Use of an infectious Simian virus 40-based shuttle vector to analyse UV-induced mutagenesis in monkey cells

DNA Repair

ELSEVIER

Mutation Research 364 (1996) 235-243

Use of an infectious Simian virus 40-based shuttle vector to analyse UV-induced mutagenesis in monkey cells Concepcib Lnhoratoty

ofh4olecular

Hera

**I,

Genetics, Institut

Received 27 February

Catherine Madzak *, Alain Sarasin de Recherches Scientijiques

SW Ie Cancer, 94801 Villeju(f:

Fmncr

1996: revised 25 June 1996: accepted 7 August 1996

Abstract SV40 based shuttle vectors able to be packaged as pseudovirions have been used either as naked DNA or as pseudovirus to analyse the mutation frequency and the UV-induced mutation spectra obtained after transfection or infection of COS7 monkey cells. The frequency of supF spontaneous mutants was similar whatever the state of the vector, indicating that the transfection step is not responsible for the high spontaneous mutation frequency when using shuttle vectors. Nevertheless the UV-induced mutation frequency of the supF gene was higher when transfected DNA was replicated into COS7 cells than when pseudovirus infection was performed. The UV induced mutation spectra was basically similar in both situations but a new hot-spot at nucleotide 110 was obtained after pseudovirus infection. UV-pretreated and control COS7 cells were infected with untreated or UV-damaged nSVPC7 shuttle virus and the survival and the supF mutation frequency were analysed in the progeny. The survival of UV-damaged pseudovirus replicated in IO J/m’ UV-pretreated cells was 2-fold higher than in untreated cells. This increase in the survival was accompanied by a slight enhancement in the number of supF - mutants. ~e~wrds:

Infectious

shuttle vector: Naked DNA; Mutagenesis;

SOS mammalian

1. Introduction Many

physical

used to analyse

and chemical molecular

mutagens

mechanisms

have been

of mutagene-

* Corresponding author. Departamento de Genttica. Universidad de C6rdoba. Avda. San Albert0 Magno s/n, E- 1407 1 CBrdoba. Espatia. Tel.: 57-21 86 01; Fax: 57-21 86 06; E-mail: [email protected] ’ Present address: Department0 de Genttica. Universidad de Cbrdoba, C6rdoba. Espaiia. ’ Present address: Laboratory of Genetics, INRA, Centre de Biotechnologies Agro-industrielles, F- 78850 Thiverval-Grignon. France. 0921-8777/96/$15.00 PII

SO92

Copyright

I -8777(96)00039-O

cc]]: UV

sis in mammalian cells. Among them UV at 254 nm has been extensively used. Specificity of UV-induced mutagenesis in mammalian cells was shown [I] using SV40 as a probe. Since then data have been reported using shuttle vectors, showing that the mutations are essentially located in front of potential UV-induced DNA lesions [2-51. Nevertheless the spontaneous mutation frequency was much higher than that obtained with the SV40 system or with endogenous genes [6]. The high spontaneous mutation frequency seemed to be independent of the transfection method used, the bacterial methylation pattern on the transfected vector or the cell line to be transfected [7]. These results suggested that the pro-

0 1996 Elsevier Science B.V. All rights reserved.

236

C. Hera et al. /Mutation Research 364 f 19961 235-243

cess of DNA transfer, from outside the cell to the replication site in the nucleus, seemed a likely cause of the mutations. To avoid these difficulties, virus 40-based shuttle vectors able to be packaged as pseudovirions were developed [8]. They can be propagated by infection, allowing their transmission to fresh cell cultures as a viral genome so that DNA entering the cells is protected by the viral chromatin and capsid structures. To analyse the importance of the transfection step on the mutation frequency, spontaneous and UV-induced mutagenesis on naked SV40 DNA and SV40 virus has been compared [9], obtaining similar mutation rates with the two methods. Experiments performed with shuttle viruses which can be used either as a shuttle vector or as a pseudovirus could help to understand the high mutation rates when using shuttle vectors. The possible existence of SOS responses in mammalian cells has been investigated, since years, using animal viruses as a probe. Although it is clear that a SOS response analogous to the RecA-dependent one in E. coli, does not happen as such in mammalian cells, DNA damage in mammalian cells induces a stress response, leading to alterations in gene expression and metabolism [lo]. This stress response might also have an effect on DNA repair and mutagenesis. The pretreatment of mammalian cells with DNAdamaging agents, before infection results in an enhancement of virus survival over that observed in untreated cells. Although this enhancement of survival is often accompanied by an enhancement of mutagenesis, this correlation has not been observed in all systems [l l-14,10,15,16]. Experiments performed with untreated SV40 [ 17,141 did not exhibit a significantly increased mutation frequency in UV or carcinogen-treated cells, while a small amount of untargeted mutagenesis has been reported by others [ 18,l 1,121. Untargeted mutagenesis in MNNG pretreated monkey cells using undamaged pZ189 DNA has been reported [19], showing that the spectrum of mutations induced differs from that of spontaneous and targeted mutations. By using fluctuation analysis, it was found [20] that DNA crosslinks induced by PUVA results in an enhancement of the mutation rate in the progeny of a treated mouse T lymphoma cell line, which persisted until the eleventh generation after treatment. Molecular analysis revealed that 53% of the point mutations in that study occurred at

positions which were not targets for light-activated psoralen. Since the non-targeted mutagenesis happens at what should be undamaged sites in DNA, it differs from targeted mutagenesis and is usually considered to be the result of error-prone DNA replication. These results suggest the existence of untargeted mutagenesis as a stress-response induced in mammalian cells. Our study has been performed in order to validate the use of the 7rSVPC7 shuttle virus as a probe to study mutagenesis in mammalian cells by (a) comparing the mutation frequencies and the spectra obtained using either DNA transfection or viral infection with ITSVPC~ shuttle virus, and (b) analysing the effect of the UV-pretreatment of the cells before infection of UV-damaged nSVPC7 virus.

2. Materials

and methods

2.1. Plasmid and G-us preparation The plasmid used, rSVPC7, is the same construction as aSVPC13 [21] with differences in the polycloning site; it carries the supF tRNA gene sequence which was employed as target of mutagenesis. It also contains the VPl, VP2 and VP3 genes from SV40 which allow the plasmid to be encapsidated as a virion. The viral stocks were prepared from the cell cultures 12 days after transfection of COS7 monkey cells [4].

2.2. Cells and bacterial strains COS7 monkey cells [22] were grown in Dulbecco’s modified Eagle’s medium supplemented with 7% fetal calf serum and antibiotics. The E. coli strain MBM7070 [23] was used for the screening of supF_ mutants among ITSVPC~ plasmid progeny. The supF gene is able to abolish the effect of an amber mutation in the 1acZ gene of MBM7070 indicator bacteria. Bacterial transformants containing plasmids with a mutated supF gene can therefore be isolated as white or light blue colonies, in a background of bright blue bacterial colonies on indicator plates.

137

C. Hero et ul. /Mutation Research 364 ( 1996) 235-243

2.3. DNA transfection,

LGrus infection

and plasmid

recovery

DNA was transfected into COS7 cells using the DEAE-dextran technique [24]. Viral infection was performed by incubating the cells for 2 h at 37°C with viral stocks previously diluted 20-fold in phosphate/saline buffer with 2% fetal calf serum. Extrachromosomal DNA was recovered from transfected or infected cells by a small-scale alkaline lysis procedure adapted from previously described methods [25].

DNA sequencer (Applied Biosystem) cols recommended by the supplier.

with the proto-

3. Results and discussion 3. I. Comparison duced

of spontaneous

mutagenesis

rrSVPC7

on naked

and ultraGolet-inTSVPC~

DNA and

virus

57SVPC7 virus or DNA plasmid was irradiated under a germicidal lamp (wavelength mainly 254 nm) with fluences of O-2000 J/m’ and O-1000 J/m’, respectively. Pretreatment of cells was performed 24 h before infection at doses of O-10 J/m’. Extrachromosomal DNA was recovered from cells 72 h after transfection or infection, digested with DpnI in order to remove input DNA (only for the case of transfection) and shuttled to MBM7070 strain. Transformants were plated in the presence of chloramphenicol, X-Gal and IPTG. The mutation frequency was defined as the ratio of white or light blue colonies (containing supF_ plasmid) to the total amount of bacterial colonies obtained. The supF gene from the mutant colonies was amplified by PCR with FM 10 primer (5’-CTAGTTCGATGATTAA-3’) and FM8b primer (S-GAGTTGGTAGCTCTTG-3’) and sequenced with the automated chain elongation termination method using the 373A

The extrachromosomal DNA was extracted and quantified 3 days after DNA transfection or pseudovirus infection of COS7 cells. The amount of plasmid DNA was determined by shuttling to strain MBM7070 and counting the total number of chloramphenicol resistant colonies, and by hybridization experiments. The replication of rrSVPC7 vectors in COS7 cells appeared to be very efficient yielding a high copy number of vector per cell. In Fig. 1A each lane contains one fiftieth (30 ng) of a DNA preparation from one confluent cell culture dish. As it has been shown [8] the large amount of plasmid obtained is probably due to the formation of virus particles, allowing the vectors to be transferred from the infected cells to the rest of the population. The treatment with the enzyme DpnI shows that transfected DNA was completely replicated 24 h after transfection (Fig. 1B). The results summarised in Table 1 show that the spontaneous mutation frequencies are in the same range after DNA transfection or viral infection using the same genetic assay. That could mean that the transfection step alone is not responsible for the high mutation frequency observed when using shuttle vec-

Table 1 Spontaneous

DNA transfection

2.4. Experimental

procedure

and UV-induced

mutation frequencies

UV dose (J/m”) Transfection

Infection

Each category

represents

following

No. of mutants/ total colonies

aSVPC7

Mutation frequency

or pseudovirus

infection of COS7 cells Induced mut. freq./ spontaneous mut. freq.

0

5/5850

0.85 x 10-s

_

500 1000

31/4500 155/4250

6.80 x 10-s 36.50 x IO-’

8 43 _

0

145/94122

1.55 x 10-j

500 1000 2000

78/14899 66/8220 45/1812

5.23 x 10-j 8.02 x lo-’ 24.83 X lo-?

2-4 independent

experiments,

3 5 16

C. Hera et al. /Mutation

238

A

1

B

2

-O+h

-

24 h +

Form

II

Form

I

Fig. 1. DNA replication of T~SVPC~ in COS7 cells. (A) Extrachromosomal DNA was extracted 72 h after infection (1 and 2 are two independent experiments). (B) Extrachromosomal DNA was extracted from cells harvested 0 h and 24 h after transfection and treated (+ ) or not (- ) with DprzI. DNA was analysed by Southern blotting using ” P-labelled SV40 as a probe.

tots. The frequency of spontaneous supF mutants after nSVPC7 infection was slightly higher (1.55 X 10-3/0.85 X lo- 3, than the spontaneous mutation frequency obtained when DNA was transfected into COS7 cells. This frequency might result from the addition of the supF mutations already present in the viral stocks, fixed from their initial transfection, plus the spontaneous mutations originated from ulterior virus infection. It was found [9] that the spontaneous mutation frequency was similar after replication of SV40 naked DNA in CVlP cells and after replication of virus, concluding that the transfection step is not directly responsible for the higher mutation frequency when using shuttle vectors. They argued that in vitro constructed shuttle vectors can be less adapted to their host cells. It has been shown that different rates of spontaneous mutation frequencies in the supF gene depends on the structure of the shuttle vector: 2.3 X 10 -’ supF_ mutants were obtained when using PCF3A to transfect COS7 cells [5], 0.6 X IO-’

Research 364

(I 996) 235-243

supF_ mutants were obtained after infection of COS7 cells with the shuttle virus nSVPC3 [4] and a frequency of 4.3 X lo-’ supF_ mutants was obtained after replication of PZ189 in CVl P cells 1261. After UV irradiation (Table 1) the mutation frequency increased to different extents when naked DNA or pseudovirus were irradiated. A dose of 1000 J/m’ produced an enhancement of 43-fold over the spontaneous mutation frequency in plasmids recovered after replication of naked DNA. The same dose led only to a 5-fold increase in the experiments using irradiated pseudovirus. Nevertheless the survival was similar after DNA transfection or viral infection: a dose of 1000 J/m’ decreased the recovery of plasmids to 10% of the unirradiated value (data not shown). Our results are not consistent with those previously reported [9] showing that the UV-induced mutation frequency was in the same order of magnitude for the experiments using SV40 naked DNA and SV40 virus, whereas the survival was higher after DNA transfection than after virus infection. Nevertheless the experiments using SV40 present an important difference compared to those using shuttle virus: the SV40 naked DNA was purified from a SV40 virus preparation and the naked DNA. in experiments with shuttle vectors, was obtained as a plasmid preparation from bacteria. As physiological base modifications occurring in bacteria or in mammalian cells are quite different, it is possible that the mechanism of repair of COS7 cells would originate some differences acting upon the two DNAs. Moreover. the effect of the UV-irradiation on the two kinds of molecules could be different as a consequence of the state of the DNA molecule in both cases: naked DNA and DNA protected by the viral proteins. In this case we would expect some differences in the mutation spectra after DNA transfection and pseudovirus infection. Finally, the transfection protocol is known to induce a stress to the treated cells, which can already affects the cellular response to the UV-irradiated target.

3.2. W-induced

.spectra

After passage of UV-irradiated pseudovirus through COS7 cells, plasmids with mutation in the supF gene were purified and characterised by se-

C. Hera et al. /Mutation

Rrsrarch

those with multiple mutations (2 or more base substitutions more than 2 bases apart). The results obtained with UV-irradiated pseudovirus are shown in Fig. 2 in comparison with those from the transfection experiments previously performed [27] with the PCF3A shuttle vector, also carrying the supF gene. The classes of mutations recovered after DNA transfection or pseudovirus infection are similar. We only found differences in relation to deletion mutants. 16% of mutants analysed from the pseudovirus infection experiments had deletions with a size from 24 to 143 bp. Probably they are spontaneous mutants that are recovered after infection with UV-irradiated pseudovirus since the lowest dose ( 1000 J/m’ 1 produced an increase in 5-fold over the spontaneous rate. So, we could expect 20% of these mutants arising from spontaneous events. In contrast. only 4% of the mutants with naked DNA belong to this class [27]. Two of the independent mutants from the infection experiments had a deletion from nucleotide - 14 to nucleotide 129 with a flanking region that produce a hairpin structure. Two other independent mutants had a deletion in the promoter region, from nucleotide - 36 to nucleotide - 12. The Fig. 2 compares the UV-induced mutation spectra following virus infection (our results) and naked DNA transfection [27]. In both spectra the

Table 2 Classification of the types of mutations recovered after DNA transfection or pseudovirus infection with UV-irradiated shuttle vectors Transfection Number of independent plasmids sequenced

mutant

a

Infection ’ 29 (1007c,,

24 f 100%)

Number of mutants carrying: Deletions

I (4%)

Point mutations Frameshifts Substitutions _ single base tandem _ multiple

5’

(17%)

23 (96%) _

24 _

23 16 5 3

24 (100%) 15 (63%) 6 (25%) 3 fl?%c)

a Data from Madzak et al. [27]. h UV-dose to nSVPC7 (number J/m’ (5). 2000 J/m’ (19). ’ Deletions from 24 to 143 bp.

f lOO%f (67%) (21%) (12%)

of plasmids

(83%)

sequenced):

239

364 (1996) 235-243

1000

quence analysis. The classes of mutations found are shown in Table 2. The results were obtained from the sequence of 29 independent mutant plasmids. We distinguish three major classes of plasmids with point mutations: those with single-base changes, those with tandem mutations (2 or 3 base substitutions O-2 bases apart, or 3 adjacent base substitutions) and

A A A A

A

T 70 I

C EcI I

A A

T T

TA TA

A H 100 I

90 I

AGGGAGCAGACTCTAAATCTGCCGTCAfCGACrrCGAAGG~ A T

A T

AA AI A A A

aA 110 I

C& 1

n

T 120 I

130 I

140 I

T E! T

TG

T T T

Fig. 2. Location of single and tandem base substitution mutations found in the acpF gene of UV-irradiated nSVPC7 pseudovirus replicated in COS7 cells (bottom) and in the supF gene of UV-irradiated PCF3A DNA replicated in COS7 cells (top). Underlined bases indicate tandem mutations. Data with PCF3A are from Madzak et al. [37]. Only independent mutants are represented.

240

C. Hera et al. /Mutation

mutation hot-spots at nucleotide 98 were observed but we obtained a new hot-spot at nucleotide 110 with the viral infection protocol. This mutation is located at the 3’ nucleotide of the pair 5’TC3’ in the sequence 5’TCCTY. By using the supF gene as a target the nucleotide 110 was also a hot-spot of UV-induced spectra in some DNA repair proficient human cell lines or in different xeroderma pigmentosum group cell lines [28-301, CS cells, AT cells and TTD cells [31-331 and also arose spontaneously or after treatment with different genotoxic agents [26]. Moreover, the same sequence is a UVC-induced hot-spot in the eukaryotic APRT gene and in the T antigen gene of simian virus 40 [34,91. By using the supF as a target in a single strand shuttle vector [27], the nucleotide 110 was not a UV-induced mutation hot-spot (the strand present in the single-stranded plasmid had the sequence 5’AGGA3’ at this position). Our results obtained after infection of the pseudovirus 7rSVPC7 in comparison with those from naked DNA [27], suggest that the sequence 5’TCCTY is an important hot spot for UV-damage but that the structure of the DNA target could be important in order to fix the mutation. It has been reported [35] that the pattern of mutagenesis of a given gene may not be identical in different cells or even in the same cells under different conditions. Thus, the fact that the infectious viruses are protected by proteins could, indeed, modify the cellular response as compared to the DNA transfection protocol. Moreover, it was found [36] that some p53 positions that are frequently mutated in human skin cancers, were repaired more slowly than the surrounding positions on the same strand. Thus, the mutation frequency depends not only on initial damage frequency, but also on the repair rate for each individual lesion. In conclusion we found similar high spontaneous mutation frequency when using viral infection or DNA transfection and that is consistent with the suggestion that the transfection step alone is not responsible for the high mutation frequency observed when using shuttle vectors [9]. Viruses have been subjected to a co-evolution process together with the organisms they infect and they probably have selected a genetic organization (GC content, avoidance of particular secondary structures or DNA sequences) adjusted to the cellular machinery to opti-

Research 364 C19961 235-243

mize their stability and recognition by cellular enzymes. In contrast, the in vitro constructed shuttle vectors or viruses can be less adapted to their host cells. The differences found in the UV-induced mutation frequency between transfected DNA and infected pseudovirns, and the existence of a new hotspot in the UV spectrum with the infected virus could indicate a difference in the way cellular machinery processes lesions, depending on the structure of DNA (naked or as mini-chromosome). 3.3. Effect of the cell pretreatment on the recover) and mutation frequency of the UV-irradiated virus after replication in COS7 cells To determine the effect of UV treatment on the ability of COS7 cells to repair or mutagenize the UV-damaged rSVPC7, monkey cells were irradiated with 5 or 10 J/m’ 24 h before pseudovirus infection. Three days after infection, plasmid DNA was isolated and the rSVPC7 survival and the frequency of supF mutants were measured. The results indicated that the recovery of non-irradiated pseudovirus from COS7 cells treated with 5 and 10 J/m2 was lower than from non-irradiated cells (53% and 32% of the non-irradiated cells, respectively, data not shown). Nevertheless, the survival of irradiated pseudovirus was higher after infection of preirradiated cells compared to the control cells. In fact, there was

Table 3 Effect of UV pretreatment of cells on the survival of pSVPC7 and on the frequency of mutants supF-. UV to cells/UV (J/m’)

to virus

Survival (%)

Mutation frequency

O/O O/l000 o/2000

100.0 6.0 2.0

1.56X IO-’ 7.76~ 10-j 19.90x to-’

5/O 5/1000 5/2000

100.0 9.0 I.0

1.35x lo-’ 11.38X lo-’ 22.50x lo-’

IO/O 10/1000 IO/2000

100.0 13.0 7.0

1.61 x IO-’ 15.74x lo--\ 10.47x lo-.<

Each category cells.

represents

3 independent

infections

into COS7

241

C. Hera et al. /Mutation Research 364 (1996) 23.5-243 Table 4 Classification of the type of point mutations recovered infection of untreated and UV-pretreated COS7 cells

after virus

UV dose to cells (J/m’)

Substitutions single base tandem multiple

0

5

IO

24 (100%) 15 (63%) 6 (25%) 3 (12%)

20 (100%) 10 (50%) 2 (10%) 8 (40%)

20 (100%) 12 (60%) 6 (30%) 2 (10%)

an increase (6% to 13%) in the survival of irradiated (1000 J/m2) pseudovirus when replicated in preirradiated cells (10 J/m’) compared to control cells (Table 3). These results are in agreement to those obtained in experiments with SV40 [12,17,13,14]. It has been shown that the treatment of mammalian cells with carcinogens before infection enhances the replication of UV-damaged SV40 viral DNA [37,38]. Alterations in the way cells processes damages or replicate damaged templates could affect plasmid survival. It has been suggested [39] that the enhanced host cell reactivation of viruses, may be due, at least in part, to the enhancement of the excision repair. The irradiation of the host cells gave rise to a slight increase in the frequency of mutation (15.8 X 10e3 compared to 7.8 X 10-3) when cells treated

with 10 J/m’ were infected with damaged pseudovirus (1000 J/m’> compared to untreated cells. No increase was observed when pseudovirus were irradiated with 2000 J/m* (Table 3). To determine whether the UV pretreatment promotes a change in the mechanism of damage-directed mutagenesis, we analysed the supF_ mutants generated in pretreated cells after infection with UV-damaged pseudovirus. The characteristics of the mutations were compared with those of UV-mutations generated in non-pretreated cells (Table 4). We found that most of mutations were either single base substitutions (60%) or tandem substitutions (30%) when cells were preirradiated with 10 J/m’, but 40% of the mutations were multiple base substitutions when cells were irradiated with 5 J/m’. Nevertheless the number of mutants analysed is not sufficient to give a definitive conclusion. The types of UV-induced mutation and sequence specificity in our study in UV-treated cells (Tables 4 and 5) did not differ from those found to occur in control cells. The spectra of single and tandem mutation generated by replication of the UV-irradiated pseudovirus in pretreated cells (5 and 10 J/m2) are drawn in Fig. 3. The comparison with those induced in non-treated cells (Fig. 2) indicate that there is no significant differences between them although the hot-spot at nucleotide 110 is not found in pre-irradiated cells.

A T -10 I

0 I

10 I

a I

ATTAb 33 I

40 I

50 I

60 I

TTGATATGATGCGCCCCGC~CCCGATAAGGGGAGGC AA

Fig. 3. Location of single and tandem base substitution mutations found in the supF gene of UV-irradiated pSVPC7 pseudovirus replicated in preirradiated COS7 cells. Cells were preirradiated 24 h before infection with 5 J/m’ (bottom) and 10 J/m* (top). Underlined bases indicate tandem mutations. Only independent mutants are represented.

242

C. Hera et al. /Mutation

Table 5 Types of base substitution replicated in non-irradiated,

mutations in UV-treated pseudovirus 5 J/m? and 10 J/m? irradiated cells.

Number of base changes (%) Non-irradiated

5 J/m’

Transitions G:C > A:T A:T>G:C

25 25 0

(64) (64)

21 21 0

Transversions G:C>T:A G:C>C:G A:T>T:A A:T>C:G Total

14

(36)

11

(34)

8 2

(21) (5) (10)

6

(19) (3) (12)

” UV J/m? h UV J/m’ ’ UV J/m’

4 0 39 iI (100)

I

10 J/m? (66) (66)

4 0 32 b (100)

dose to virus (number of base substitution (9). 2000 J/m’ (30). dose to virus (number of base substitution (121, 2000 J/m’ (21). dose IO virus (number of base substitution (10). 2000 J/m’ (18).

23 21 2

(82) (75)

5 3

(18) (11)

I 1 0 28

(7)

(3.5) (3.5) (100)

mutations):

1000

mutations):

1000

mutations):

1000

Although our results do not allow to conclude about such a possible SOS response in mammalian cells, the pretreatment of COS7 cells with UV leads to an enhancement of the recovery of the UV damaged pseudovirus and to a slight increase in the UV induced supF mutants frequency. This increase may be due to a better bypass of UV-lesions giving rise to a higher plasmid survival, but probably not linked to a new molecular process since the types of induced mutations are not different from those found in untreated cells.

Acknowledgements We are indebted to Professor C.F.M. Menck (Sao Paulo University, Sao Paulo, Brazil) for constructing the rrSVPCl3 vector and for helpful discussion. During this work C. Hera had a post-doctoral fellowship from MEC (Espafia). Part of this work was subsidized by EC contract EVSV-CT91-0012.

References [l] Bourre, F. and A. Sarasin (1983) Targeted mutagenesis SV40 DNA induced by UV light, Nature, 305, 68-70.

of

Research 364 (19961235-213 [2] Razzaque. A., H. Mizusawa and M.M. Seidman (1983) Rearrangement and mutagenesis of a shuttle vector plasmid after passage in mammalian cells. Proc. Natl. Acad. Sci. USA, 80. 3010-3014. [3] Calos, M.P.. J.S. Lebkowski and M.R. Botchan (1983) High mutation frequency in DNA transfected into mammalian cells. Proc. Natl. Acad. Sci. USA, 80. 3015-3019. (41 Menck. C.F.M., C. Madzak, G. Renault, A. Margot and A. Sarasin (1989) SV40-based shuttle viruses, Mutation Res., 220, 101-106. [5] Madzak, C. and A. Sarasin (1991) Mutation spectrum following transfection of ultraviolet-irradiated single-stranded or double-stranded shuttle vector DNA into monkey cells, J. Mol. Biol., 218. 667-673. [6] Sarasin. A. (1989) Shuttle vectors for studying mutagenesis in mammalian cells. J. Photochem. Photobiol., 3, 143-155. [7] Du Bridge. R.B. and M.P. Calos (1988) Recombinant shuttle vectors for the study of mutation in mammalian cells, Mutagenesis. 3. l-9. [8] Menck, C.F.M.. A. Sarasin and M.R. James (1987) SV40based Escherkhiu coli shuttle vectors infectious for monkey cells, Gene, 53, 2 1-29. [9] Bourre, F.. A. Lichtenberger and A. Sarasin (I 99 1) Comparison of spontaneous and ultraviolet-induced mutagenesis on naked SV40 DNA and SV40 virus, Mutation Res., 250, 49-53. [lo] Sarasin, A. (1985) SOS response in mammalian cells, Cancer Invest.. 3(2), 163-174. [ll] Cornelis. J.J., J.H. Lupker and A.J. van der Eb (1980) UV-reactivation. virus production and mutagenesis of SV40 in UV-irradiated monkey kidney cells. Mutation Res.. 7 I, 139- 146. [12] Taylor, W.D.. L.E. Bockstahler, J. Montes, M.A. Babich and C.D. Lytle (1982) Further evidence that ultraviolet radiation-enhanced reactivation of simian virus 40 in monkey kidney ceils is not accompanied by mutagenesis. Mutation Res.. 105. 291-298. [I 31 Gentil, A.. A. Margot and A. Sarasin (1982) Enhanced reactivation and mutagenesis after transfection of carcinogen-treated monkey kidney cells with UV-irradiated Simian virus (SV40) DNA, Biochimie, 64, 693-696. [ 141 Sarasin, A.. F. Bourre and A. Benoit (1982) Error-prone replication of ultraviolet-irradiated simian virus 40 in carcinogen-treated monkey kidney cells, Biochimie, 64. 8 I5821. [15] Sarasin. A. and A. Benoit (1986) Enhanced mutagenesis of UV-irradiated simian virus 40 occurs in mitomycin C-treated host cells only at a low multiplicity of infection. Mol. Cell. Biol., 6. 1102-l 107. [16] Roilides, E., P.J. Munson, AS. Levine and K. Dixon (1988) Use of a simian virus 40-based shuttle vector to analyze enhanced mutagenesis in Mitomycin C-treated monkey cells, Mol. Cell. Biol., 8. 3943-3946. [ 171 Sarasin. A. and A. Benoit (1980) Induction of an error-prone mode of DNA repair in UV-irradiated monkey kidney cells, Mutation Res., 70. 7 I-8 I. [18] Lytle. C.D., J.G. Goddard and C. Lin (1980) Repair and

C. Hera et al. /Mutatiorl Research 364 (1996) 235-243 mutagenesis of herpes simplex virus in UV-irradiated monkey cells, Mutation Res., 70, 139-149. [19] Zhang, X., Y. Yu and X. Chen (1994) Evidence for nontatgeted mutagenesis in a monkey kidney cell line and analysis of its sequence specificity using a shuttle-vector plasmid, Mutation Res.. 323, 105-l 12. [20] Boesen, J.J.B., S. Stuivenberg, C.H.M. Thyssens, H. Panneman, F. Darroudi, P.H.M. Lohman and J.W.I.M. Simons (19921 Stress response induced by DNA damage leads to specific, delayed and untargeted mutations, Mol. Gen. Genet., 234, 217-227. [21] Di Mascio, P., C.F.M. Menck. R.G. Nigro, A. Sarasin and H. Sies (1990) Singlet molecular oxygen induced mutagenicity in a mammalian SV40-based shuttle vector, Photochem. Photobiol., 51. 293-298. [22] Gluzman. Y. (1981) SV40-transformed simian cells support the replication of early SV40 mutants, Cell, 23, 175-182. [23] Seidman, M.M.. K. Dixon, A. Razzaque, R.J. Zagursky and M.L. Berman (1985) A shuttle vector plasmid for studying carcinogen-induced point mutations in mammalian cells. Gene. 38, 233-237. 1’2.41Wilson, J.H. (1978) Interference in SV40 DNA infections: a possible basis for cellular competence, Virology. 91, 380388. [25] Birnboim, H.C. and J. Doly (19791 A rapid alkaline extraction procedure for screening plasmid DNA, Nucleic Acids Res., 7. 1513-1523. 1261 Kraemer, K.H. and M.M. Seidman (19891 Use of supF, an Esrherichia di tyrosine suppressor tRNA gene. as a mutagenic target in shuttle-vector plasmids, Mutation Res.. 220. 61-72. [27] Madzak, C., J.B. Cabral-Neto, C.F.M. Menck and A. Sarasin (19921 Spontaneous and ultraviolet-induced mutations on a single-stranded shuttle vector transfected into monkey cells, Mutation Res., 274, 135-145. [28] Bredberg, A.. K.H. Kraemer and M.M. Seidman (1986) Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells, Proc. Natl. Acad. Sci. USA, 83, 8273-8277. [29] Seetharam, S., K.H. Kraemer, H.L.Waters and M.M. Seidman (1991) Ultraviolet mutational spectrum in a shuttle

[30]

[31]

[32]

[33]

1341

[35]

1361

[37]

1381

[39]

243

vector propagated in Xerodenna pigmentosum lymphoblastoid cells and fibroblasts, Mutation Res., 254, 97-105. Yagi, T., M Sato, J. Tatsumi-Miyajima and H. Takebe (1992) IJV-induced base substitution mutations in a shuttle vector plasmid propagated in group C Xeroderma pigmentosum cells, Mutation Res.. 273, 213-220. Parris, C.N. and K.H. Kraemer (1993) Ultraviolet-induced mutations in Cockayne syndrome cells are primarily caused by cyclobutane dimer photoproducts while repair of other photoproducts is normal. Proc. Natl. Acad. Sci. USA, 90, 7260-7364. Muriel, W.J.. J.R. Lamb and A.R. Lehmann (1991) UV mutation spectra in cell lines from patients with Cockayne’s syndrome and ataxia telangiectasia, using the shuttle vector pZ189, Mutation Res., 254. 119-123. Madzak, C.. J. Armier, A. Stary, L. Daya-Grosjean and A. Sarasin (19931 UV- induced mutations in a shuttle vector replicated in repair deficient trichothiodystrophy cells differ with those in genetically-related cancer prone xeroderma pigmentosum. Carcinogenesis, 14, 1255- 1260. Drobetsky, E.4.. A.J. Grosovsky and B.W. Glikman (1987) The specificity of UV-induced mutations at an endogenous locus in mammalian cells, Proc. Natl. Acad. Sci. USA. 84. 9103-9107. Seetharam, S., K.H. Kraemer, H.L.Waters and M.M. Seidman (1990) Mutational hotspot variability in an ultraviolettreated shuttle vector plasmid propagated in Xeroderma pigmentosum and normal human lymphoblasts and fibroblasts. J. Mol. Biol. 212, 433-436. Tornaletti. S. and G.P. Pfeifer (1994) Slow repair of pyrimidine dimers at p53 mutation hotspots in skin cancer, Science, 263. 1436-1438. Treger. J.M., J. Hauser and K. Dixon (19881 Molecular analysis of enhanced replication of UV-treated mammalian cells. Mol. Cell. Biol., 8, 2428-2434. Scaria, A and H.J. Edenberg (19871 Preirradiation of host (monkey) cells mitigates the effects of UV upon simian virus 40 DNA replication, Mutation Res., 183, 265-271, Protic. M., E. Roilides, A.S. Levine and K. Dixon (1988) Enhancement of DNA repair capacity of mammalian cells by carcinogen treatment. Somat. Cell Mol. Genet., 14, 351-357.