Variant chicken kidney AE1 anion exchanger transcripts are derived from a single promoter by alternative splicing

Gene, 173 (1996) 221-226 0 1996 Elsevier Science B.V. All rights reserved.

221

03781119/96,S15.00

GENE 09808

Variant chicken kidney AEI anion exchanger transcripts are derived from a single promoter by alternative splicing (Genomic DNA; transcription start point; primer extension; RNA blotting; RNase protection)

Kathleen Department

H. Cox, Tracy L. Adair-Kirk

and John V. Cox

of Microbiology and Immunology, University of Tennessee Health Science Center, Memphis, TN 38163, USA

Received by C.M. Kane: 18 August

1995; Revised/Accepted:

12 January/l2

February

1996; Received at publishers:

4 March

1996

SUMMARY

Previous studies have demonstrated

that three variant transcripts, AEI-3, AEl-4

and AEl-5,

are derived from the

AEl gene in chicken kidney. These variant transcripts encode AEl anion exchangers that possess alternative N-terminal

cytoplasmic domains. To determine the mechanisms involved in generating these transcripts, a genomic clone, containing the unique sequences at the 5’ ends of the AEl-4 and AEI-5 transcripts, was isolated. Characterization of this clone revealed that the sequences at the 5’ ends of the AEl-3, AEI-4 and AEI-5 transcripts were each present within an approx. 1.2-kb BumHI fragment of the chicken AEI gene. RNA blotting and RNase protection analyses using probes derived from this genomic clone have shown that the AEI-4 variant corresponds to the approx. 4.5-kb chicken kidney AEl transcript, while the AEl-5 variant corresponds to the approx. 5.1-kb transcript. These studies have shown that the AEl-5 transcript extends further 5’ than had been previously shown from cDNA cloning studies, and contains the sequence present at the 5’ end of the AEl-4 transcript. In addition, primer extension analyses have shown that the variant kidney AEI transcripts initiate transcription from a common site. This result indicates that the expression of the AEl-3, AEI-4 and AEl-5 transcripts is regulated by a single promoter, P3, that is distinct from the PI and P2 erythroid-specific promoters of the chicken AE1 gene.

INTRODUCTION

Molecular and immunological studies have shown that polypeptides encoded by the AEl gene are localized in the basolateral membrane of A-intercalated cells of the kidney collecting duct (Alper et al., 1989), where they function coordinately with the H f-ATPase to dispose of bicarbonate and protons generated by intracellular carbonic anhyCorrespondence

to: Dr. J.V. Cox, Department

of Microbiology

and

tmmunology, University of Tennessee Health Science Center, 858 Madison Avenue, Memphis, TN 38163, USA. Tel. (l-901) 448-7080; Fax

(l-901) 448-8462; e-mail: [email protected]

Abbreviations:

aa, amino

acid(s);

AEl,

anion

exchanger

1; AE, gene

( DNA, RNA) encoding AE; bp, base pair(s); cDNA, DNA complementary to RNA, triphosphatase;

cpm, counts kb, kilobase

per min; H+-ATPase, proton adenosine or 1000 bp; nt, nucleotide(s); oligo, oligo-

deoxyribonucleotide; P. promoter; THR, thyroid hormone transcription start point(s); UTR, untranslated region(s). PII

SO378-1119(96)00211-9

receptor;

tsp,

drase. Characterization of the murine (Brosius et al., 1989) and human (Kollert-Jons et al., 1993) kidney AEl cDNAs has shown that these species possess a single kidney AEl transcript that is identical to the erythroid AEl transcript except at its 5’ end. Similar analyses have shown that two AEl transcripts accumulate in rat kidney. These transcripts are also identical to the rat erythroid AEl transcript, except at their 5’ ends (Kudrycki and Shull, 1989; 1993). In rat and mouse, the kidney AEl transcripts encode anion exchangers that are identical to their erythroid counterparts except for the absence of the 79 N-terminal aa of the erythroid molecule, while the human kidney AEl anion exchanger lacks the 65 N-terminal aa of the human erythroid AEl anion exchanger. Recent studies have shown that three AEl transcripts, AEl-3, AEl-4 and AEI-5, accumulate in chicken kidney (Cox and Cox, 1995). These transcripts differ from each other and from the chicken erythroid AEl transcripts

222 (Kim et al., 1988; Cox et al., 1995) in the sequences present at their 5’ ends. The AEI-3 and AEI-5 transcripts encode polypeptides that are structurally homologous to kidney AEl anion exchangers from other species, in that they lack the 78 N-terminal aa of the chicken erythroid AEl-lb anion exchanger (Cox and Cox, 1995; Cox et al., 1995), while AE1-4 possesses an in-frame AUG in its unique 5’ sequence, resulting in a polypeptide with an alternative N-terminal cytoplasmic tail (Cox and Cox, 1995). A comparison of the sequence at the 5’ ends of AEl-3 and AEl-4 suggested that these transcripts are generated by alternative splicing of a single primary transcript (Cox and Cox, 1995). In addition, the observation that the 5’ end of AEl-5 is unique to this variant suggested that AEl-5 may initiate transcription from a different site than AEl-3 and AEl-4. The studies described here have further investigated the mechanisms involved in generating the variant chicken kidney AEl transcripts. EXPERIMENTAL

AND DISCUSSION

(a) Characterization of a genomic clone containing the unique sequences at the 5’ ends of the variant chicken kidney AEl transcripts

Three AEl anion-exchanger transcripts, AEl-3, AEl-4 and AEl-5, are expressed in chicken kidney (Fig. 1A) (Cox and Cox, 1995). These variant transcripts differ in sequence from the erythroid AEl transcripts (Kim et al., 1988; Cox et al., 1995) at their 5’ ends. Furthermore, DNA blotting analyses have suggested that AEl-4 and AEl-5 initiate transcription several kb downstream from the erythroid-specific AEl promoters, Pl and P2 (Kim et al., 1989; Cox and Cox, 1995). These analyses demonstrated that the unique sequences at the 5’ ends of both AEl-4 and AEl-5 hybridize to a fragment of approx. 1.2 kb in a BarnHI digest of chicken genomic DNA. To further investigate the mechanisms involved in generating the variant kidney AEl transcripts, a genomic library was constructed from BumHI digested chicken genomic DNA. This library was screened using probes corresponding to a portion of the unique sequence (underlined in Fig. 1A) at the 5’ ends of the AEI-4 and AEl-5 cDNAs. Four clones that hybridized with both probes were isolated. Characterization of these clones revealed that they were all identical, and the sequence of this region of the AEl gene is illustrated in Fig. 1B. This 1174-bp BamHI genomic fragment, which lies approx. 5 kb and approx. 6 kb downstream from the PI and P2 promoters, respectively, of the chicken AEl gene (Kim et al., 1989; Cox and Cox, 1995), contains the unique sequences at the 5’ ends of each kidney AEl variant (Fig. 1A). The 14 nt that is shared at the 5’ ends of the AEl-3 and AEl-4 cDNAs (nt 14-27 in Fig. 1B) is

immediately followed by the unique sequence at the 5’ end of the AEl-4 cDNA (nt 28-99 in Fig. 1B). The unique sequence at the 5’ end of the AEl-5 cDNA (nt 217-303 in Fig. 1B) is separated from the sequence at the 5’ end of AEl-4 by 117 nt. The 74 nt (nt 3044377 in Fig. 1B) immediately downstream from the unique sequence at the 5’ end of the AEl-5 cDNA is the first exon that is held in common among all of the chicken AEl transcripts. An intron of 150 nt separates this exon from the next exon of the AEl gene which is also present in all characterized AEl transcripts. (h) Characterization

of the variant kidney AEl transcripts

(1) Previous studies have shown that AEl transcripts of approx. 4.5 kb, approx. 5.1 kb and approx. 6.5 kb accumulate in chicken kidney (Cox and Cox, 1995). RNA blotting analyses have investigated which of the sequences in this genomic DNA fragment are represented in these variant transcripts. 7 ug of kidney poly(A)+RNA were electrophoresed on a formaldehyde-agarose gel and transferred to nitrocellulose. The filters were probed with 32P-labeled antisense transcripts complementary either to a portion of the sequence at the 5’ end of the AEI-4 cDNA (probe 1 in Fig. 2A), a portion of the sequence at the 5’ end of the AEl-5 cDNA (probe 3 in Fig. 2A), or to nt loo-190 in the AEI genomic clone illustrated in Fig. 1B (probe 2 in Fig. 2A). Probe 2 corresponds to a portion of the sequence in the AEl gene that separates the alternative sequences at the 5’ ends of the AEI-4 and AEI-5 cDNAs. As shown in Fig. 2B, each probe hybridizes with a transcript of approx. 5.1 kb, and probes 1 and 2 weakly hybridize with a transcript of approx. 6.5 kb. Longer exposure of the autoradiograms has indicated that probe 3 also hybridizes with the approx. 6.5-kb transcript (data not shown). Furthermore, only probe 1 hybridizes with the approx. 4.5-kb AEl transcript (Fig. 2B, lane 1). In addition to containing most of the sequence unique to the AEl-4 cDNA (nt 28-96 in Fig. lB), probe 1 contains sequence that is shared by-the AEI-3 and AEl-4 cDNAs (nt 14-27 in Fig. 1B). To determine which sequences in probe 1 hybridized with the approx. 4.5-kb transcript, similar analyses were carried out using a probe that only contained nt 28-96. This resulted in a pattern of hybridization identical to that seen in Fig. 2B, lane 1, while no detectable hybridization was observed when using a probe corresponding to nt 7-27 (data not shown). The inability to detect hybridization using a probe corresponding to nt 7-27 is consistent with previous results from our laboratory that have indicated that probes of this size are unable to form stable hybrids under the conditions used for these studies. These data suggest that the approx. 4.5-kb kidney AEl transcript results from the splicing of the sequence at the 5’

223

A AEl-3

.......

GCGGGGGGGAGCAG GCGGGGGGGAGCAGGTAGGCAGGGGATGGGGACAGGGGACACCAGGCCGTTAGGCGAGGGGACGCCGTGTCCCCATCGTGGTCCAG GGTGGGGGGTGTGTGGGGGGGGTACACCGTGCGGACCCCACCGGGGCTGGGCAGGACCTGCTGACACAGCGCCCGCTCCGCTCACAG

.......

AEl-4

.......

AEl-5

(-

Fig. 1. Genomic

organization

of the chicken

AH

gene near the 5’ ends of the variant

kidney

AEI transcripts.

Restriction

the BarnHI digestion of chicken genomic DNA were ligated into a BarnHI-cut hZAP Express vector (Stratagene, library was packaged and plated on E. coli strain XLl-Blue MRF’, and screened by plaque filter hybridization corresponding containing

to the unique the genomic

termination AEI-4

method

and AH-5

number

sequences

insert

from 4 phage

using specific oligos as primers. cDNAs

I in B corresponds

AEI-4 and AE1-5 cDNAs

at the 5’ ends of the variant

was prepared

(A). The sequence

clones

that

screened

Each clone was identical

of this 1174-bp

to the tsp of the kidney

AEl-3,

genomic

AEI-4

positive

and contained

fragment

and AEI-5

that are underlined

with both accession

resulting

in A. pBK-CMV

and sequenced

the unique sequence

(GenBank

transcripts

probes,

fragments

from

La Jolla, CA, USA). This phage using 32P-labeled DNA probes phagemid

DNA

by the dideoxy

chain

at the 5’ ends of the kidney AH-3,

No. U24675)

is illustrated

(see section c). Exons in these sequences

in B. Nucleotide are in uppercase

type, while introns are in lowercase type (see sections b and c). The underlined regions in B correspond to the sequences in the AH-4 and AH-5 cDNAs (A) that were used to screen the genomic library. The arrows 3’ of nt 27 and 99 in B mark the splice donor sites that are differentially utilized in the AEI-3

and AE1-4 transcripts,

TATA box 9 nt upstream sites for AP2, SPl, comparison transcripts.

the thyroid

of three regions Numbers

respectively.

from the transcription hormone

receptor

that lie immediately

in the right margin

The arrow initiation

marked

by the asterisk

site (nt 1) of the variant

(THR), upstream

of B and C indicate

as well as several

CACCC

from the transcription the position

in B lies 5’ of the splice acceptor

kidney AE1 transcripts elements

initiation

in the chicken

site in exon 10. A potential

is boxed in B. In addition,

are boxed

(B). Panel

site of the chicken,

AEl gene relative

kidney AEI transcripts. The dots in A indicate nt shared in common by the variant chicken AEI transcripts, human, mouse and rat .46f genes that are identical to the sequence of the chicken AEI gene.

mouse,

potential

C illustrates rat and human

to the transcription

binding

the sequence kidney

initiation

while the dots in C indicate

AEI

site of the nt in the

end of AEl-4 (splice donor site marked by arrow at nt 99 in Fig. 1B) to the exon that is held in common among

vitro

all of the variant AEl transcripts (splice acceptor site marked with asterisk at nt 304 in Fig. 1B). The fact that

thought extended

each probe also recognizes the approx. 5.1-kb kidney AEl transcript indicates that this transcript contains at least

first exon held in common among all the AEl variants. The resulting hybrids were digested with RNase, and the

a portion of the unique sequence at the 5’ ends of both the AEl-4 and AEl-5 cDNAs, as well as sequence in the AEl gene that lies between the alternative 5’ ends of these variant cDNAs. (2) To verify that the unique sequences at the 5’ ends

protected fragments were resolved on a denaturing urea/ polyacrylamide gel. This analysis resulted in a single protected 257-nt fragment (Fig. 3, lane 2) indicating that the entire sequence between nt 644320 in Fig. IB is present in a subset of the kidney AEl transcripts. The additional bands in the RNase protection (Fig. 3, lane 2) are also present in the no RNA control (Fig. 3, lane 3) indicating they are non-specific in nature. Based upon the sequence

of the AEI-4 and AEl-5 cDNAs are present in a single kidney AEl transcript, a 32P-labeled antisense RNA complementary to nt 64-320 in Fig. 1B was synthesized in

and hybridized

This probe

initiated

to 1 ug of kidney in the sequence

poly(A)+RNA.

that was previously

to be unique to the AEl-4 through the sequence unique

transcript, and to AEI-5 to the

224

A 1 27

99

303

nt

377

338

c -PROBE 1

PROBE 2

Pm 3

B 12

3

284

kb 9.5 7.5 :

230 Fig. 3. RNase protection antisense

AH

clone in Fig. 1B was synthesized

genomic

ase. This probe

transcript

also contained

3 x 10’ cpm of this 32P-labeled poly(A)+RNA

isolated

kidney AEl transcripts.

analysis of the variant

A 32P-labeled

from

chicken (lane 2). Following

complementary

to nt 644320 of the

using T7 RNA polymer-

81 nt of unrelated probe the

vector

were hybridized

perfused

hybridization,

kidney

sequence.

with

1 ug of

of a 2-week-old

the sample was digested with

0.3 ug RNase A and 6.6 units of RNase Tl for 1 h at 30°C deproteinized by treatment (Sambrook Fig. 2. RNA blotting scripts.

RNA was isolated

chicken as described cation

with identical

by autoradiography 3 was hybridized

32P-labeled

hybridizing

303 and 377 in A correspond Nucleotide

characterized

AEI-5

2

clone in

These probes previously

3. Nucleotide

(Cox

with probe 2, and lane

1 in A corresponds Nucleotides

to the 27, 99,

to the last nt of exons 7, 8, 9 and 10,

217 corresponds

ments were visualized Lane

K, phenol

extracted,

and precipitated

1 corresponds

to a hybridization

polyacrylamide

by autoradiography to the undigested

and digestion correspond

carried

electropho-

gel, and the protected using an intensifying probe,

fragscreen.

and lane 3 corresponds

out in the presence

to in vitro transcripts

of tRNA

of known

sizes.

tran-

species were detected

tsp of the variant kidney AEI transcripts.

respectively.

antisense

resed on a 7 M urea-6%

alone. The markers

screen. Lane 1 in panel B was

1, lane 2 was hybridized

with probe

7 ug

1 in A), nt lOOG190 (probe

RNA blots as described

washing,

old

purifi-

chromatography,

3 in A) of the AEI genomic

using an intensifying

with probe

of a 2-week

using SP6 RNA polymerase.

and Cox, 1995). Following

putative

to nitrocellulose.

(probe

Fig. 1B were synthesized

hybridized

kidney

on a 0.5 M formaldehyde/l%

to nt 7-96 (probe

in A), and nt 2399300

kidney AEI tran-

(Cox and Cox, 1995). Following

were electrophoresed

scripts complementary

chicken

by oligo(dT)-cellulose

gel, and transferred

were incubated

of the variant

from the perfused

previously

of poly(A)+RNA

of poly(A)+RNA agarose

analysis

with proteinase

et al., 1989). The sample was then resuspended,

to the first nt of the previously

cDNA clone (Cox and Cox, 1995).

of the variant kidney transcripts, this protection was predicted to yield additional protected fragments of 36 nt (nt 64-99 in Fig. lB, corresponding to the AEl-4 transcript), and 17 nt (nt 304-320 in Fig. lB, corresponding to the AEl-3 and AEI-4 transcripts). These products were not observed. However, under the conditions employed for these analyses we have been unable to detect RNase protection products smaller than approx. 40 nt. These data indicate that the AEl-5 transcript extends further 5’ than that previously shown by cDNA cloning

(Cox and Cox, 1995) and contains at least a portion of the sequence at the 5’ end of the AEl-4 transcript. Furthermore, this result in conjunction with the blotting studies indicates that the AEI-5 variant corresponds to the approx. 5.1-kb AEI transcript that accumulates in chicken kidney. A stop codon (nt 123-125 in Fig. 1B) resides within the additional sequence at the 5’ end of the AEl-5 transcript that is in-frame with the single long open reading frame of the remainder of the transcript. This suggests that AEl-5 initiates translation downstream at the first available AUG codon, resulting in a polypeptide with a predicted mass of 93 717 Da. This polypeptide, like the AEl-3 variant, lacks the 78 N-terminal aa of the polypeptide encoded by the chicken erythroid AEl-lb transcript (Cox and Cox, 1995; Cox et al., 1995). (c) Mapping the transcription start point (tsp) of the variant kidney A El transcripts (I) The tsp of the kidney AE1 transcripts was deter-

mined by primer extension analyses. The antisense primer

225

75-95 in Fig. 1B) chosen for this analysis is complementary to a sequence in both the AE1-4 and AEI-5 transcripts. This primer was 32P-end labeled, and incubated with 2 pg of kidney poly(A)+RNA. Following annealing, the primer was extended using reverse transcriptase, and the extension products were resolved on a denaturing urea/polyacrylamide gel. A primary extension product of 95 nt, and a minor product of 96 nt (Fig. 4C, lane 1) were observed. Comparison of these extension products to the sequencing ladder that was generated using the same antisense oligo as a primer and the genomic clone described above as a template has shown that the primary extension product maps to a site (nt 1 in Fig. 1B) in the AEI gene that is 13 nt upstream from the most 5’ nucleotide in the previously characterized AE1-3 and AEl-4 cDNAs (Cox and Cox, 1995). This analysis coupled with the RNA blotting and RNase protection data suggest that each of the variant kidney AEl transcripts initiates transcription from this tsp. The demonstration of a common tsp indicates that the variant kidney AEl transcripts are generated by the alternative splicing events illustrated in Fig. 4B. The studies described above indicate that the AEI-5 transcript contains an exon of 204 nt (nt loo-303 in Fig. 1B) that is absent in AEI-4. However, this additional exon is not sufficient to account for the size difference detected between the AEI-4 and AEl-5 transcripts by RNA blotting. Since cDNA cloning studies (Cox and Cox, 1995) have shown that other than their 5’ ends the coding regions of the AEl-4 and AEl-5 cDNAs are identical, these results suggest that the AEl-4 and AEl-5 transcripts must also differ in their 3’ UTR. (2) The 3’ end of exon 6 (nt - 600 to - 529 in Fig. 1B) of the chicken AEl gene lies upstream from the tsp of the variant kidney AEl transcripts. This exon is present in multiple alternatively spliced chicken erythroid AEl transcripts (Cox et al., 1995). This result indicates that the alternative exons at the 5’ ends of the kidney AEI transcripts (Fig. 4A) correspond to exons 7 (nt 1-27 in Fig. lB), 8 (nt 28-99 in Fig. lB), and 9 (nt loo-303 in Fig. 1B) of the AEl gene. Examination of the sequence between exon 6 and the tsp of the kidney transcripts (intron 6 of the AEl gene) for regulatory sequences has revealed a potential TATA sequence (Breathnach and Chambon, 1981) 9 nt upstream from the tsp of the kidney AEl transcripts (Fig. 1B). The sequence immediately upstream from the TATA box contained two potential AP2-binding sites (Imagawa et al., 1987), two potential SPl-binding sites (Dierks et al., 1983), and two sites that match the core element of the thyroid hormone receptorbinding site (Norman et al., 1989) (Fig. 1B). The AEl-3 and AEI-5 transcripts accumulate both in kidney and erythroid cells, while the AE1-4 transcript

(nt

A 1 27

I

I EX 7

99

303

377

I

I

I

EXON 9

EXON 8 f

EXON 10

B D-----j

AEl-3

[l---u-k

AEI -4

[-I

AEI-5

C TGACl

2 5’ A G G G C C A G A* G* G C G

T G G G

3’

Fig. 4. Mapping An antisense

the tsp of the variant

oligo complementary

clone (Fig. 1B) was 32P-end This end-labeled

oligo,

chicken kidney AH to nt 76-96

labeled

which

transcripts.

of the AEf genomic

using T4 polynucleotide

is illustrated

by the arrow

kinase. in A, was

incubated with 2 pg of poly(A)+RNA isolated from the perfused kidney of a 2 week old chicken for 5 min at 70°C. The mixture was quick chilled on ice, and the annealed

primers

were extended

by incubating

with Superscript reverse transcriptase (BRL, Gaithersburg, MD, USA) for 1 h at 42°C. The resulting extension products were electrophoresed on a 7 M urea-6% products

polyacrylamide

gel. The migration

(panel C, lane 1) was compared

of the extension

to a DNA sequencing

(lanes T, G, A, and C) that was generated

ladder

using the same antisense

oligo as a primer, and the AEI anion exchanger genomic clone (Fig. 1B) as a template. Lane 2 in C corresponds to a control primer extension carried

out in the absence

of kidney RNA. The two extension

in panel C, lane 1 terminate

at the bold nt marked

the right margin.

extension

The major

product

products

by the asterisks

(indicated

in

by the bold

G) corresponds to nt 1 in Fig. 1B. The numbers in A refer to the location in the AEl gene relative to the tsp of the kidney AEl transcripts, which is denoted as nt 1. The line drawings in B indicate the alternative splicing events that result in the production of the AEl-3, AH-4 and AEl-5 transcripts.

226 accumulates only in kidney (Cox and Cox, 1995). Since these variant transcripts initiate from a single tsp, the ~3 promoter, which regulates their expression, must be active in both kidney and erythroid cell types. For this reason, it is of interest that several CACCC sites (Walters and Martin, 1992) are present within the P3 promoter (Fig. 1B). These elements have been shown to be involved in high level expression of erythroid genes (Walters and Martin, 1992; Collis et al., 1990). The presence of these elements within the P3 promoter of the AEI gene suggests that one or more of these elements may be involved in directing the expression of AEI-3 and AEI-5 in chicken erythroid cells. A comparison of the sequence upstream from the tsp of the rat kidney AEl transcripts (Kudrycki and Shull, 1993) with the homologous region of the murine (Kopito et al., 1987), and human (Schofield et al., 1994) AEI anion-exchanger genes has indicated that three regions (illustrated in Fig. lC), which share at least 86% sequence identity, lie just upstream from the TATA box in each gene. Although the comparable regions of the chicken AEl gene share homology with these sequences, the regions of identity represent a subset of the sequences that are conserved among the other species. These elements have not been implicated in the binding of any known transcription factors. However, their conservation suggests that they may be involved in regulating the expression of the kidney AEl transcripts in these species. (d) Conclusions

blotting analyses have indicated that the AEl-4 anion exchanger is encoded by the approx. 4.5-kb AEl transcript that accumulates in chicken kidney, while the AEl-5 anion exchanger is encoded by the approx. 5.1-kb kidney AEl transcript. (2) The expression of the variant chicken kidney AEI transcripts is regulated by a single promoter, P3, that is distinct from the PI and P2 promoters that regulate the expression of the chicken erythroid AEl transcripts. (3) The chicken AEl-3, AEl-4 and AEl-5 anion exchanger transcripts are derived by alternative splicing of a single primary transcript. The alternative exons at the 5’ ends of the chicken kidney AEl variants are not separated by intervening introns. This indicates that the alternatively spliced sequences, corresponding to exons 8 and 9, are differentially treated as exons or introns by the splicing machinery of the kidney epithelial cells where they accumulate. (I) RNA

ACKNOWLEDGEMENTS

This research was supported by grants from the National Chapter of the American Heart Association (9 l-009920), the American Cancer Society (IN- 176-B),

and the University of Tennessee Medical Group, Inc. to J.V.C., and from the National Kidney Foundation of West Tennessee to K.H.C.

REFERENCES

Alper,S.L., Natale,J.,

Gluck, S., Lodish, H.F. and Brown, D.: Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H+ATPase. Proc. Natl. Acad. Sci. USA 86 (1989) 5429-5433. Breathnach, R. and Chambon, P.: Organization and expression of eukaryotic split genes coding for proteins. Annu. Rev. Biochem. 50 (1981) 349~-383. Brosius, F.C., Alper, S.L., Garcia, A.M. and Lodish, H.F.: The major kidney band 3 gene transcript predicts an N-terminal truncated band 3 polypeptide. J. Biol. Chem. 264 (1989) 7784-7787. Collis, P., Antoniou, M. and Grosveld, F.: Definition of the minimal requirements within the human beta-globin gene and the dominant control region for high level expression. EMBO J. 9 (1990) 233-240. Cox, K.H. and Cox, J.V.: Variant chicken AEl anion exchangers possess divergent NH,-terminal cytoplasmic domains. Am. J. Physiol. 268 (1995) F503-F513. Cox, K.H., Adair-Kirk, T.L. and Cox., J.V.: Four variant chicken erythroid AEl anion exchangers: role of the alternative N-terminal sequences in intracellular targeting in transfected human erythroleukemia cells. J. Biol. Chem. 270 (1995) 19752-19760. Dierks, P., Van Ooyen, A., Cochran, M.D., Dobkin, C., Reiser, J. and Weissmann, C.: Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit beta-globin gene in mouse 3T6 cells. Cell 32 (1983) 246-248. Imagawa, M., Chiu, R. and Karin, M.: Transcription factor AP-2 mediates induction by two different signal transduction pathways: protein kinase C and CAMP. Cell 51 (1987) 251-260. Kim, H.-R.C.,Yew, N.S.,Ansorge, W.,Voss, H., Schwager, C., Vennstrom, B., Zenke, M. and Engel, J.D.: Two different mRNAs are transcribed from a single genomic locus encoding the chicken erythrocyte anion transport proteins (band 3). Mol. Cell Biol. 8 (1988) 4416-4424 Kim, H.-R.C., Kennedy, B.S. and Engel, J.D.: Two chicken erythrocyte hund 3 mRNAs are generated by alternative transcriptional initiation and differential RNA splicing. Mol. Cell Biol. 9 (1989) 5 198-5206. Kollert-Jons, A., Wagner, S., Hubner, S., Appelhans, H. and Drenckhahn, D.: Anion exchanger 1 in human kidney and oncocytoma differs from erythroid AEl in its NH, terminus. Am. J. Physiol. 265 (1993) F813-F821. Kopito, R.R., Andersson, M.A. and Lodish, H.F.: Multiple tissue-specific sites of transcriptional initiation of the mouse anion antiport gene in erythroid and renal cells. J. Biol. Chem. 262 (1987) 8035-8042. Kudrycki, K.E. and Shull, G.E.: Primary structure of the rat kidney anion exchange protein deduced from a cDNA. J. Biol. Chem. 264 (1989) 8185-8192. Kudrycki, K.E. and Shull, G.E.: Rat kidney band 3 chloride/bicarbonate exchanger mRNA is transcribed from an alternative promoter. Am. J. Physiol. 264 (1993) F540-F547. Norman, M.F., Lavin, T.N., Baxter, J.D. and West, B.L.: The rat growth hormone gene contains multiple thyroid response elements. J. Biol. Chem.264(1989)12063~12073. Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. CSHL Press, Cold Spring Harbor, NY, 1989. Schofield, A.E., Martin, P.G., Spillett, D. and Tanner, M.J.A.: The structure of the human red blood cell anion exchanger (EPB3, AEI, Band 3) gene. Blood X4 (1994) 2000-2012. Walters, M. and Martin, D.I.K.: Functional erythroid promoters created by interaction of the transcription factor GATA-1 with CACCC and AP-l/NFE-2 elements. Proc. Natl. Acad. Sci. USA 89 (1992) 10444-10448.