

ABCA1 Protein Expression in HAVICs HAVICs isolated from normal human aortic valves expressed abundant ABCA1 protein (Figure 5, A). Treatment of HAVICs with 200 nM of UII for 24 hours led to a significant reduction in ABCA1 protein expression compared with vehicle-treated cells (Figure 5, B, P ¼ .0457). Although there was a trend toward reduction, no significant changes in ABCA1 protein expression was observed in HAVICs treated with 200 nM of URP compared with vehicle-treated cells (Figure 5, A and B). UII and URP Increased b-Catenin Nuclear Translocation in HAVICs Treatment of HAVICs with 200 nM UII for 24 hours significantly increased b-catenin nuclear localization (Figure 6, A and B, P<.0001). URP had no effect on b-catenin translocation in HAVICs.

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al

Basic Science

HAVIC Lines

Glycosylated UT

40KD

Deglycosylated UT

37KD

GAPDH

300

200

100

U te d sy la

sy la

B

G

600

P = .0473

AVS

60KD

Glycosylated UT

37KD

GAPDH

C

D

500 400 300

BS

NAV

Relative Normalized Average Intergrated Intensity (%)

D

eg

ly

ly

co

co

A

te d

U

T

0

T

60KD

Relative Normalized Average Integrated Intensity (%)

400

200 100 0 NAV

AVS

FIGURE 3. Protein expression of UT in HAVICs and stenotic aortic valves. For box plots, the middle horizontal line represents the median, the boxes represent the IQR, and the whiskers represent the range of values within 1.5 times the IQR. Extra dots represent outliers and are values greater than 1.5 times the IQR. A, Western Blot showing UT protein glycosylation in 4 primary cultured HAVIC lines generated from calcified human aortic valves. B, Densitometry analysis of glycosylated UT expression relative to deglycosylated UT expression in HAVICs, suggesting a trend toward increased glycosylated UT protein expression in calcified human aortic valves. C, Western Blot of UT receptor protein in 8 aortic stenotic valves. The first 2 lanes represent UT expression from normal leaflets of diseased valves, and the rest are samples from calcified leaflets. D, Densitometry analysis of glycosylated UT expression showing increased glycosylated UT protein expression in calcified aortic valves. HAVICs, Human aortic valve interstitial cells; UT, urotensin receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; NAV, normal aortic valve; AVS, aortic valve stenosis.

UII Increases Cell Mineralization in HAVICs Treatment of HAVICs treated with 100 nM and 200 nM of UII for 3 weeks resulted in significant calcium deposition depicted by ARS (Figure 7, A and B, P ¼ .0269 and P < .0001, respectively). Treatment with 50 nM UII or URP did not result in any significant calcification. Raman spectra collected on lysates from HAVICs incubated in osteogenic medium and treated with 50 nM, 100 nM, or 200 nM UII or URP for 3 weeks showed a significant increase in mineralization (Figure 7, C). In addition to the peaks relative to the organic components (Table E231-36), all spectra showed a peak located at 960 cm1. This peak corresponds to the n1 vibration of the phosphate group and is indicative of the formation of hydroxyapatite (HA) on these samples, as shown by the comparison with

spectra of bone, and reference HA (Figure 7, D, spectra c-d). There was also presence of HA in UII-treated cells (Figure 7, D, spectrum b), whereas HAVICs incubated in DMEM for 3 weeks did not show any evidence of phosphate deposition (Figure 7, D, spectrum a). A complete list of peak assignments for these spectra is presented in Table E2.31-36 By integrating the area of the n1 phosphate peak and dividing this value by the area of the peak at 1440 cm1, which is relative to the asymmetric bending of CH2,CH3 groups, we estimated the amount of inorganic deposits relative to the amount of organic material found in each sample (Figure 7, E).37 HA was deposited in significantly larger amounts on HAVICs treated with 100 nM and 200 nM of UII compared with nontreated HAVICs (P ¼ .0199 and

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

7

Basic Science

Khan et al

P < .0001

P = .0002 Relative APOA1 Efflux Change (%)

Relative Proliferation Ratio (%)

120 P < .0001

110

100

BS

Relative APOA1 Efflux Change (%)

C

100

90

80

M

70

0n

M

P = .0011

30

Control

UII

URP

R

P

20

0n

B

U

R U

P R U

P

10

0n

M

M 0n

M 30

0n II

II

20

0n

U

A

U

U

II

C

10

on

tro l

M

90

110

P = .0371

120

100

80

60

40 Control

UII

URP

FIGURE 4. Effects of UII or URP on cellular proliferation and cholesterol efflux in HAVICS and cholesterol efflux in THP1-activated macrophages. For box plots, the middle horizontal line represents the median, the boxes represent the IQR, and the whiskers represent the range of values within 1.5 times the IQR. Extra dots represent outliers and are values greater than 1.5 times the IQR. A, Increased cellular proliferation detected by MTT of HAVICs treated with 100 nM, 200 nM, and 300 nM of UII and URP peptides for 48 hours (N ¼ 6 HAVICs from different valves). B, Reduced APOA1-dependent cholesterol efflux in HAVICs treated with 200 nM UII or URP peptides for 48 hours (N ¼ 6 HAVICs from different valves). C, Reduced APOA1-dependent cholesterol efflux in THP1-induced M2 macrophages treated with 200 nM UII, but not 200 nM URP peptides, for 48 hours (N ¼ 6 HAVICs from different valves). UII, Urotensin II; URP, urotensin-related peptide; HAVICs, human aortic valve interstitial cells; IQR, interquartile range; APOA1, apolipoprotein A1.

P ¼ .0035, respectively). No significant differences were found between the HAVICs treated with 50 nM UII or URP at any concentration and the nontreated HAVICs. By measuring the full width at half maximum of the n1 phosphate peak, we estimated the degree of crystallinity of the HA deposits (Figure 7, F). Wider peaks indicate a less crystalline material, whereas sharper peaks relate to greater crystallinity.38 Significantly lower full width at half maximum values were found in HAVICs treated with 50 nM (P ¼ .0121), 100 nM (P ¼ .0282), and 200 nM (P ¼ .0058) of UII compared with the nontreated cells, indicating the formation of more crystalline deposits. No statistically significant differences were found between the HAVICs treated with URP and the nontreated HAVICs, suggesting the same degree of crystallinity for these deposits. 8

Changes in Gene Expression in HAVICs Treated With UII or URP Several genes involved in HAVIC mineralization such as Wnt2, Wnt3a, Wnt4, and Wnt11, as well as bone gammacarboxyglutamic acid-containing protein, secreted phosphoprotein 1, and matrix Gla-protein (MGP), were upregulated by at least 1.5-fold upon treatment with UII or URP for 48 hours (Table E3). A reduction in the expression of secreted frizzled receptor protein 2, an inhibitor of Wnts, was also observed. After 10 days of treatment of HAVICs with either UII or URP, there was more than 1.5-fold increase in low-density lipoprotein-receptor, liver X receptor alpha, and Wnt3a (Table E4). There was also a decrease in the expression of MGP and collagen 3A1. Neither UII nor URP had any effects on other genes tested.

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al

Basic Science

Control

UII

URP

254 kDa

ABCA1 Actin

42 kDa

A

A P = .0457

140 120 100 80 60 40 20 Control

UII

URP

P < .0001

6000

4000

2000

URP 0

FIGURE 5. ABCA1 protein expression in HAVICs treated with UII or URP. For box plots, the middle horizontal line represents the median, the boxes represent the IQR, and the whiskers represent the range of values within 1.5 times the IQR. Extra dots represent outliers and are values greater than 1.5 times the IQR. A, Representative Western blot of ABCA1 expression in HAVICs treated with 200 nM UII or URP peptides for 24 hours. B, Densitometry analysis of ABCA1 protein intensity showing reduced expression in UII-treated HAVICs (N ¼ 4 HAVICs from different valves). UII, Urotensin II; URP, urotensin-related peptide; ABCA1, ATP-binding cassette A1.

DISCUSSION Although previous work has profiled UII and UT immunostaining in atherosclerosis and other cardiovascular diseases,11,21,27 this is the first study showing UII, UT, and URP expression in stenotic human aortic valves (Figure 8). Our histologic analyses revealed that while UII, URP, and UT protein expression were low in histologically normal valves, all 3 proteins were elevated in activated valve interstitial cells, inflammatory cells, and areas of mature and active calcification. We also found significant positive correlations between UII, URP, and UT overall immunostaining with calcification, fibrosis, inflammation, and lipid. Of particular interest is the strong cell-specific immunostaining of UII, URP, and UT activated valve interstitial cells, which are characterized by the expression of myofibroblast marker a-smooth muscle actin. Previous studies showed that UII increases proliferation and collagen production of smooth muscle cells.22,39 Here, we show that UII and URP significantly increased cellular proliferation, b-catenin nuclear translocation, and mineralization and decreased ABCA1 protein expression and cholesterol efflux in HAVICs. Taken together, our findings of increased release and tissue expression of UII, URP, and UT, as

B

Control

UII

URP

FIGURE 6. b-catenin nuclear translocation analysis of HAVICs treated with UII or URP. For box plots, the middle horizontal line represents the median, the boxes represent the IQR, and the whiskers represent the range of values within 1.5 times the IQR. Extra dots represent outliers and are values greater than 1.5 times the IQR. A, Representative image of b-catenin immunofluorescence in HAVICs treated with 200 nM UII or URP peptides in for 24 hours. Magnification, 203. Nuclei are shown in blue, b-catenin in green, and outline of nuclei in red. B, Quantification of nuclear b-catenin fluorescence intensity in HAVICS treated with UII or URP (N > 800 analyzed cells). UII, Urotensin II; URP, urotensin-related peptide.

well as our in vitro data from isolated HAVICs suggest a role for the UII system in the pathogenesis of AVS. Our analysis of the mRNA expression of UII, URP, and UT in advanced (calcified) and fibrotic (early disease) aortic valves provides interesting insight into the potential differential effects of UII and URP. While both UII and the UT receptor were found to have significantly elevated mRNA expression in advanced calcified human valves, interestingly, URP mRNA expression was greater in diseased fibrotic valves with focal calcification. There is currently little information regarding the differential expression of UII and URP. In a study of spontaneously hypertensive rats, URP mRNA expression in the kidneys was 4-fold greater compared with normotensive rats.40 Our findings that URP immunostaining has statistically significant negative correlations with aortic valve area and positive correlation with jet velocity, Pmean, and Pmax may provide some insight into the potentially important role of URP in aortic valve calcification and stenosis.

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

9

BS

B

UII

8000 Average Integrated Intensity

Relative Normalized Integrated Intensity (%)

160

Control

Basic Science

Khan et al

UII 50nM

UII 100nM

Relative Calcium Deposition (%)

P < .0001 UII 200nM

OSM

URP 100nM

URP 50nM

URP 200nM

160

P = .0269

140 120 100 80

0 20

0 P U

R

P

P U

R

R U

10

50

00

00

II 2 U

II 1 U

B

U

O

A

II

SM

50

60

v1 PO43_

v1 PO43_

Raman scattering (a.u.)

BS

Raman scattering (a.u.)

(f)

(e)

(d) (c) (b)

(d) (c) (b) (a)

(a) 1600

1400

1200

1000

800

600

Wavenumber (cm )

C

1800

400

–1

600

400

P = .0058

24 FWHM (cm–1)

P = .0121

22 20 18

20 0 R P

U

U

R P

10 0

50 P

20

0

0 U R

U II

50

10 U II

O SM

0 20

10

0 U R P

50 P

U R P

20

0

0 U R

U II

50

10 U II

II U

O

SM

16 II

Inorganic/Organic Ratio

800

P = .0282

2.5

1.5

1000

Wavenumber (cm )

26

2.0

1200

–1

P = .0199

1.0

E

1400

D

P = .0035 3.0

1600

U

1800

F

FIGURE 7. Assessment of cell mineralization in HAVICs treated with UII or URP. For box plots, the middle horizontal line represents the median, the boxes represent the IQR, and the whiskers represent the range of values within 1.5 times the IQR. Extra dots represent outliers and are values greater than 1.5 times the IQR. A, Representative images of Alizarin Red Sirius staining on HAVICs treated with 50 nM, 100 nM, or 200 nM UII and URP peptides for 3 weeks. Magnification, 103. B, Quantification of the Alizarin Red staining. Absorbance was read at OD 405 and normalized to total cell count by Crystal Violet staining. C, Representative Raman spectra of HAVICs incubated in osteogenic medium for 3 weeks treated with 50 nM (a), 100 nM (b), 200 nM (c) of UII, or treated with 50 nM (d), 100 nM (e), 200 nM (f) of URP. D, Representative Raman spectra of reference samples: HAVICs incubated in DMEM (a) or osteogenic medium (b) for 3 weeks, bone (c), and standard HA (d). E, Inorganic-to-organic ratio measured by dividing the area of the n1 (PO4) peak at 960 cm1 by the area of the das CH2, CH3 peak at 1440 cm1. F, FWHM measured on the n1(PO4) peak at 960 cm1. OSM, Osteogenic medium; UII, urotensin II; URP, urotensin-related peptide; FWHM, full width at half maximum.

10

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al

Basic Science

Role of the urotensin system in the pathogenesis of aortic valve stenosis Normal Valve

Stenotic Valve Urotensin II Immunostaining Control

Urotensin II

Enzymatic Digestion

Valve Interstitial Cells

Urotensin II and Urotensin-related Peptide Treatment Proliferation Calcification Cholesterol efflux

We performed several experiments to better elucidate the mechanism in which the UII system may be contributing to AVS. Interestingly, we found that UII reduced HAVIC and M2 macrophages cholesterol efflux capacity, and expression of ABCA1 in HAVICs. ABCA1 is a cholesterol transporter that induces cellular cholesterol efflux via transfer of cholesterol onto apolipoprotein A1.41 Thus, downregulation of ABCA1, as shown in our study, is an indicative of reduced capacity for cholesterol efflux and vice versa. Our findings are in agreement with a previous report demonstrating that UII reduces ABCA1 expression and cholesterol efflux capacity in human macrophages, and increased foam cell formation in atherosclerosis.42 Furthermore, our study suggests a role for UII in promoting mineralization in cultured HAVICs. Similar to our previous results in human aortic smooth muscle cells,21 treating HAVICs with UII induced significant mineralization,27 a finding that further confirmed by our Raman spectroscopy data. In addition, treatment with UII significantly increased the crystallinity of the mineral deposits. In previous works, we and others found that mineral deposits in ectopic calcifications become more crystalline over time,43-45 following a trend similar to what observed during bone mineralization.46-49 Thus, the greater crystallinity found on the minerals deposited by UII-treated HAVICs suggests that the process of calcification was initiated earlier in these cells compared with nontreated cells. Our data showed that UII induced b-catenin nuclear localization, which may lead to activation of canonical Wnt signaling pathways. Canonical Wnt ligand Wnt3a has been shown to be upregulated in AVS and induce b-catenin nuclear localization.50,51 Our results demonstrated increased

mRNA expression of Wnt3a during short-term UII and URP treatments, and long-term UII treatment. UII also increased expression of noncanonical Wnt11. Previously, our group demonstrated increased Wnt11 expression in stenotic valves and its effects on HAVIC calcification.28 Long-term exposure of HAVICs to the UII system led to a decrease in secreted frizzled receptor protein 2 and MGP, both known to inhibit mineralization, further supporting a role for the urotensin system in the pathogenesis of AVS. The strengths of our study are that it is the first to report expression of UII, URP, and UT in human aortic valves and represents the first documentation of the UII system’s effect on cholesterol efflux and mineralization in HAVICs. Our study is limited in that first, it measures the UII system moreso in patients with advanced AVS and not in those with early disease due to lack of available tissues in early stages of the disease, suggesting the need for further investigation in this subset population. Second, the semiquantitative grading system used for the intensity of the immunostaining may vary based on the reader; we therefore complimented it with the quantifiable technique Western blotting. Third, insight into the in vivo effects of UT receptor blockade in an in vivo model of AVS, or genetic deletion of the UT receptor in mice would further delineate the exact role the UII system plays in AVS. Based on the evidence provided here, future experiments aimed at blocking the UT receptor in vivo are warranted to fully elucidate the role of UII in the pathogenesis of AVS. Conflict of Interest Statement Dr Tardif reports the following conflicts: Servier: grant; Servier: personal fees; grants: Amarin, Ionis, Pfizer, Sanofi,

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

11

BS

FIGURE 8. The urotensin system in aortic valve stenosis. The urotensin system is abundantly expressed in calcified regions of stenotic aortic valves compared with normal tissues and contributed to the pathogenesis of aortic valve stenosis by increase calcification and fibrosis, while decreasing cholesterol efflux in aortic valve interstitial cells.

Basic Science

Servier, DalCor, AstraZeneca, Esperion; personal fees: Pfizer (honoraria committee co-chairman), Sanofi (honoraria as exec. comm. member), Servier (honoraria), DalCor (honoraria and minor equity interest), Astra Zeneca Honoraria. We thank Dr Qutayba Hamid (McGill University, Montreal, Canada), Dr Benoit de Varennes (McGill University, Montreal, Canada), Dr Dominique Shum-Tim (McGill University, Montreal, Canada), Dr Mohammad Alreshidan (McGill University, Montreal, Canada), and Dr Eric Rheaume (Montreal Heart Institute, Montreal, Canada) for their help in providing the aortic valve tissues.

References

BS

1. Osnabrugge RLJ, Mylotte D, Head SJ, Van Mieghem NM, Nkomo VT, Lereun CM, et al. Aortic stenosis in the elderly: disease prevalence and number of candidates for transcatheter aortic valve replacement: a meta-analysis and modeling study. J Am Coll Cardiol. 2013;62:1002-12. 2. Coffey S, Cox B, Williams MJA. The prevalence, incidence, progression, and risks of aortic valve sclerosis: a systematic review and meta-analysis. J Am Coll Cardiol. 2014;63(25 Part A):2852-61. 3. Dweck MR, Khaw HJ, Sng GKZ, Luo ELC, Baird A, Williams MC, et al. Aortic stenosis, atherosclerosis, and skeletal bone: is there a common link with calcification and inflammation? Eur Heart J. 2013;34:1567-74. 4. Ross R. Atherosclerosis—an inflammatory disease. N Engl J Med. 1999;340: 115-26. 5. Small A, Kiss D, Giri J, Anwaruddin S, Siddiqi H, Guerraty M. Biomarkers of calcific aortic valve disease. Arterioscler Thromb Vasc Biol. 2017;37:623-32. 6. Akahori H, Tsujino T, Masuyama T, Ishihara M. Mechanisms of aortic stenosis. J Cardiol. 2017;71:215-20. 7. Parisi V, Leosco D, Ferro G, Bevilacqua A, Pagano G, de Lucia C, et al. The lipid theory in the pathogenesis of calcific aortic stenosis. Nutr Metab Cardiovasc Dis. 2015;25:519-25. 8. Cote N, Mahmut A, Bosse Y, Couture C, Page S, Trahan S, et al. Inflammation is associated with the remodeling of calcific aortic valve disease. Inflammation. 2013;36:573-81. 9. Albanese I, Khan K, Barratt B, Al-Kindi H, Schwertani A. Atherosclerotic calcification: Wnt is the hint. J Am Heart Assoc. 2018;7:1-12. 10. Ames RS, Sarau HM, Chambers JK, Willette RN, Aiyar NV, Romanic AM, et al. Human urotensin-II is a potent vasoconstrictor and agonist for the orphan receptor GPR14. Nature. 1999;401:282-6. 11. Bousette N, Patel L, Douglas SA, Ohlstein EH, Giaid A. Increased expression of urotensin II and its cognate receptor GPR14 in atherosclerotic lesions of the human aorta. Atherosclerosis. 2004;176:117-23. 12. Douglas SA, Tayara L, Ohlstein EH, Halawa N, Giaid A. Congestive heart failure and expression of myocardial urotensin II. Lancet. 2002;359:1990-7. 13. Vaudry H, Leprince J, Chatenet D, Fournier A, Lambert DG, Le Mevel JC, et al. International Union of Basic and Clinical Pharmacology. XCII. Urotensin II, urotensin II-related peptide, and their receptor: from structure to function. Pharmacol Rev. 2015;67:214-58. 14. Matsushita M, Shichiri M, Imai T, Iwashina M, Tanaka H, Takasu N, et al. Coexpression of urotensin II and its receptor (GPR14) in human cardiovascular and renal tissues. J Hypertens. 2001;19:2185-90. 15. McDonald J, Batuwangala M, Lambert DG. Role of urotensin II and its receptor in health and disease. J Anesth. 2007;21:378-89. 16. Mohler ER III, Chawla MK, Chang AW, Vyavahare N, Levy RJ, Graham L, et al. Identification and characterization of calcifying valve cells from human and canine aortic valves. J Hear Valve Dis. 1999;8:254-60. 17. Tzanidis A, Hannan RD, Thomas WG, Onan D, Autelitano DJ, See F, et al. Direct actions of urotensin II on the heart: implications for cardiac fibrosis and hypertrophy. Circ Res. 2003;93:246-53. 18. Liu Q, Pong SS, Zeng Z, Zhang Q, Howard AD, Williams DL Jr, et al. Identification of urotensin II as the endogenous ligand for the orphan G-protein-coupled receptor GPR14. Biochem Biophys Res Commun. 1999;266:174-8. 19. Hassan GS, Douglas SA, Ohlstein EH, Giaid A. Expression of urotensin-II in human coronary atherosclerosis. Peptides. 2005;26:2464-72.

12

Khan et al

20. Lapp H, Boerrigter G, Costello-Boerrigter LC, Jaekel K, Scheffold T, Krakau I, et al. Elevated plasma human urotensin-II-like immunoreactivity in ischemic cardiomyopathy. Int J Cardiol. 2004;94:93-7. 21. Maguire JJ, Kuc RE, Wiley KE, Kleinz MJ, Davenport AP. Cellular distribution of immunoreactive urotensin-II in human tissues with evidence of increased expression in atherosclerosis and a greater constrictor response of small compared to large coronary arteries. Peptides. 2004;25:1767-74. 22. Watanabe T, Pakala R, Katagiri T, Benedict CR. Synergistic effect of urotensin II with serotonin on vascular smooth muscle cell proliferation. J Hypertens. 2001; 19:2191-6. 23. Watanabe T, Pakala R, Katagiri T, Benedict CR. Synergistic effect of urotensin II with mildly oxidized LDL on DNA synthesis in vascular smooth muscle cells. Circulation. 2001;104:16-8. 24. Ozer O, Davutoglu V, Ercan S, Akcay M, Sari I, Sucu M, et al. Plasma urotensin II as a marker for severity of rheumatic valve disease. Tohoku J Exp Med. 2009; 218:57-62. 25. Baumgartner H, Hung J, Bermejo J, Chambers JB, Edvardsen T, Goldstein S, et al. Recommendations on the echocardiographic assessment of aortic valve stenosis: a focused update from the European Association of Cardiovascular Imaging and the American Society of Echocardiography. Eur Hear J Cardiovasc Imaging. 2017;18:254-75. 26. Al Kindi H, Hafiane A, You Z, Albanese I, Pilote L, Genest J, et al. Circulating levels of the vasoactive peptide urotensin II in patients with acute coronary syndrome and stable coronary artery disease. Peptides. 2014;55:151-7. 27. Albanese I, Daskalopoulou SS, Yu B, You Z, Genest J, Alsheikh-Ali A, et al. The urotensin II system and carotid atherosclerosis: a role in vascular calcification. Front Pharmacol. 2016;7:149. 28. Albanese I, Yu B, Al-Kindi H, Barratt B, Ott L, Al-Refai M, et al. Role of noncanonical Wnts signaling pathway in human aortic valve calcification. Arter Thromb Vasc Biol. 2017;37:543-52. 29. Ruytinx P, Proost P, Damme J Van, Struyf S. Chemokine-induced macrophage polarization in inflammatory conditions. Front Immunol. 2018;9:1930. 30. Daigneault M, Preston JA, Marriott HM, Whyte MKB, Dockrell DH. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS One. 2010;5:e8668. 31. Penel G, Leroy G, Rey C, Bres E. MicroRaman spectral study of the PO4 and CO3 vibrational modes in synthetic and biological apatites. Calcif Tissue Int. 1998;63:475-81. 32. Karampas IA, Kontoyannis CG. Characterization of calcium phosphates mixtures. Vib Spectrosc. 2013;64:126-33. 33. Baraga J, Feld M, Rava R. In situ optical histochemistry of human artery using near infrared Fourier transform Raman spectroscopy. Proc Natl Acad Sci U S A. 1992;89:3473-7. 34. Salenius JP, Brennan JF, Miller A, Wang Y, Aretz T, Sacks B, et al. Biochemical composition of human peripheral arteries examined with near-infrared Raman spectroscopy. J Vasc Surg. 1998;27:710-9. 35. Rygula A, Majzner K, Marzec KM, Kaczor A, Pilarczyk M, Baranska M. Raman spectroscopy of proteins: a review. J Raman Spectrosc. 2013;44:1061-6. 36. Ramser K. In: Ghomi M, ed. Raman Spectroscopy of Single Cells for Biomedical Applications. Amsterdam: IOS Press; 2012. 37. Morris MD, Mandair GS. Raman assessment of bone quality. Clin Orthop Relat Res. 2011;469:2160-9. 38. Puceat E, Reynard B, Lecuyer C. Can crystallinity be used to determine the degree of chemical alteration of biogenic apatites? Chem Geol. 2004;205:83-97. 39. Li W, Cai Z, Liu M, Zhao C, Li D, Lv C, et al. Urotensin II contributes to collagen synthesis and up-regulates Egr-1 expression in cultured pulmonary arterial smooth muscle cells through the ERK1/2 pathway. Biochem Biophys Res Commun. 2015; 467:1076-82. 40. Forty EJ, Ashton N. The urotensin system is up-regulated in the pre-hypertensive spontaneously hypertensive rat. PLoS One. 2013;8:e83317. 41. Phillips M. Is ABCA1 a lipid transfer protein? J Lipid Res. 2018;59:749-63. 42. Wang Y, Wu JF, Tang YY, Zhang M, Li Y, Chen K, et al. Urotensin II increases foam cell formation by repressing ABCA1 expression through the ERK/NF-kB pathway in THP-1 macrophages. Biochem Biophys Res Commun. 2014;452:998-1003. 43. Gourgas O, Marulanda J, Zhang P, Murshed M, Cerruti M. Multidisciplinary approach to understand medial arterial calcification. Arterioscler Thromb Vasc Biol. 2018;38:363-72. 44. Pilarczyk M, Czamara K, Baranska M, Natorska J, Kapusta P, Undas A, et al. Calcification of aortic human valves studied in situ by Raman microimaging: following mineralization from small grains to big deposits. J Raman Spectrosc. 2013;44:1222-9.

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al

Basic Science

49. Mahamid J, Sharir A, Addadi L, Weiner S. Amorphous calcium phosphate is a major component of the forming fin bones of zebrafish: indications for an amorphous precursor phase. Proc Natl Acad Sci. 2008;105: 12748-53. 50. Alfieri CM, Cheek J, Chakraborty S, Yutzey KE. Wnt signaling in heart valve development and osteogenic gene induction. Dev Biol. 2010;338:127-35. 51. Leopold JA. Cellular mechanisms of aortic valve calcification. Circ Cardiovasc Interv. 2013;5:605-14.

Key Words: human, immunohistochemistry, reverse transcriptase polymerase chain reaction, cholesterol efflux, Raman spectroscopy, mineralization

BS

45. Cottignoli V, Cavarretta E, Salvador L, Valfre C, Maras A. Morphological and chemical study of pathological deposits in human aortic and mitral valve stenosis: a biomineralogical contribution. Pathol Res Int. 2015;2015:342984. 46. Mahamid J, Aichmayer B, Shimoni E, Ziblat R, Li C, Siegel S, et al. Mapping amorphous calcium phosphate transformation into crystalline mineral from the cell to the bone in zebrafish fin rays. Proc Natl Acad Sci. 2010;107:6316-21. 47. Rey C, Shimizu M, Collins B, Glimcher MJ. Resolution-enhanced fourier transform infrared spectroscopy study of the environment of phosphate ion in the early deposits of a solid phase of calcium phosphate in bone and enamel and their evolution with age: 2. Investigations in the v3 PO4 domain. Calcif Tissue Int. 1991; 49:383-8. 48. Rey C, Hina A, Tofighi MJ, Glimcher A. Maturation of poorly crystalline apatites: chemical and structural aspects in vivo and in vitro. Cells Mater. 1995;5:345-56.

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

13

Basic Science

Khan et al

TABLE E1. Primers used in the reverse transcriptase polymerase chain reaction analyses Gene

Forward sequence

Reverse sequence

UII

CTTGAGCTATGTCAAGAGAAGCCAC

CAATGTTGCCTCAGTTACGAATGAT

URP

ATGTACGTCTACGTGGTCAACCTG

GAAGTGCCACTCCTTGGTGACGTA

UT

ATGTACGTCTACGTGGTCAACCTG

GAAGTGCCACTCCTTGGTGACGTA

BGLAP

ACCGAGACACCATGAGAGCC

ACCTTTGCTGGACTCTGCAC

COL3A1

CGCTCTGCTTCATCCCACTATTATT

GTTCTGGCTTCCAGACATCTCTATC

MGP

CACATGAAAGCATGGAATCTTATGAACT

TCTGCTGAGGGGATATGAAGGTATT

SFRP2

CAACGACATAATGGAAACGCTTTGT

TCAGCTTGTAAATGGTCTTGCTCTT

LDLR

TATCAGAAGACCACAGAGGATGAGG

CGTCATCCTCCAGACTGACCATC

LXRa

CCAAATTGCTACTTCTCTGGGGCT

CTTCCTGGAGCCCTGGTCATTA

WNT3A

ACTCGGATACTTCTTACTCCTCTGC

GAGCCCAGGGAGGAATACTG

WNT11

AAGTTTTCCGATGCTCCTATGAAGG

ACTTACACTTCATTTCCAGAGAGGC

WNT2

CATTTGTGGATGCAAAGGAAAGGAA

CACTCTTGTTTCAAGAACCGCTTTAC

WNT4

CTCGACTCCTTGCCCGTCTTC

ATGCACTGTCCTGTCACAGCC

UII, Urotensin II; URP, urotensin-related peptide; UT, urotensin receptor; BGLAP, bone gamma-carboxyglutamic acid-containing protein; COL3A1, collagen type III alpha 1 chain; MGP, matrix Gla-protein; SFRP2, secreted frizzled receptor protein 2; LDLR, low-density lipoprotein-receptor; LXRa, liver X receptor alpha; WNT3A, Wnt family member 3a; WNT11, Wnt family member 11; WNT2, Wnt family member 2; WNT4, Wnt family member 4.

BS TABLE E2. Raman peak assignment for all peaks shown in Figure 7 Raman shift (cm1)

Assignment

425

n2 PO4

590

n4 PO4

621

n C-C phenylalanine

758

Tryptophan

796

U, A, C (DNA)

960

n1 PO4

1001

Phenylalanine

1031

d C-H phenylalanine

1078

n3 PO4

1091

n3 PO4

1155

n C-C, n C-N in proteins

1182

n C-H tyrosine, phenylalanine

1197-1200

n C-C6H6 stretching phenylalanine, tyrosine, tryptophan

1329

d C-H proteins

1450

C-H deformation proteins

1583

A, G (DNA)

1602

C¼C phenylalanine, tyrosine

1661

d C¼O proteins (Amide I)

13.e1

The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al

Basic Science

TABLE E3. mRNA expression profile in HAVICs treated with UII and URP for 48 hours Gene

Control RNE SEM

50 nM UII SEM P value

RNE

RNE

200 nM UII SEM P value

RNE

50 nM URP SEM P value

RNE

200 nM URP SEM P value

WNT2

1.000

0.120

1.210

0.140

.318

1.270

0.180

.280

1.470

0.300

.220

1.690*

0.180

.033

WNT3A

1.000

0.120

2.120y

0.180

.007

2.490y

0.230

.005

2.520y

0.250

.005

1.890*

0.220

.024

WNT4

1.000

0.090

1.790*

0.160

.013

2.200y

0.190

.005

2.560y

0.230

.003

2.130*

0.240

.012

WNT11

1.000

0.100

1.720*

0.160

.019

2.860*

0.390

.010

1.220

0.310

.536

1.050

0.430

.915

SFRP2

1.000

0.090

1.380

0.110

.056

0.340*

0.040

.026

0.560

0.140

.057

0.320y

0.090

.006

MGP

1.000

0.100

1.150

0.090

.327

1.160

0.100

.321

1.250

0.120

.185

1.850*

0.170

.013

BGLAP

1.000

0.080

1.450*

0.130

.042

2.150y

0.190

.005

2.100y

0.200

.007

1.810*

0.200

.020

BS

UII, Urotensin II; URP, urotensin-related peptide; RNE, relative normalized expression; SEM, standard error of the mean; WNT2, Wnt family member 2; WNT3A, Wnt family member 3a; WNT4, Wnt family member 4; WNT11, Wnt family member 11; SFRP2, secreted frizzled receptor protein 2; MGP, matrix Gla-protein; BGLAP, bone gammacarboxyglutamic acid-containing protein. *P <.05. yP <.01 compared with control.

TABLE E4. mRNA expression profile in HAVICs treated with UII and URP for 10 days Gene

RNE

Control SEM

RNE

100nM UII SEM

P value

RNE

100nM URP SEM

P value

WNT3A

1.000

0.068

1.899*

0.137

.024

1.273

0.113

.167

MGP

1.000

0.011

1.045*

0.031

.018

0.772y

0.018

.002

COL3A1

1.000

0.013

0.739y

0.022

.001

1.080y

0.021

.007

LXRa

1.000

0.067

2.018y

0.065

.005

1.103

0.221

.647

LDLR

1.000

0.037

2.022y

0.072

.003

2.269y

0.049

.001

UII, Urotensin II; URP, urotensin-related peptide; RNE, relative normalized expression; SEM, standard error of the mean; WNT3A, Wnt family member 3a; MGP, matrix Glaprotein; COL3A1, collagen type III alpha 1 chain; LXRa, liver X receptor alpha; LDLR, low-density lipoprotein-receptor. *P <.05. yP <.01 compared with control.

The Journal of Thoracic and Cardiovascular Surgery c Volume -, Number -

13.e2

Basic Science

000

Urotensin II, urotensin-related peptide, and their receptor in aortic valve stenosis Kashif Khan, BSc, Isabella Albanese, MD, MSc, BSc, Bin Yu, PhD, Yousif Shalal, Hamood AlKindi, MD, FRCSC, Hossney Alaws, BSc, Jean-Claude Tardif, MD, Ophelie Gourgas, MSc, BSc, Marta Cerutti, PhD, and Adel Schwertani, DM, PhD, Montreal, Quebec, Canada This study supports the identification of the urotensin system as a key player in the pathogenesis of AVS, using human valve tissues and cells derived from these tissues.

BS The Journal of Thoracic and Cardiovascular Surgery c - 2019

Khan et al