- Email: [email protected]
Using promoter replacement and selection for loss of heterozygosity to generate an industrially applicable sake yeast strain that homozygously overproduces isoamyl acetate
Journal of Bioscience and Bioengineering VOL. 108 No. 5, 359 – 364, 2009 www.elsevier.com/locate/jbiosc
Using promoter replacement and selection for loss of heterozygosity to generate an industrially applicable sake yeast strain that homozygously overproduces isoamyl acetate Hiroshi Sahara,1,⁎ Atsushi Kotaka,1 Akihiko Kondo,2 Mitsuyoshi Ueda,3 and Yoji Hata1 Research Institute, Gekkeikan Sake Co. Ltd., 101 Shimotoba-koyanagi-cho, Fushimi-ku, Kyoto 612–8385, Japan 1 Department of Chemical Science and Engineering, Graduate School of Engineering, Kobe University, 1–1 Rokkodai-cho, Nada-ku, Kobe, Hyogo 657–8501, Japan 2 and Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606–8502, Japan 3 Received 18 March 2009; accepted 7 May 2009
By application of the high-efficiency loss of heterozygosity (HELOH) method for disrupting genes in diploid sake yeast (Kotaka et al., Appl. Microbiol. Biotechnol., 82, 387–395 (2009)), we constructed, from a heterozygous integrant, a homozygous diploid that overexpresses the alcohol acetyltransferase gene ATF2 from the SED1 promoter, without the need for sporulation and mating. Under the conditions of sake brewing, the homozygous integrant produced 1.4 times more isoamyl acetate than the parental, heterozygous strain. Furthermore, the homozygous integrant was more genetically stable than the heterozygous recombinant. Thus, the HELOH method can produce homozygous, recombinant sake yeast that is ready to be grown on an industrial scale using the well-established procedures of sake brewing. The HELOH method, therefore, facilitates genetic modification of this rarely sporulating diploid yeast strain while maintaining those characteristics required for industrial applications. © 2009, The Society for Biotechnology, Japan. All rights reserved. [Key words: Sake yeast; Industrial diploid yeast; Alcohol acetyltransferase; Loss of heterozygosity; SED1 promoter; HELOH method]
Sake yeast is a diploid strain of Saccharomyces cerevisiae that was obtained by selective breeding under the severe conditions that arise during sake production (15 °C and 20% (v/v) ethanol). It exhibits a rapid growth rate, is stress resistant, and is highly tolerant of the ethanol that it is able to produce (1, 2). These features make sake yeast a very attractive microorganism for use as a host strain for bioconversion (3–5). Recombinant yeasts that can be used for bioconversion are usually obtained by the introduction of a new trait by transformation of a plasmid containing the necessary gene or by chromosomal integration of the necessary gene. Unlike transformation, chromosomal integration creates stable, industrially applicable strains that can be grown in the absence selective agents, without the risk of losing the new trait. In diploid yeasts, integration of an exogenous gene normally results in a relatively unstable heterozygous integrant, as loss of heterozygosity can occur (6). It is possible to obtain a homozygous mutant from a heterozygous integrant but only after comprehensive screening for increased copy number or stabilization of the acquired trait—a possibility if the modified strain exhibits improved performance under selective conditions. In general, homozygous yeast integrants are generated by mating haploids with the same trait (7) or by the integration of the exogenous gene into the wild-type allele of a heterozygous integrant by means of another selectable marker (8). However, breeding of homozygous, ⁎ Corresponding author. Tel.: +81 75 623 2130; fax: +81 75 623 2132. E-mail address: [email protected] (H. Sahara).
recombinant sake yeast by these approaches is difficult, since it rarely sporulates (9) and it generally lacks recessive traits that would enable multiple marker selection. We recently described a method for disrupting genes in diploid sake yeast, namely, the high-efficiency loss of heterozygosity (HELOH) method (10), by which homozygous sake yeast strains with multiple recessive traits can be constructed without sporulation and mating. As demonstrated in the present work, this method can also be applied to the breeding of homozygous integrants from diploid transformants in which an exogenous gene has been integrated into the chromosome heterozygously. Isoamyl acetate, which is synthesized from isoamyl alcohol and acetyl coenzyme A by alcohol acetyltransferase (AATase) in S. cerevisiae, is an important volatile flavor component in sake and wine. The ATF1 and ATF2 genes, which encode AATase I and AATase II, respectively, have been cloned from S. cerevisiae (11, 12) and then overexpressed in yeast for the purpose of brewing a beverage with a high flavor content (8, 13–16). These sake and wine yeast strains were constructed by transformation with plasmids containing ATF genes or by replacing the ATF1 promoter by targeted recombination, yielding heterozygous mutants. Atf2p has been reported to produce less isoamyl acetate and ethyl acetate than Atf1p (15). Since high levels of ethyl acetate can result in an unpleasant flavor in sake, we selected ATF2 for overexpression in this study. Overexpression of the ATF2 gene was driven by the promoter of the SED1 gene, which encodes for a cell wall protein and is induced during the middle to late growth stage during sake mash fermentation (17).
1389-1723/$ - see front matter © 2009, The Society for Biotechnology, Japan. All rights reserved. doi:10.1016/j.jbiosc.2009.05.002
360
SAHARA ET AL.
J. BIOSCI. BIOENG.,
TABLE 1. Yeast strains used in this study. Strains GKT1001 GKT1001U ATF-HET ATF-HOM
TABLE 2. PCR primers used in this study.
Genotype
Source
MATa/α ura3/ura3 lys2/lys2 (Derivative of Kyokai No.9 ⁎) MATa/α lys2/lys2 (GKT1001 harboring pRS406 vector) MATa/α lys2/lys2 URA3::PSED1::ATF2 / PATF2::ATF2 MATa/α lys2/lys2 URA3::PSED1::ATF2 / URA3::PSED1::ATF2
Ref. 10 This study This study This study
⁎ Obtained from the Brewing Society of Japan.
Diploid, homozygous sake yeast that overexpressed ATF2 under the control of the SED1 promoter was constructed from heterozygous integrants by the HELOH method. To examine the industrial utility of strains obtained by this method, the isoamyl acetate productivity and genetic stability of the homozygous integrant were compared to those of the heterozygous integrant. MATERIALS AND METHODS −
+ hsdR17(r− K12mK12),
Strains and media Escherichia coli strain DH5α [F ,endA1, supE44, thi-1,λ−, recA1, gyrA96, ΔlacU169 (φ80lacZΔM15)] (18) was used as the host strain for recombinant DNA manipulations. The S. cerevisiae strains used in this study are listed in Table 1. E. coli was grown in Luria–Bertani medium containing 10 g/l Polypepton, 5 g/l yeast extract, and 10 g/l sodium chloride and 100 mg/l ampicillin at 37 °C for 16 h. Yeast strains were cultivated aerobically at 30 °C in YPD containing 10 g/l yeast extract, 20 g/l Polypepton and 20 g/l glucose, or synthetic defined (SD) medium containing 6.7 g/l yeast nitrogen base without amino acids (Becton Dickinson and Company, NJ, USA), 20 g/l glucose and appropriate supplements. Uracil auxotrophic strains were selected for by growth in 5-fluoroorotic acid (5-FOA) medium containing 6.7 g/l yeast nitrogen base without amino acids, 20 g/l glucose, 1 g/l 5-FOA, 20 mg/l uracil (19) and appropriate supplements. Lysine auxotrophic strains were selected for by growth on α-aminoadipate(α-AA) medium containing 1.6 g/l yeast nitrogen base without amino acids and ammonium sulfate (Becton Dickinson and Company, NJ, USA), 20 g/l glucose, 2 g/l α-AA, 50 mg/l lysine HCl (20) and 20 mg/l uracil. Construction of heterozygous integrants As outlined in Fig. 1A, a fusion of URA3 and the SED1 promoter (URA3_PSED1), with appropriate flanking regions to direct replacement of the ATF2 promoter by homologous recombination, was synthesized by fusion PCR (21). The URA3 marker and SED1 promoter (PSED1) fragments were amplified by PCR (with primers URA3-F and URA3-R, and PSED1-F and PSED1-R, respectively; see Table 2) using pK112 (4) as a template. The two resulting DNA products contained mutual overlapping regions, and together they served as the template in a second round of PCR using two outer primers that had 30 bp overhangs homologous to the 5′ UTR (primer URA3_PSED1-F) and the coding region of ATF2 (URA3_PSED1-R), thus creating the complete product. DNA fragments were transformed into sake yeast by the lithium acetate method (22). Transformants were then selected for by growth on SD-U medium (SD medium with added 0.77 g/l CSM-URA; MP Biomedicals, Irvine, CA, USA).
Primer name URA3-F URA3-R PSED1-F PSED1-R URA3_PSED1-F URA3_PSED1-R LYS2-F LYS2-R PATF2-F PATF2-R cATF2-F cATF2-R
Primer sequence (5' → 3') ⁎ TATTGCGGGATAATGAGTAAACGAATTCAAACGTCTTCAATTCAT CGTTAATTTTCTATATCCAAGGTACCAGGGTAATAACTGA ATTATATCAGTTATTACCCTGGTACCTTGGATATAGAAAAT ATGTGGTTCGTATCCTTCTATATCTTCCATCCTTAATAGAGCGAA CTACATTGAACTCTGTAGGCCACCGATAAATATTGCGGGATAATG ATGGCCACGGTCTATCAACTCTTGAGTGATATGTGGTTCGTATCC gcggacgtcCACTTGCAATTACATA (AatII) CTGCACGTGATTTACAGTTCTTATTCAATA gggaagcttACGTCAGAAAAAGCAATATATAGTAA (HindIII) gggtctagaAATTAACCTGGACAATTTTTATTGCT (XbaI) CTACATTGAACTCTGTAGGCCACCGATAAA ATCCACTGACACCGTCGGAGCCGCAGTGGT
⁎ Non-annealing tail sequences are in lowercase; priming sequences are in uppercase. Restriction sites for enzymes shown in parentheses are underlined.
Construction of homozygous strains from heterozygous integrants Plasmid pPATF was used to “mark” the wild-type ATF2 allele by LYS2 integration (Fig. 1B). To construct pPATF, the URA3 containing AatII–NaeI region of plasmid pRS406 (Stratagene, La Jolla, CA, USA) was substituted with LYS2 (amplified off of S. cerevisiae chromosomal DNA by PCR with primers LYS2-F and LYS2-R), and approximately 600 bp of the S. cerevisiae ATF2 promoter (amplified with primers PATF2-F and PATF2-R) was inserted in between the HindIII and XbaI sites. pPATF that had been linearized by EcoRI digestion was transformed into ATF-HET (Table 1) by the lithium acetate method (22), and transformants were selected on SD-UK (SD medium containing 0.72 g/l CSM-LYS-URA; MP Biomedicals, Irvine, CA, USA) plates. To test for subsequent loss of LYS2, strains were cultured in YPD medium for 3 days at 30 °C and then plated on α-AA agar medium for 7 days at 30 °C. As a control, GKT1001U, a uracil autotroph with wild-type ATF2 loci, was constructed by transformation of StuI-linearized pRS406 into strain GKT1001 (Table 1). Analysis of the upstream region of the ATF2 locus To test for the presence of recombinant DNA upstream of ATF2, yeast genomic DNA was isolated with an ISOPLANT kit (Nippon Gene Co., Ltd., Tokyo, Japan), and the regions upstream of ATF2 were amplified by PCR (with primers cATF2-F and cATF2-R) and visualized by agarose gel electrophoresis. Sake brewing test Mash for sake brewing consisted of 136 g of steamed rice, 43 g of koji, precultured yeast cells (OD600 of 250 U), 150 μl of 90% (v/v) lactic acid, and 392 ml of water. Mash was fermented at 15 °C for 21 days. The fermentation profile was monitored by measuring the loss of weight of the mash in conjunction with CO2 emission. After 21 days, the sake mash was centrifuged, and the general components of the resulting sake were analyzed by standard methods established by the National Tax Administration Agency (23). The levels of isoamyl acetate in sake were quantified by headspace gas chromatography (24). Genetic stability of heterozygous and homozygous PSED1::ATF2 strains A series of culture tubes with 5 ml YPD medium was inoculated with 103 cells of preculture of ATF-HET or ATF-HOM and then cultivated in YPD medium for 24 h at 30 °C with aeration. Cells were harvested, washed twice with sterile distilled water, and then
FIG. 1. DNAs used for construction of homozygous PSED1::ATF2 integrants. (A) The URA3_PSED1 DNA fragment for replacement of the ATF2 promoter was synthesized by fusion PCR (see Materials and methods). PCR fragments with the URA3 marker or SED1 promoter (PSED1), and primers URA3_PSED1-F (primer-1) and URA3_PSED1-R (primer-2), are indicated. (B) Structure of plasmid pPATF used to “mark” the wild-type ATF2 allele with the LYS2 marker. The ATF2 promoter (PATF2), ampicillin resistance gene (Ampr), origin of replication in E. coli (ColE1 ori), and restriction sites used for cloning (XbaI, HindIII) or linearization (EcoRI) are indicated.
VOL. 108, 2009
CONSTRUCTION OF HOMOZYGOUS SAKE YEAST BY HELOH METHOD
361
FIG. 2. Schematic representation of the HELOH method used to construct homozygous PSED1::ATF2 integrants. White bars interrupted by two vertical wavy lines indicate homologous chromosome pairs. resuspended in sterile distilled water. Finally, 106 cells were plated on 5-FOA agar medium. Colonies were counted after incubation at 30 °C for 4 days. The remaining harvested cells were used to inoculate the next series of cultures.
RESULTS Construction of homozygous sake yeast integrants In order to obtain sake yeast with enhanced isoamyl acetate production during the latter stages of fermentation, a homozygous integrant was constructed in which both ATF2 genes encoding alcohol acetyltransferase were placed under the control of the promoter of SED1, a major cell wall protein expressed in the stationary phase (25). In the first
step of the HELOH procedure (10, see Fig. 2), a heterologous integrant was created by targeted integration of a DNA fragment, in which URA3 had been fused to the SED1 promoter (URA3_PSED1) and positioned directly upstream of ATF2, into parental strain GKT1001 (10). For subsequent conversion of the heterologous strain (ATF-HET) to a homozygous integrant (ATF-HOM) by loss of heterozygosity, the wildtype ATF2 promoter was “marked” with LYS2 by integration of linearized plasmid pPATF (Figs. 1B and 2). Due to its homology to the endogenous ATF2 promoter, linearized pPATF can recombine with the wild-type ATF2 upstream region but not the recombinant allele. The resulting strains were cultured on medium that selected against colonies that had lost LYS2 (ATF-HOM candidates). ATF-HOM
FIG. 3. Analysis of upstream regions of ATF2 loci by PCR. (A) Fragments predicted to be amplified from wild-type and recombinant alleles with primers cATF2-F (primer-1) and cATF-R (primer-2) and (B) the resulting fragments as obtained for GKT1001U (lane 1), ATF-HET (lane 2), and ATF-HOM (lane 3). The size markers (lane M) and fragments derived from wildtype and recombinant alleles are indicated.
362
SAHARA ET AL.
J. BIOSCI. BIOENG., TABLE 4. The number of 5-FOAr colonies after several subcultures in YPD. Number of subculture Strain ATF-HET ATF-HOM
Genotype ⁎
1
3
5
URA3::PSED1::ATF2 / PATF2::ATF2 URA3::PSED1::ATF2 / URA3::PSED1::ATF2
113 ± 11.3 n.d.
118 ± 10.8 n.d.
119 ± 11.2 n.d.
Data represent the mean and s.d. values of at least three independent experiments; n.d. indicates that no colonies were determined. ⁎ Only the locus where the URA3 marker is located in each strain is shown.
FIG. 4. Time courses of laboratory-scale sake brewing. Strains GKT1001U (squares), ATFHET (triangles) and ATF-HOM (circles) were assessed for net weight loss due to CO2 production (A) and for the production of isoamylacetate (B). Plots show the mean ± s.d. values of at least three independent experiments.
candidates consisted of cells that were homozygous for PSED1::ATF2 by LOH occurrence (ATF-HOM) as well as ATF-HET revertants (Fig. 2). As a control, GKT1001U, a uracil autotroph with wild-type ATF2 loci, was constructed from GKT1001 (Table 1). PCR analysis of ATF2 loci The regions upstream of ATF2 in the various integrants were analyzed by PCR as shown in Fig. 3. By using primers cATF2-F and cATF2-R (Table 2), fragments that were either 0.9 kb or 2.5 kb in length were amplified. The shorter fragment was amplified from the wild-type allele, and the longer was amplified from the recombinant allele (Fig. 3A). A single band of length 0.9 kb was obtained from PCR using GKT1001U genomic DNA as a template (Fig. 3B lane 1). On the other hand, PCR on genomic DNA from ATFHET strains yielded both 0.9 and 2.5 kb bands, indicating heterozygosity of the ATF2 promoter loci (Fig. 3B lane 2). Finally, PCR on
TABLE 3. Fermentation profiles in brewed sake with the integrants.
Sake meter Alcohol (v/v%) Total acids (ml) Amino acids (ml) Glucose (×10− 1 g/l) Isoamyl acetate (ppm)
GKT1001U
ATF-HET
ATF-HOM
+ 16 ± 0.00 22 ± 0.44 3.1 ± 0.050 2.1 ± 0.050 6.0 ± 0.12 7.8 ± 0.44
+ 16 ± 0.17 21 ± 0.57 2.9 ± 0.076 2.1 ± 0.029 5.2 ± 0.29 19 ± 0.98
+ 16 ± 0.12 21 ± 0.92 2.8 ± 0.029 2.3 ± 0.029 4.7 ± 0.42 27 ± 2.2
Data represent the mean and s.d. values of at least three independent experiments.
genomic DNA from 30% of ATF-HOM candidates resulted in a single band that was 2.5 kb in length, indicating successful homozygous promoter replacement by LOH occurrence (Fig. 3B lane 3). This result, therefore, confirmed these strains as ATF-HOM. PCR on the other 70% of the ATF-HOM candidates resulted in the same fragment pattern as seen for ATF-HET (data not shown), indicating that reversion to the parental heterozygous genotype by loop-out recombination of the LYS2-marker happened more frequently than conversion to ATF-HOM by LOH. Laboratory-scale sake brewing When compared in laboratoryscale sake brewing experiments, all three integrants, ATF-HET, ATFHOM and GKT1001U, were excellent fermenters and reached a final ethanol concentration of about 21% (v/v) (Fig. 4). After four days of fermentation, the concentration of isoamyl acetate was significantly higher in the ATF-HOM culture, especially in comparison to the wildtype strain (GKT1001U). The production of isoamyl acetate by ATFHOM also exceeded that by ATF-HET and peaked around day 14, corresponding to the period of SED1 promoter induction in sake mash (17). After complete fermentation, the final concentration of isoamyl acetate was 7.8 ppm in the sake generated by wild-type strain (GKT1001U), 19 ppm in the sake generated by the heterozygous integrant (ATF-HET), and 27 ppm in the sake generated by the homozygous recombinant (ATF-HOM). In sensory tests, none of the brewed sakes were identified as having the undesirable flavor related to ethyl acetate production (data not shown). As a result, ATF-HOM produced sake with an extremely fruity aroma and taste. In other aspects, such as CO2-emission, the fermentation profiles of these brewed sake yeasts did not differ (Fig. 4A and Table 3). Trait stability of heterozygous and homozygous integrants The genetic stability of the homozygous PSED1::ATF2 integrant (ATF-HOM) was compared to that of the heterozygous recombinant (ATF-HET) by monitoring the frequency of spontaneous loss of the URA3 marker in the first, third and fifth rounds of subculturing (see Materials and methods). As shown in Table 4, about 100 out of every 106 ATF-HET cells spread on selective plates became resistant to 5-FOA (5-FOAr), indicating a 10− 4 frequency of conversion to 5-FOAr. This number remained constant during propagation over at least five subcultures and is close to the frequency at which spontaneous LOH is reported to occur (6). Sequence analysis of the ATF2 locus of 5-FOAr colonies derived from ATF-HET demonstrated that these strains had reverted to the parental, wild-type GKT1001 (data not shown). In contrast to the heterozygous integrant, the homozygous integrant (ATF-HOM) did not form any revertants resistant to 5-FOA after loss of the URA3 marker, demonstrating superior genetic stability.
DISCUSSION By application of the HELOH method (10) on a heterozygous integrant obtained by targeted promoter replacement, we constructed a homozygous diploid sake yeast strain that overexpresses the alcohol acetyltransferase gene ATF2 from the SED1 promoter (Fig. 2). We used LYS2 to “mark” wild-type alleles by recombination with the ATF2 promoter region. By growing the resulting strains on α-aminoadipate, we were able to screen for loss of this marker, which would indicate
VOL. 108, 2009
CONSTRUCTION OF HOMOZYGOUS SAKE YEAST BY HELOH METHOD
either that the desired homozygous recombinant had been produced via loss of heterozygosity (LOH) or that the strain had reverted to the parental heterozygote by loop-out recombination. Of the resulting clones, 70% had reverted to the parental heterozygote. As LOH usually occurs with a frequency of less than 10− 4 (6), the 30% success-rate of the HELOH method demonstrates that this approach enabled us to obtain LOH strains relatively easily. It should be possible to obtain desired homozygous integrants even more efficiently by reducing the frequency of loop-out recombination events by optimizing the length of the integrative plasmid (pPATF). Under the conditions of sake brewing, isoamyl acetate production was increased by the overexpression of ATF2 using the SED1 promoter and strain GKT1001, derivative of Kyokai No.9, as a host cell (Fig. 4). Recently, it was reported that ATF2 did not show any effects upon isoamyl acetate production (26). However, in that report, a different regulatory region, the TDH3 promoter, was used to drive overexpression of ATF2 in a different host cell, strain Kyokai No.7. It is likely that the different host cell and promoter used in our present study are responsible for the contrasting effects of heterologous ATF2 expression on isoamyl acetate production. The homozygous recombinant (ATF-HOM) produced 1.4 times more isoamyl acetate than the heterozygous parent (ATF-HET, Table 3). We assume that the level of ATF2 expression in the homozygous integrant was higher because both SED1 promoters were fully active and led to strong induction of the two ATF2 genes. In the low temperature, long-term culture environment of sake brewing, the homozygous integrant produced high levels of ethanol and isoamyl acetate in the absence of selective pressure, thereby demonstrating its industrial usefulness. In the future, perhaps the brewing performance of ATF-HOM can be improved further by reintroduction of LYS2 as ATF-HOM has lys2 for counterselection of the wild-type promoter of ATF2. The genetic stability of the homozygous integrant was excellent. In contrast, the heterozygous integrant underwent spontaneous LOH at a frequency of about 10− 4 when grown in the absence of selective pressure (Table 4). This frequency, which hardly changed over several rounds of propagation, is comparable to LOH observed for heterozygous wine yeast as previously reported (27). Our sake brewing experiments (Fig. 4 and Table 3) show that overexpression of ATF2 and accumulation of isoamyl acetate do not impair the growth and ethanol production of the recombinant yeast strains. However, if the overexpressed protein were to become harmful or stressful for the host, it is possible that the frequency of reversion by LOH could increase. Therefore, the stability of genetic traits of heterozygous integrants must be regularly monitored and verified during industrial use. In the case of homozygous integrants, however, such ongoing control is not necessary. Recently, Saitoh et al. bred a homozygous wine yeast strain in which the multicopy BGL expression cassette was integrated by using two auxotrophic markers, spore formation and autodiploidization (28). Improvements in the production efficiency of useful compounds by genetic recombination in microorganisms are often achieved by increasing the copy number of the gene expression cassette. The HELOH method allows the easy construction of diploid, homozygous sake yeast strains with integrated multicopy expression cassettes, despite the fact that sake yeast rarely sporulates. In this study, we confirmed that the HELOH method is industrially useful for the construction of genetic recombinant microorganisms. We expect that this method can be applied to other diploid microorganisms as well. ACKNOWLEDGEMENT This work was supported in part by the Research and Development Program for New Bio-industry Initiatives of the Bio-oriented Technology Research Advancement Institution.
363
References 1. Kodama, K.: Sake-brewing yeast, in: AH Rose, JS Harrison (Eds.), The Yeasts, vol. 3, Academic Press, London United Kingdom, 1993, pp. 129–168 (1993). 2. Casey, G. P. and Ingledew, W. M.: Ethanol tolerance in yeasts, Crit. Rev. Microbiol., 13, 219–280 (1986). 3. Kotaka, A., Bando, H., Kaya, M., Kato-Murai, M., Kuroda, K., Sahara, H., Hata, Y., Kondo, A., and Ueda, M.: Direct ethanol production from barley β-glucan by sake yeast displaying Aspergillus oryzae β-glucosidase and endoglucanase, J. Biosci. Bioeng., 105, 622–627 (2008). 4. Kaya, M., Ito, J., Kotaka, A., Matsumura, K., Bando, H., Sahara, H., Ogino, C., Shibasaki, S., Kuroda, K., Ueda, M., Kondo, A., and Hata, Y.: Isoflavone aglycones production from isoflavone glycosides by display of β-glucosidase from Aspergillus oryzae on yeast cell surface, Appl. Microbiol. Biotechnol., 79, 51–61 (2008). 5. Tanino, T., Noguchi, E., Kimura, S., Sahara, H., Hata, Y., Fukuda, H., and Kondo, A.: Effect of cultivation conditions on cell-surface display of Flo1 fusion protein using sake yeast, Biochem. Eng. J., 33, 232–237 (2007). 6. Hiraoka, M., Watanabe, K., Umezu, K., and Maki, H.: Spontaneous loss of heterozygosity in diploid Saccharomyces cerevisiae cells, Genetics, 156, 1531–1548 (2000). 7. Saitoh, S., Mieno, Y., Nagashima, T., Kumagai, C., and Kitamoto, K.: Breeding of a new type of baker's yeast by δ-integration for overproduction of glucoamylase using a homothallic yeast, J. Ferment. Bioeng., 81, 98–103 (1996). 8. Fukuda, K., Yamamoto, N., Kiyokawa, Y., Yanagiuchi, T., Wakai, Y., Kitamoto, K., Inoue, Y., and Kimura, A.: Balance of activities of alcohol acetyltransferase and esterase in Saccharomyces cerevisiae is important for production of isoamyl acetate, Appl. Environ. Microbiol., 64, 4076–4078 (1998). 9. Suizu, T., Tsutsumi, A., Kawato, A., Murata, K., Suginami, K., and Imayasu, S.: Method for sporulation of industrially used sake yeast, J. Ferment. Bioeng., 81, 93–97 (1996). 10. Kotaka, A., Sahara, H., Kondo, A., Ueda, M., and Hata, Y.: Efficient generation of recessive traits in diploid sake yeast by targeted gene disruption and loss of heterozygosity, Appl. Microbiol. Biotechnol., 82, 387–395 (2009). 11. Fujii, T., Nagasawa, N., Iwamatsu, A., Bogoki, T., Tamai, Y., and Hamachi, M.: Molecular cloning, sequence analysis, and expression of the yeast alcohol acetyltransferase gene, Appl. Environ. Microbial., 60, 2786–2792 (1994). 12. Nagasawa, N., Bogaki, T., Iwamatsu, A., Hamachi, M., and Kumagai, C.: Cloning and Nucleotide sequence of alcohol acetyltransferase II gene (ATF2) from kyokai no, 7. Biosci. Biotechnol. Biochem., 62, 1852–1857 (1998). 13. Lilly, M., Lambrechts, M. G., and Pretorius, I. S.: Effect of increased yeast alcohol acetyltransferase activity on flavor profiles of wine and distillates, Appl. Environ. Microbiol., 66, 744–753 (2000). 14. Mason, A. B. and Dufour, J. P.: Alcohol acetyltransferases and the significance of ester synthesis in yeast, Yeast, 16, 1287–1298 (2000). 15. Verstrepen, K. J., Van Laere, S. D., Vanderhaegen, B. M., Derdelinckx, G., Dufour, J.P., Pretorius, I. S., Winderickx, J., Thevelein, J. M., and Delvaux, F. R.: Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad range of volatile esters, Appl. Environ. Microbiol., 69, 5228–5237 (2003). 16. Hirosawa, I., Aritomi, K., Hoshida, H., Kashiwagi, S., Nishizawa, Y., and Akada, R.: Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol, Appl. Microbiol. Biotechnol., 65, 68–73 (2004). 17. Wu, H., Zheng, X., Araki, Y., Sahara, H., Takagi, H., and Shimoi, H.: Global gene expression analysis of yeast cells during sake brewing, Appl. Environ. Microbiol., 72, 7353–7358 (2006). 18. Hanahan, D.: Studies on the transformation of Escherichia coli with plasmids, J. Mol. Biol., 166, 557–580 (1983). 19. Boeke, J. D., LaCroute, F., and Fink, G. R.: A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance, Mol. Gen. Genet., 197, 345–346 (1984). 20. Zaret, K. S. and Sherman, F.: α-Aminoadipate as a primary nitrogen source for Saccharomyces cerevisiae mutants, J. Bacteriol., 162, 579–583 (1985). 21. Kuwayama, H., Obara, S., Morio, T., Katoh, M., Urushihara, H., and Tanaka, Y.: PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors, Nucleic Acids Res., 30, E2 (2002). 22. Ito, H., Fukuda, Y., Murata, K., and Kimura, A.: Transformation of intact yeast cells treated with alkali cations, J. Bacteriol., 153, 163–168 (1983). 23. Brewing Society of Japan Tokyo: Annotation of the official analytical method of the National Tax Administration Agency of Japan, 4th edn (in Japanese) (1993). 24. Yoshizawa, K.: Rapid method for determining flavor components in sake by headspace gas chromatography, J. Sot. Brew. Jpn., 68, 59–61 (1973) (in Japanese). 25. Shimoi, H., Kitagaki, H., Ohmori, H., Iimura, Y., and Ito, K.: Sed1p is a major cell wall protein of Saccharomyces cerevisiae in the stationary phase
364
SAHARA ET AL.
and is involved in lytic enzyme resistance, J. Bacteriol., 180, 3381–3387 (1998). 26. Ano, A., Suehiro, D., Cha-Aim, K., Aritomi, K., Phonimdaeng, P., Nontaso, N., Hoshida, H., Mizunuma, M., Miyakawa, T., and Akada, R.: Combinatorial gene overexpression and recessive mutant gene introduction in sake yeast, Biosci. Biotechnol. Biochem., 73, 633–640 (2009).
J. BIOSCI. BIOENG., 27. Ramírez, M., Vinagre, A., Ambrona, J., Molina, F., Maqueda, M., and Rebollo, J. E.: Genetic instability of heterozygous, hybrid, natural wine yeasts, Appl. Environ. Microbiol., 70, 4686–4691 (2004). 28. Saitoh, S., Tanaka, T., and Kondo, A.: Breeding of industrial diploid yeast strain with chromosomal integration of multiple β-glucosidase genes, J. Biosci. Bioeng., 106, 594–597 (2008).
Using promoter replacement and selection for loss of heterozygosity to generate an industrially applicable sake yeast strain that homozygously overproduces isoamyl acetate Hiroshi Sahara,1,⁎ Atsushi Kotaka,1 Akihiko Kondo,2 Mitsuyoshi Ueda,3 and Yoji Hata1 Research Institute, Gekkeikan Sake Co. Ltd., 101 Shimotoba-koyanagi-cho, Fushimi-ku, Kyoto 612–8385, Japan 1 Department of Chemical Science and Engineering, Graduate School of Engineering, Kobe University, 1–1 Rokkodai-cho, Nada-ku, Kobe, Hyogo 657–8501, Japan 2 and Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606–8502, Japan 3 Received 18 March 2009; accepted 7 May 2009
By application of the high-efficiency loss of heterozygosity (HELOH) method for disrupting genes in diploid sake yeast (Kotaka et al., Appl. Microbiol. Biotechnol., 82, 387–395 (2009)), we constructed, from a heterozygous integrant, a homozygous diploid that overexpresses the alcohol acetyltransferase gene ATF2 from the SED1 promoter, without the need for sporulation and mating. Under the conditions of sake brewing, the homozygous integrant produced 1.4 times more isoamyl acetate than the parental, heterozygous strain. Furthermore, the homozygous integrant was more genetically stable than the heterozygous recombinant. Thus, the HELOH method can produce homozygous, recombinant sake yeast that is ready to be grown on an industrial scale using the well-established procedures of sake brewing. The HELOH method, therefore, facilitates genetic modification of this rarely sporulating diploid yeast strain while maintaining those characteristics required for industrial applications. © 2009, The Society for Biotechnology, Japan. All rights reserved. [Key words: Sake yeast; Industrial diploid yeast; Alcohol acetyltransferase; Loss of heterozygosity; SED1 promoter; HELOH method]
Sake yeast is a diploid strain of Saccharomyces cerevisiae that was obtained by selective breeding under the severe conditions that arise during sake production (15 °C and 20% (v/v) ethanol). It exhibits a rapid growth rate, is stress resistant, and is highly tolerant of the ethanol that it is able to produce (1, 2). These features make sake yeast a very attractive microorganism for use as a host strain for bioconversion (3–5). Recombinant yeasts that can be used for bioconversion are usually obtained by the introduction of a new trait by transformation of a plasmid containing the necessary gene or by chromosomal integration of the necessary gene. Unlike transformation, chromosomal integration creates stable, industrially applicable strains that can be grown in the absence selective agents, without the risk of losing the new trait. In diploid yeasts, integration of an exogenous gene normally results in a relatively unstable heterozygous integrant, as loss of heterozygosity can occur (6). It is possible to obtain a homozygous mutant from a heterozygous integrant but only after comprehensive screening for increased copy number or stabilization of the acquired trait—a possibility if the modified strain exhibits improved performance under selective conditions. In general, homozygous yeast integrants are generated by mating haploids with the same trait (7) or by the integration of the exogenous gene into the wild-type allele of a heterozygous integrant by means of another selectable marker (8). However, breeding of homozygous, ⁎ Corresponding author. Tel.: +81 75 623 2130; fax: +81 75 623 2132. E-mail address: [email protected] (H. Sahara).
recombinant sake yeast by these approaches is difficult, since it rarely sporulates (9) and it generally lacks recessive traits that would enable multiple marker selection. We recently described a method for disrupting genes in diploid sake yeast, namely, the high-efficiency loss of heterozygosity (HELOH) method (10), by which homozygous sake yeast strains with multiple recessive traits can be constructed without sporulation and mating. As demonstrated in the present work, this method can also be applied to the breeding of homozygous integrants from diploid transformants in which an exogenous gene has been integrated into the chromosome heterozygously. Isoamyl acetate, which is synthesized from isoamyl alcohol and acetyl coenzyme A by alcohol acetyltransferase (AATase) in S. cerevisiae, is an important volatile flavor component in sake and wine. The ATF1 and ATF2 genes, which encode AATase I and AATase II, respectively, have been cloned from S. cerevisiae (11, 12) and then overexpressed in yeast for the purpose of brewing a beverage with a high flavor content (8, 13–16). These sake and wine yeast strains were constructed by transformation with plasmids containing ATF genes or by replacing the ATF1 promoter by targeted recombination, yielding heterozygous mutants. Atf2p has been reported to produce less isoamyl acetate and ethyl acetate than Atf1p (15). Since high levels of ethyl acetate can result in an unpleasant flavor in sake, we selected ATF2 for overexpression in this study. Overexpression of the ATF2 gene was driven by the promoter of the SED1 gene, which encodes for a cell wall protein and is induced during the middle to late growth stage during sake mash fermentation (17).
1389-1723/$ - see front matter © 2009, The Society for Biotechnology, Japan. All rights reserved. doi:10.1016/j.jbiosc.2009.05.002
360
SAHARA ET AL.
J. BIOSCI. BIOENG.,
TABLE 1. Yeast strains used in this study. Strains GKT1001 GKT1001U ATF-HET ATF-HOM
TABLE 2. PCR primers used in this study.
Genotype
Source
MATa/α ura3/ura3 lys2/lys2 (Derivative of Kyokai No.9 ⁎) MATa/α lys2/lys2 (GKT1001 harboring pRS406 vector) MATa/α lys2/lys2 URA3::PSED1::ATF2 / PATF2::ATF2 MATa/α lys2/lys2 URA3::PSED1::ATF2 / URA3::PSED1::ATF2
Ref. 10 This study This study This study
⁎ Obtained from the Brewing Society of Japan.
Diploid, homozygous sake yeast that overexpressed ATF2 under the control of the SED1 promoter was constructed from heterozygous integrants by the HELOH method. To examine the industrial utility of strains obtained by this method, the isoamyl acetate productivity and genetic stability of the homozygous integrant were compared to those of the heterozygous integrant. MATERIALS AND METHODS −
+ hsdR17(r− K12mK12),
Strains and media Escherichia coli strain DH5α [F ,endA1, supE44, thi-1,λ−, recA1, gyrA96, ΔlacU169 (φ80lacZΔM15)] (18) was used as the host strain for recombinant DNA manipulations. The S. cerevisiae strains used in this study are listed in Table 1. E. coli was grown in Luria–Bertani medium containing 10 g/l Polypepton, 5 g/l yeast extract, and 10 g/l sodium chloride and 100 mg/l ampicillin at 37 °C for 16 h. Yeast strains were cultivated aerobically at 30 °C in YPD containing 10 g/l yeast extract, 20 g/l Polypepton and 20 g/l glucose, or synthetic defined (SD) medium containing 6.7 g/l yeast nitrogen base without amino acids (Becton Dickinson and Company, NJ, USA), 20 g/l glucose and appropriate supplements. Uracil auxotrophic strains were selected for by growth in 5-fluoroorotic acid (5-FOA) medium containing 6.7 g/l yeast nitrogen base without amino acids, 20 g/l glucose, 1 g/l 5-FOA, 20 mg/l uracil (19) and appropriate supplements. Lysine auxotrophic strains were selected for by growth on α-aminoadipate(α-AA) medium containing 1.6 g/l yeast nitrogen base without amino acids and ammonium sulfate (Becton Dickinson and Company, NJ, USA), 20 g/l glucose, 2 g/l α-AA, 50 mg/l lysine HCl (20) and 20 mg/l uracil. Construction of heterozygous integrants As outlined in Fig. 1A, a fusion of URA3 and the SED1 promoter (URA3_PSED1), with appropriate flanking regions to direct replacement of the ATF2 promoter by homologous recombination, was synthesized by fusion PCR (21). The URA3 marker and SED1 promoter (PSED1) fragments were amplified by PCR (with primers URA3-F and URA3-R, and PSED1-F and PSED1-R, respectively; see Table 2) using pK112 (4) as a template. The two resulting DNA products contained mutual overlapping regions, and together they served as the template in a second round of PCR using two outer primers that had 30 bp overhangs homologous to the 5′ UTR (primer URA3_PSED1-F) and the coding region of ATF2 (URA3_PSED1-R), thus creating the complete product. DNA fragments were transformed into sake yeast by the lithium acetate method (22). Transformants were then selected for by growth on SD-U medium (SD medium with added 0.77 g/l CSM-URA; MP Biomedicals, Irvine, CA, USA).
Primer name URA3-F URA3-R PSED1-F PSED1-R URA3_PSED1-F URA3_PSED1-R LYS2-F LYS2-R PATF2-F PATF2-R cATF2-F cATF2-R
Primer sequence (5' → 3') ⁎ TATTGCGGGATAATGAGTAAACGAATTCAAACGTCTTCAATTCAT CGTTAATTTTCTATATCCAAGGTACCAGGGTAATAACTGA ATTATATCAGTTATTACCCTGGTACCTTGGATATAGAAAAT ATGTGGTTCGTATCCTTCTATATCTTCCATCCTTAATAGAGCGAA CTACATTGAACTCTGTAGGCCACCGATAAATATTGCGGGATAATG ATGGCCACGGTCTATCAACTCTTGAGTGATATGTGGTTCGTATCC gcggacgtcCACTTGCAATTACATA (AatII) CTGCACGTGATTTACAGTTCTTATTCAATA gggaagcttACGTCAGAAAAAGCAATATATAGTAA (HindIII) gggtctagaAATTAACCTGGACAATTTTTATTGCT (XbaI) CTACATTGAACTCTGTAGGCCACCGATAAA ATCCACTGACACCGTCGGAGCCGCAGTGGT
⁎ Non-annealing tail sequences are in lowercase; priming sequences are in uppercase. Restriction sites for enzymes shown in parentheses are underlined.
Construction of homozygous strains from heterozygous integrants Plasmid pPATF was used to “mark” the wild-type ATF2 allele by LYS2 integration (Fig. 1B). To construct pPATF, the URA3 containing AatII–NaeI region of plasmid pRS406 (Stratagene, La Jolla, CA, USA) was substituted with LYS2 (amplified off of S. cerevisiae chromosomal DNA by PCR with primers LYS2-F and LYS2-R), and approximately 600 bp of the S. cerevisiae ATF2 promoter (amplified with primers PATF2-F and PATF2-R) was inserted in between the HindIII and XbaI sites. pPATF that had been linearized by EcoRI digestion was transformed into ATF-HET (Table 1) by the lithium acetate method (22), and transformants were selected on SD-UK (SD medium containing 0.72 g/l CSM-LYS-URA; MP Biomedicals, Irvine, CA, USA) plates. To test for subsequent loss of LYS2, strains were cultured in YPD medium for 3 days at 30 °C and then plated on α-AA agar medium for 7 days at 30 °C. As a control, GKT1001U, a uracil autotroph with wild-type ATF2 loci, was constructed by transformation of StuI-linearized pRS406 into strain GKT1001 (Table 1). Analysis of the upstream region of the ATF2 locus To test for the presence of recombinant DNA upstream of ATF2, yeast genomic DNA was isolated with an ISOPLANT kit (Nippon Gene Co., Ltd., Tokyo, Japan), and the regions upstream of ATF2 were amplified by PCR (with primers cATF2-F and cATF2-R) and visualized by agarose gel electrophoresis. Sake brewing test Mash for sake brewing consisted of 136 g of steamed rice, 43 g of koji, precultured yeast cells (OD600 of 250 U), 150 μl of 90% (v/v) lactic acid, and 392 ml of water. Mash was fermented at 15 °C for 21 days. The fermentation profile was monitored by measuring the loss of weight of the mash in conjunction with CO2 emission. After 21 days, the sake mash was centrifuged, and the general components of the resulting sake were analyzed by standard methods established by the National Tax Administration Agency (23). The levels of isoamyl acetate in sake were quantified by headspace gas chromatography (24). Genetic stability of heterozygous and homozygous PSED1::ATF2 strains A series of culture tubes with 5 ml YPD medium was inoculated with 103 cells of preculture of ATF-HET or ATF-HOM and then cultivated in YPD medium for 24 h at 30 °C with aeration. Cells were harvested, washed twice with sterile distilled water, and then
FIG. 1. DNAs used for construction of homozygous PSED1::ATF2 integrants. (A) The URA3_PSED1 DNA fragment for replacement of the ATF2 promoter was synthesized by fusion PCR (see Materials and methods). PCR fragments with the URA3 marker or SED1 promoter (PSED1), and primers URA3_PSED1-F (primer-1) and URA3_PSED1-R (primer-2), are indicated. (B) Structure of plasmid pPATF used to “mark” the wild-type ATF2 allele with the LYS2 marker. The ATF2 promoter (PATF2), ampicillin resistance gene (Ampr), origin of replication in E. coli (ColE1 ori), and restriction sites used for cloning (XbaI, HindIII) or linearization (EcoRI) are indicated.
VOL. 108, 2009
CONSTRUCTION OF HOMOZYGOUS SAKE YEAST BY HELOH METHOD
361
FIG. 2. Schematic representation of the HELOH method used to construct homozygous PSED1::ATF2 integrants. White bars interrupted by two vertical wavy lines indicate homologous chromosome pairs. resuspended in sterile distilled water. Finally, 106 cells were plated on 5-FOA agar medium. Colonies were counted after incubation at 30 °C for 4 days. The remaining harvested cells were used to inoculate the next series of cultures.
RESULTS Construction of homozygous sake yeast integrants In order to obtain sake yeast with enhanced isoamyl acetate production during the latter stages of fermentation, a homozygous integrant was constructed in which both ATF2 genes encoding alcohol acetyltransferase were placed under the control of the promoter of SED1, a major cell wall protein expressed in the stationary phase (25). In the first
step of the HELOH procedure (10, see Fig. 2), a heterologous integrant was created by targeted integration of a DNA fragment, in which URA3 had been fused to the SED1 promoter (URA3_PSED1) and positioned directly upstream of ATF2, into parental strain GKT1001 (10). For subsequent conversion of the heterologous strain (ATF-HET) to a homozygous integrant (ATF-HOM) by loss of heterozygosity, the wildtype ATF2 promoter was “marked” with LYS2 by integration of linearized plasmid pPATF (Figs. 1B and 2). Due to its homology to the endogenous ATF2 promoter, linearized pPATF can recombine with the wild-type ATF2 upstream region but not the recombinant allele. The resulting strains were cultured on medium that selected against colonies that had lost LYS2 (ATF-HOM candidates). ATF-HOM
FIG. 3. Analysis of upstream regions of ATF2 loci by PCR. (A) Fragments predicted to be amplified from wild-type and recombinant alleles with primers cATF2-F (primer-1) and cATF-R (primer-2) and (B) the resulting fragments as obtained for GKT1001U (lane 1), ATF-HET (lane 2), and ATF-HOM (lane 3). The size markers (lane M) and fragments derived from wildtype and recombinant alleles are indicated.
362
SAHARA ET AL.
J. BIOSCI. BIOENG., TABLE 4. The number of 5-FOAr colonies after several subcultures in YPD. Number of subculture Strain ATF-HET ATF-HOM
Genotype ⁎
1
3
5
URA3::PSED1::ATF2 / PATF2::ATF2 URA3::PSED1::ATF2 / URA3::PSED1::ATF2
113 ± 11.3 n.d.
118 ± 10.8 n.d.
119 ± 11.2 n.d.
Data represent the mean and s.d. values of at least three independent experiments; n.d. indicates that no colonies were determined. ⁎ Only the locus where the URA3 marker is located in each strain is shown.
FIG. 4. Time courses of laboratory-scale sake brewing. Strains GKT1001U (squares), ATFHET (triangles) and ATF-HOM (circles) were assessed for net weight loss due to CO2 production (A) and for the production of isoamylacetate (B). Plots show the mean ± s.d. values of at least three independent experiments.
candidates consisted of cells that were homozygous for PSED1::ATF2 by LOH occurrence (ATF-HOM) as well as ATF-HET revertants (Fig. 2). As a control, GKT1001U, a uracil autotroph with wild-type ATF2 loci, was constructed from GKT1001 (Table 1). PCR analysis of ATF2 loci The regions upstream of ATF2 in the various integrants were analyzed by PCR as shown in Fig. 3. By using primers cATF2-F and cATF2-R (Table 2), fragments that were either 0.9 kb or 2.5 kb in length were amplified. The shorter fragment was amplified from the wild-type allele, and the longer was amplified from the recombinant allele (Fig. 3A). A single band of length 0.9 kb was obtained from PCR using GKT1001U genomic DNA as a template (Fig. 3B lane 1). On the other hand, PCR on genomic DNA from ATFHET strains yielded both 0.9 and 2.5 kb bands, indicating heterozygosity of the ATF2 promoter loci (Fig. 3B lane 2). Finally, PCR on
TABLE 3. Fermentation profiles in brewed sake with the integrants.
Sake meter Alcohol (v/v%) Total acids (ml) Amino acids (ml) Glucose (×10− 1 g/l) Isoamyl acetate (ppm)
GKT1001U
ATF-HET
ATF-HOM
+ 16 ± 0.00 22 ± 0.44 3.1 ± 0.050 2.1 ± 0.050 6.0 ± 0.12 7.8 ± 0.44
+ 16 ± 0.17 21 ± 0.57 2.9 ± 0.076 2.1 ± 0.029 5.2 ± 0.29 19 ± 0.98
+ 16 ± 0.12 21 ± 0.92 2.8 ± 0.029 2.3 ± 0.029 4.7 ± 0.42 27 ± 2.2
Data represent the mean and s.d. values of at least three independent experiments.
genomic DNA from 30% of ATF-HOM candidates resulted in a single band that was 2.5 kb in length, indicating successful homozygous promoter replacement by LOH occurrence (Fig. 3B lane 3). This result, therefore, confirmed these strains as ATF-HOM. PCR on the other 70% of the ATF-HOM candidates resulted in the same fragment pattern as seen for ATF-HET (data not shown), indicating that reversion to the parental heterozygous genotype by loop-out recombination of the LYS2-marker happened more frequently than conversion to ATF-HOM by LOH. Laboratory-scale sake brewing When compared in laboratoryscale sake brewing experiments, all three integrants, ATF-HET, ATFHOM and GKT1001U, were excellent fermenters and reached a final ethanol concentration of about 21% (v/v) (Fig. 4). After four days of fermentation, the concentration of isoamyl acetate was significantly higher in the ATF-HOM culture, especially in comparison to the wildtype strain (GKT1001U). The production of isoamyl acetate by ATFHOM also exceeded that by ATF-HET and peaked around day 14, corresponding to the period of SED1 promoter induction in sake mash (17). After complete fermentation, the final concentration of isoamyl acetate was 7.8 ppm in the sake generated by wild-type strain (GKT1001U), 19 ppm in the sake generated by the heterozygous integrant (ATF-HET), and 27 ppm in the sake generated by the homozygous recombinant (ATF-HOM). In sensory tests, none of the brewed sakes were identified as having the undesirable flavor related to ethyl acetate production (data not shown). As a result, ATF-HOM produced sake with an extremely fruity aroma and taste. In other aspects, such as CO2-emission, the fermentation profiles of these brewed sake yeasts did not differ (Fig. 4A and Table 3). Trait stability of heterozygous and homozygous integrants The genetic stability of the homozygous PSED1::ATF2 integrant (ATF-HOM) was compared to that of the heterozygous recombinant (ATF-HET) by monitoring the frequency of spontaneous loss of the URA3 marker in the first, third and fifth rounds of subculturing (see Materials and methods). As shown in Table 4, about 100 out of every 106 ATF-HET cells spread on selective plates became resistant to 5-FOA (5-FOAr), indicating a 10− 4 frequency of conversion to 5-FOAr. This number remained constant during propagation over at least five subcultures and is close to the frequency at which spontaneous LOH is reported to occur (6). Sequence analysis of the ATF2 locus of 5-FOAr colonies derived from ATF-HET demonstrated that these strains had reverted to the parental, wild-type GKT1001 (data not shown). In contrast to the heterozygous integrant, the homozygous integrant (ATF-HOM) did not form any revertants resistant to 5-FOA after loss of the URA3 marker, demonstrating superior genetic stability.
DISCUSSION By application of the HELOH method (10) on a heterozygous integrant obtained by targeted promoter replacement, we constructed a homozygous diploid sake yeast strain that overexpresses the alcohol acetyltransferase gene ATF2 from the SED1 promoter (Fig. 2). We used LYS2 to “mark” wild-type alleles by recombination with the ATF2 promoter region. By growing the resulting strains on α-aminoadipate, we were able to screen for loss of this marker, which would indicate
VOL. 108, 2009
CONSTRUCTION OF HOMOZYGOUS SAKE YEAST BY HELOH METHOD
either that the desired homozygous recombinant had been produced via loss of heterozygosity (LOH) or that the strain had reverted to the parental heterozygote by loop-out recombination. Of the resulting clones, 70% had reverted to the parental heterozygote. As LOH usually occurs with a frequency of less than 10− 4 (6), the 30% success-rate of the HELOH method demonstrates that this approach enabled us to obtain LOH strains relatively easily. It should be possible to obtain desired homozygous integrants even more efficiently by reducing the frequency of loop-out recombination events by optimizing the length of the integrative plasmid (pPATF). Under the conditions of sake brewing, isoamyl acetate production was increased by the overexpression of ATF2 using the SED1 promoter and strain GKT1001, derivative of Kyokai No.9, as a host cell (Fig. 4). Recently, it was reported that ATF2 did not show any effects upon isoamyl acetate production (26). However, in that report, a different regulatory region, the TDH3 promoter, was used to drive overexpression of ATF2 in a different host cell, strain Kyokai No.7. It is likely that the different host cell and promoter used in our present study are responsible for the contrasting effects of heterologous ATF2 expression on isoamyl acetate production. The homozygous recombinant (ATF-HOM) produced 1.4 times more isoamyl acetate than the heterozygous parent (ATF-HET, Table 3). We assume that the level of ATF2 expression in the homozygous integrant was higher because both SED1 promoters were fully active and led to strong induction of the two ATF2 genes. In the low temperature, long-term culture environment of sake brewing, the homozygous integrant produced high levels of ethanol and isoamyl acetate in the absence of selective pressure, thereby demonstrating its industrial usefulness. In the future, perhaps the brewing performance of ATF-HOM can be improved further by reintroduction of LYS2 as ATF-HOM has lys2 for counterselection of the wild-type promoter of ATF2. The genetic stability of the homozygous integrant was excellent. In contrast, the heterozygous integrant underwent spontaneous LOH at a frequency of about 10− 4 when grown in the absence of selective pressure (Table 4). This frequency, which hardly changed over several rounds of propagation, is comparable to LOH observed for heterozygous wine yeast as previously reported (27). Our sake brewing experiments (Fig. 4 and Table 3) show that overexpression of ATF2 and accumulation of isoamyl acetate do not impair the growth and ethanol production of the recombinant yeast strains. However, if the overexpressed protein were to become harmful or stressful for the host, it is possible that the frequency of reversion by LOH could increase. Therefore, the stability of genetic traits of heterozygous integrants must be regularly monitored and verified during industrial use. In the case of homozygous integrants, however, such ongoing control is not necessary. Recently, Saitoh et al. bred a homozygous wine yeast strain in which the multicopy BGL expression cassette was integrated by using two auxotrophic markers, spore formation and autodiploidization (28). Improvements in the production efficiency of useful compounds by genetic recombination in microorganisms are often achieved by increasing the copy number of the gene expression cassette. The HELOH method allows the easy construction of diploid, homozygous sake yeast strains with integrated multicopy expression cassettes, despite the fact that sake yeast rarely sporulates. In this study, we confirmed that the HELOH method is industrially useful for the construction of genetic recombinant microorganisms. We expect that this method can be applied to other diploid microorganisms as well. ACKNOWLEDGEMENT This work was supported in part by the Research and Development Program for New Bio-industry Initiatives of the Bio-oriented Technology Research Advancement Institution.
363
References 1. Kodama, K.: Sake-brewing yeast, in: AH Rose, JS Harrison (Eds.), The Yeasts, vol. 3, Academic Press, London United Kingdom, 1993, pp. 129–168 (1993). 2. Casey, G. P. and Ingledew, W. M.: Ethanol tolerance in yeasts, Crit. Rev. Microbiol., 13, 219–280 (1986). 3. Kotaka, A., Bando, H., Kaya, M., Kato-Murai, M., Kuroda, K., Sahara, H., Hata, Y., Kondo, A., and Ueda, M.: Direct ethanol production from barley β-glucan by sake yeast displaying Aspergillus oryzae β-glucosidase and endoglucanase, J. Biosci. Bioeng., 105, 622–627 (2008). 4. Kaya, M., Ito, J., Kotaka, A., Matsumura, K., Bando, H., Sahara, H., Ogino, C., Shibasaki, S., Kuroda, K., Ueda, M., Kondo, A., and Hata, Y.: Isoflavone aglycones production from isoflavone glycosides by display of β-glucosidase from Aspergillus oryzae on yeast cell surface, Appl. Microbiol. Biotechnol., 79, 51–61 (2008). 5. Tanino, T., Noguchi, E., Kimura, S., Sahara, H., Hata, Y., Fukuda, H., and Kondo, A.: Effect of cultivation conditions on cell-surface display of Flo1 fusion protein using sake yeast, Biochem. Eng. J., 33, 232–237 (2007). 6. Hiraoka, M., Watanabe, K., Umezu, K., and Maki, H.: Spontaneous loss of heterozygosity in diploid Saccharomyces cerevisiae cells, Genetics, 156, 1531–1548 (2000). 7. Saitoh, S., Mieno, Y., Nagashima, T., Kumagai, C., and Kitamoto, K.: Breeding of a new type of baker's yeast by δ-integration for overproduction of glucoamylase using a homothallic yeast, J. Ferment. Bioeng., 81, 98–103 (1996). 8. Fukuda, K., Yamamoto, N., Kiyokawa, Y., Yanagiuchi, T., Wakai, Y., Kitamoto, K., Inoue, Y., and Kimura, A.: Balance of activities of alcohol acetyltransferase and esterase in Saccharomyces cerevisiae is important for production of isoamyl acetate, Appl. Environ. Microbiol., 64, 4076–4078 (1998). 9. Suizu, T., Tsutsumi, A., Kawato, A., Murata, K., Suginami, K., and Imayasu, S.: Method for sporulation of industrially used sake yeast, J. Ferment. Bioeng., 81, 93–97 (1996). 10. Kotaka, A., Sahara, H., Kondo, A., Ueda, M., and Hata, Y.: Efficient generation of recessive traits in diploid sake yeast by targeted gene disruption and loss of heterozygosity, Appl. Microbiol. Biotechnol., 82, 387–395 (2009). 11. Fujii, T., Nagasawa, N., Iwamatsu, A., Bogoki, T., Tamai, Y., and Hamachi, M.: Molecular cloning, sequence analysis, and expression of the yeast alcohol acetyltransferase gene, Appl. Environ. Microbial., 60, 2786–2792 (1994). 12. Nagasawa, N., Bogaki, T., Iwamatsu, A., Hamachi, M., and Kumagai, C.: Cloning and Nucleotide sequence of alcohol acetyltransferase II gene (ATF2) from kyokai no, 7. Biosci. Biotechnol. Biochem., 62, 1852–1857 (1998). 13. Lilly, M., Lambrechts, M. G., and Pretorius, I. S.: Effect of increased yeast alcohol acetyltransferase activity on flavor profiles of wine and distillates, Appl. Environ. Microbiol., 66, 744–753 (2000). 14. Mason, A. B. and Dufour, J. P.: Alcohol acetyltransferases and the significance of ester synthesis in yeast, Yeast, 16, 1287–1298 (2000). 15. Verstrepen, K. J., Van Laere, S. D., Vanderhaegen, B. M., Derdelinckx, G., Dufour, J.P., Pretorius, I. S., Winderickx, J., Thevelein, J. M., and Delvaux, F. R.: Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad range of volatile esters, Appl. Environ. Microbiol., 69, 5228–5237 (2003). 16. Hirosawa, I., Aritomi, K., Hoshida, H., Kashiwagi, S., Nishizawa, Y., and Akada, R.: Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol, Appl. Microbiol. Biotechnol., 65, 68–73 (2004). 17. Wu, H., Zheng, X., Araki, Y., Sahara, H., Takagi, H., and Shimoi, H.: Global gene expression analysis of yeast cells during sake brewing, Appl. Environ. Microbiol., 72, 7353–7358 (2006). 18. Hanahan, D.: Studies on the transformation of Escherichia coli with plasmids, J. Mol. Biol., 166, 557–580 (1983). 19. Boeke, J. D., LaCroute, F., and Fink, G. R.: A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance, Mol. Gen. Genet., 197, 345–346 (1984). 20. Zaret, K. S. and Sherman, F.: α-Aminoadipate as a primary nitrogen source for Saccharomyces cerevisiae mutants, J. Bacteriol., 162, 579–583 (1985). 21. Kuwayama, H., Obara, S., Morio, T., Katoh, M., Urushihara, H., and Tanaka, Y.: PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors, Nucleic Acids Res., 30, E2 (2002). 22. Ito, H., Fukuda, Y., Murata, K., and Kimura, A.: Transformation of intact yeast cells treated with alkali cations, J. Bacteriol., 153, 163–168 (1983). 23. Brewing Society of Japan Tokyo: Annotation of the official analytical method of the National Tax Administration Agency of Japan, 4th edn (in Japanese) (1993). 24. Yoshizawa, K.: Rapid method for determining flavor components in sake by headspace gas chromatography, J. Sot. Brew. Jpn., 68, 59–61 (1973) (in Japanese). 25. Shimoi, H., Kitagaki, H., Ohmori, H., Iimura, Y., and Ito, K.: Sed1p is a major cell wall protein of Saccharomyces cerevisiae in the stationary phase
364
SAHARA ET AL.
and is involved in lytic enzyme resistance, J. Bacteriol., 180, 3381–3387 (1998). 26. Ano, A., Suehiro, D., Cha-Aim, K., Aritomi, K., Phonimdaeng, P., Nontaso, N., Hoshida, H., Mizunuma, M., Miyakawa, T., and Akada, R.: Combinatorial gene overexpression and recessive mutant gene introduction in sake yeast, Biosci. Biotechnol. Biochem., 73, 633–640 (2009).
J. BIOSCI. BIOENG., 27. Ramírez, M., Vinagre, A., Ambrona, J., Molina, F., Maqueda, M., and Rebollo, J. E.: Genetic instability of heterozygous, hybrid, natural wine yeasts, Appl. Environ. Microbiol., 70, 4686–4691 (2004). 28. Saitoh, S., Tanaka, T., and Kondo, A.: Breeding of industrial diploid yeast strain with chromosomal integration of multiple β-glucosidase genes, J. Biosci. Bioeng., 106, 594–597 (2008).