Variation in gene expression in response to stress in two populations of Fundulus heteroclitus

Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

Variation in gene expression in response to stress in two populations of Fundulus heteroclitus Daniel J. Picard, Patricia M. Schulte* Department of Zoology, University of British Columbia, 6270 University Blvd., Vancouver, BC, Canada V6T 1Z4 Received 2 July 2003; received in revised form 28 September 2003; accepted 29 September 2003

Abstract We used differential display PCR to identify hepatic genes responsive to handling stress and genes that differ in expression between populations of a fish, Fundulus heteroclitus, from different thermal environments. Despite substantial inter-individual variation, we cloned 20 putatively stress-regulated bands from Northern fish, 10 of which had high similarity to genes of known function. We selected five of these genes for further analysis based on their known roles in the stress response. Three of these genes (glucokinase, serine-threonine kinase 10 and cRAF) were confirmed as stress-responsive using real-time PCR. These genes increased in expression in response to a 7-day chronic stress protocol in fish from the Southern population of F. heteroclitus, but did not change significantly in fish from the Northern population. These three genes also differed in expression between populations in control fish, suggesting a link between the response to chronic stress and inter-population differences in gene expression in unstressed laboratory-acclimated fish. Two genes that did not respond to stress (glycogen synthase kinase and warm acclimation-related protein (WAP)) also differed between populations. Expression of WAP was eight-fold higher in Southern than in Northern fish, consistent with a previously suggested role for this gene in thermal acclimation or adaptation in fish. 䊚 2003 Elsevier Inc. All rights reserved. Keywords: Fish; Differential display PCR; ddPCR; Cortisol; Temperature; RAP-PCR

1. Introduction Populations of Fundulus heteroclitus, a small teleost fish are found along the Atlantic Coast of North America, from Newfoundland to central Florida. Along this coast, there is a steep thermal gradient such that Southern habitats have mean annual temperatures approximately 12 8C warmer than habitats at the Northern end of the species range. F. heteroclitus have relatively low migration rates, and population sizes are large, suggesting the possibility of local adaptation to the thermal *Corresponding author. Tel.: q1-604-822-4276; fax: q1604-822-2416. E-mail address: [email protected] (P.M. Schulte).

environments of these populations (Lotrich, 1975; Brown and Chapman, 1991). Indeed, fish from Northern and Southern populations have been shown to differ in swimming performance, developmental rate, and behavior in directions consistent with adaptation to cold and warm temperatures, respectively, (reviewed in Powers and Schulte, 1998). Despite intensive investigation, the physiological, biochemical and genetic mechanisms underlying thermal adaptation in this species are not yet well understood, although some biochemical correlates of physiological performance indicators have been identified. One such biochemical correlate is the metabolic enzyme lactate dehydrogen-

1095-6433/04/$ - see front matter 䊚 2003 Elsevier Inc. All rights reserved. doi:10.1016/S1095-6433Ž03.00292-7

206

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

ase-B (LDH-B). Changes in the coding sequence of Ldh-B and differences in LDH-B specific activity both may play a role in thermal adaptation in F. heteroclitus (Pierce and Crawford, 1997; Crawford and Powers, 1992; DiMichele et al., 1991; DiMichele and Powers, 1982; Place and Powers, 1984). Differences in liver LDH-B specific activity between Northern and Southern populations of F. heteroclitus are sensitive to stress (Schulte et al., 2000). Fish from Northern populations have high resting liver LDH-B activities, which do not change detectably in response to stress. In contrast, LDH-B activity is low in unstressed fish from the Southern population, but increases when the fish are exposed to stress, removing the differences between the populations. These changes in LDHB specific activity are reflected at the mRNA level, and are associated with differences in a glucocorticoid responsive element within the regulatory sequence of Ldh-B (Schulte et al., 2000). The activities of two additional hepatic proteins involved in glycolysis (phosphofructokinase and aldolase) also differ between populations, and exposure to stress changes the specific activities of these enzymes in fish from the Southern, but not the Northern populations, ablating the difference between populations in enzyme activity, just as is the case for LDH-B (DeKoning et al., 2003). This observation suggests the possibility that differences between populations in enzyme expression in laboratory-acclimated fish are related to differences between the populations in the response to stress. To begin to address this question, we have developed a modified differential display PCR (ddPCR) protocol and used it to identify genes whose mRNA levels were altered in response to chronic exposure to stress in the Northern population of F. heteroclitus. We then examined the expression of these genes in fish from Northern and Southern populations at rest and in response to stress using real-time PCR to determine whether there is an association between genes that respond to stress, and genes that differ in expression between populations in unstressed fish. 2. Materials and methods 2.1. Animal care F. heteroclitus were collected from the Northern population near Hampton, New Hampshire, by

Aquatic Research Organisms, and from the Southern population near Bell Baruch Marine Laboratory, South Carolina. Fish were held in recirculating 20-gallon glass aquaria containing brackish water (22 ppt salinity) at a temperature of 20"1 8C with a 12:12 h light–dark cycle. Animals were fed twice daily to satiation with Tetramin flake food. Fish were allowed to acclimate to their surroundings for a minimum of 8 weeks prior to experimentation. All experiments were performed according to the guidelines of the Canadian Council on Animal Care, under the appropriate approved animal care protocol (噛9710 and 噛A01-0180). 2.2. Experimental design Fish from the Northern population were exposed to chronic handling stress under normoxic conditions for 7 days, and sampled at 24 h, 48 h, and 7 days following the onset of the stressor. To induce handling stress, fish were netted and transferred into a small bucket containing well-aerated shallow water at 10.00, 13.00, and 16.00 h each day. The bucket was gently agitated to simulate transport stress. After 20 min, fish were returned to their experimental tanks. On the appropriate day, fish were killed and dissected, immediately following exposure to the 10.00 h handling stress. On the day of sampling, fish were individually removed from the aquaria and blood samples were collected via caudal severance using heparinized capillary tubes. Fish were then rapidly killed by decapitation, weighed and sexed. Liver samples were collected, frozen in liquid nitrogen, and stored at y80 8C until use (not longer than 3 weeks). In experiments comparing Northern and Southern fish, an identical protocol was followed except that fish were sampled only at 7 days following the onset of the chronic stress protocol. Plasma cortisol levels for these fish have been previously reported (DeKoning et al., 2003). 2.3. Differential display PCR Total RNA was extracted from F. heteroclitus liver using TriPure Solution (Roche), and treated with 1 U of RNase-free DNase (Promega Corp.). Concentration and purity of total RNA was determined spectrophotometrically and the integrity of the RNA samples was verified using 1.2% agarose formaldehyde gels. Three micrograms of DNAse-

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

207

Table 1 Primer sequences Primer name

Primer sequence

Arbitrary primer A2 Arbitrary primer A3 Arbitrary primer A4 Arbitrary primer A5 Arbitrary primer A6 Adapter primer Actin forward Actin reverse Glycogen synthase kinase forward Glycogen synthase kinase reverse Serine-threonine kinase forward Serine-threonine kinase reverse Glucokinase forward Glucokinase reverse PEPCK forward PEPCK reverse CRAF forward CRAF reverse Warm-acclimation-related protein forward Warm-acclimation-related protein reverse

AATCTAGAGCTCCTC CTC AATCTAGAGCTCCAGCAG AATCTAGAGCTCTCCTGG AATCTAGAGCTCTCCAGC AATCTAGAGCTCCCTCCA AATCTAGAGCTC CCCCATCGAGCACGGTATT AAGGTGTGATGCCAGATCTTCTC CTGTGGGAACTTGAACTCTGTGTAG CGCCAACGAGGGAACAGAT CAGCAGGTGGCACTTTTCATT TCAGTGCGAAAGCAACATGAG TGTCGGCACTGGCTGTAATG CCTTCCACCAGCTCCACTGT CCTACGCACTCCACCTTCCA AAACCAACCTGGCCATGATG TGACGGTGCAGATCATTCTCT CAGGCTGCCCGTTTACACAT GGTCGAGGTCAGCTCCATGA TTGCTCTGGCATGGGCTAAT

treated total RNA was reverse transcribed in a total volume of 20 ml, using 1 ml of a 25 mM equimolar mixture of arbitrary ddPCR primers. The sequences of the arbitrary primers (Table 1) were derived from the RAP-PCR kit (Stratagene). The resulting cDNA was then diluted 10-fold in molecular biology grade water, and 4 ml of the diluted cDNA was used for ddPCR. The amount of cDNA used was optimized to fall within the linear range of the technique. In addition, a nonreverse transcribed control was performed for each sample to check for the presence of contaminating genomic DNA. No amplification was observed from these controls. PCR reactions were performed in a 25 ml volume using Ready-To-Go PCR beads (Amersham Pharmacia Biotech), and 25 pmole each of two randomly selected arbitrary primers (Table 1). All amplifications were performed in a PTC-200 thermocycler (MJ Research Products, Waltham, MA, USA) as follows: one low stringency cycle (1 min at 94 8C, 5 min at 35 8C, 5 min at 72 8C); followed by 29 high stringency cycles (1 min at 94 8C, 2 min at 50 8C and 2 min at 72 8C). Ten pmoles of Cy 5.0 fluorescently labelled adapter primer (Table 1) was added to the PCR product, and the mixture was incubated for 5 min at 90 8C, and then cooled on ice for 2 min. A mix containing 1 ml of dNTPs (25 mM), 3 ml of 5X Klenow Reaction Buffer (500 mM Tris–HCl pH

7.2, 100 mM MgSO4, 1 mM DTT), and 1 ml (10 Uyml) of Klenow fragment (exonuclease minus) (Promega) was added, and the samples were incubated at room temperature for 30 min, followed by 30 min at 37 8C. The fluorescently tagged PCR products were then mixed 1:1 with a formamide gel loading dye (80% formamide, 50 mM Tris– HCl pH 6.8, 1 mM EDTA, 0.25% (wyv) bromocresol green) and heated for 2 min at 80 8C. The samples were separated at 1700 V and 55 W for 3 h on a 6% acrylamide (19:1 acrylamide:bisacrylamide)—7 M urea denaturing polyacrylamide sequencing gel prepared in 1X Tris–borate–EDTA buffer. The acrylamide was allowed to polymerize at least 2 h before use and the gel was preelectrophoresed at least 30 min prior to loading 7.5 ml of each heated sample. Loading dye (7.5 ml) without sample was loaded into the two lanes immediately flanking the samples to minimize diffusion of samples and to facilitate the excision of bands. PCR products were visualized using the red fluorescence mode on a Storm 860 Imaging System (Molecular Dynamics Corp.). Bromcresol green does not fluoresce at these wavelengths, and thus does not interfere with the visualization of the bands. To facilitate band excision, every half hour throughout electrophoresis, 7.5 ml of loading dye containing bromophenol blue, which is visible to the naked eye and fluoresces at the wavelengths monitored, was added to the lanes flanking the

208

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

sample lanes. An actual-size print out of the fluorescent gel image was aligned under the gel by matching the bromophenol blue loading dye marks visible on the gel to those on the printout. Bands of interest were then excised with a razor blade and transferred into 1.5 ml microcentrifuge tubes using tweezers. Both the razor blades and tweezers were cleaned with 95% ethanol between each band excision. The gel was re-scanned to confirm that the correct bands had been excised. The gel slices were incubated in 100 ml of diffusion buffer (0.5 mM ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA pH 8.0, 0.1% SDS) at 50 8C for 30 min and the DNA was eluted using the QiaexII gel extraction kit (Qiagen Corp.) following the manufacturer’s instructions for elution of DNA from acrylamide gels. The eluted band was re-amplifed using the identical PCR conditions and primer combinations as in the initial PCR. Reaction products were electrophoresed on a 2% agarose gel for 2 h at 80 V and DNA fragments were excised and purified using the Qiaex extraction kit (Qiagen Corp). The PCR products were subsequently cloned into either the EcoRI site of pGem T-easy (Promega, Madison, WI, USA) or into the EcoRV site of bluescript KSy (Stratagene Inc) and transformed into heatshock competent Escherichia coli JM109 cells (Promega). Plasmids were isolated from at least three colonies for each band using the Genelute Plasmid Miniprep Kit (Sigma), and sequences were obtained using automated fluorescent DNA sequencing. 2.4. Sequence analysis Vector sequence and ddPCR primers were removed using the Seqman and EditSeq Modules of the Lasergene99 sequence analysis package (DNAstar Inc.), and all sequences from a single PCR product were aligned to determine if more than one sequence was represented in the pool of clones. Trimmed sequences were compared to those in Genbank using NCBI BLAST software, version 1.8 (Altschul et al., 1997). All sequences were analyzed using both Blastn and tBlastx. Blastn was used in combination with nucleotide and expressed sequence tag (EST) databases, and tblastx was used in combination with the nucleotide database only.

2.5. Real-time PCR Real-time PCR primers were designed using Primer Express version 2.0.0 (Applied Biosystems) for a selection of the sequences obtained by ddPCR. Primer sequences are outlined in Table 1. In addition, Dr Tom Singer kindly provided a sequence of F. heteroclitus actin, which we used to developed primers as a normalization control. Five microgram of total RNA was reversed transcribed using an oligo dT primer as described above. Real-time PCR was performed using an ABI Prism 7000 (Applied Biosystems). PCR reactions contained 1 ml of cDNA, 150 pmoles of each primer and Universal SYBR green master mix (Applied Biosystems), in a total volume of 25 ml. All real-time PCR reactions were performed as follows: 2 min at 50 8C, 10 min at 95 8C, followed by 40 cycles of 95 8C for 15 s and 60 8C for 1 min. Melt curve analysis was performed following each reaction to confirm the presence of only a single product of the reaction. In addition, representative PCR products were electrophoresed on a 2.5% agarose gel to verify that only a single band was present. Negative control reactions were performed for all samples using RNA that had not been reverse transcribed to control for the possible presence of genomic DNA contamination. Genomic DNA contamination was present in many samples, but never constituted more than 1 in 78 000 starting copies even for genes with relatively low expression levels. As a result, only a negligible fraction of the real-time PCR signal was attributable to genomic DNA. One randomly selected control sample was used to develop a standard curve relating threshold cycle to cDNA amount for each primer set. The results interpolated from these standard curves were expressed relative to the actin signal. Actin mRNA levels did not differ significantly between populations or in response to stress, and thus can appropriately be used as a normalization control. Similar patterns, but with higher variance, were observed when the data were expressed relative to total RNA, confirming the utility of the normalization procedure. 2.6. Statistical analysis Real-time PCR data were analyzed by two-way analysis of variance (ANOVA) with treatment and population as the factors. Data were log transformed where necessary to meet assumptions of

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

209

Fig. 1. Within-sample and inter-individual variation revealed by ddPCR. Liver samples were obtained from three individuals from the New Hampshire population of F. heteroclitus (labeled individuals 1, 2, and 3). Two independent RNA isolations and reverse transcriptions were performed for each individual (labeled RTa, RTb). Two ddPCRs using primer set A2yA5 were performed for each reverse transcribed RNA isolate, resulting in a total of four ddPCRs per individual. Arrows indicate bands that differ among individuals.

homogeneity of variance. When interaction terms were significant, the data were separated and analyzed independently using one-way ANOVA. If significant differences were detected in the initial ANOVAs, post-hoc comparisons were performed among the groups with the Bonferroni multiple comparison test (as0.05). 3. Results 3.1. Isolation of putative differentially expressed genes Optimization experiments indicated that the ddPCR procedure produced reproducible patterns within an individual across multiple replicates, but revealed substantial variation among individuals (Fig. 1). On average, approximately 15% of bands varied among individuals within a single gel. For all gels involving experimental samples, we therefore, performed a single reaction for each individual, but tested several individuals for each condition. Twenty differentially expressed bands were obtained from Northern fish exposed to stress (differentially expressed bands were arbitrarily

defined as those that were up- or down-regulated in at least two individuals). These bands were cloned and sequenced, along with two bands with high and constant expression. Ten of the clones isolated by ddPCR had no clear match with sequences in Genbank or matched with genes of no known function and have been deposited under the following accession numbers: CD670459, CD670460, CD670461, CD670463, CD670465, CD670466, CD670473, CD670474, CD670476, CD670477. The accession numbers of the remaining 10 differentially expressed bands and the two constant bands are listed in Table 2, along with their putative identifications, based on matches to Genbank. At least three clones were sequenced for all bands, and the majority of bands yielded only a single sequence. However, three bands yielded multiple sequences. Sequencing additional bands generally allowed us to select the major product. However, for one band, we were unable to identify a clear majority candidate. We sequenced a total of 30 clones for this band. From these 30 clones, we obtained a total of 15 different sequences. One sequence was present in 8 of the 30 clones (or 27% of the pool). This sequence had no clear

210

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

Table 2 Clones isolated by ddPCR with matches to proteins of known function Clone ID

Clone accession number

Primer set

Response in DdPCR

Putative gene name (based on Blast ID)

Blast e-value

s1L1

CD670462

A2yA5

CD670472

A2yA5

CDC-42 binding protein kinase beta Glucokinase

2=10y20

s3U2 Strs22

CD670479

A2yA3

CD670478 CD670480

A2yA4 A2yA3

1=10y112 2=10y14

s4U1

CD670475

A2yA5

Glycogen synthase kinase 3 PEPCK Serineythreonine kinase 10 cRAF

8=10y39

St1d Strs211

s1u1

CD670464

A2yA5

PACSIN2

7=10y19

s3

CD670469

A3yA6

Apical-like protein

9=10y7

s3L1

CD670470

A2yA5

Transferrin

6=10y11

S3U1

CD670471

A2yA5

CD670468

A2yA5

s2L1

CD670467

A2yA5

Constant

Glutathione-Stransferase Initiation factor 2 alpha subunit Warm temperature acclimation-related 65-kDa protein

9=10y33

s2L2

Down-regulated 24 and 48 h Up-regulated 24 and 48 h Up-regulated 48 h and 7 days Up-regulated 7 days Up-regulated 48 h and 7 days Down-regulated 24, 48 h and 7 days Down-regulated 24 and 48 h Up-regulated 48 h Up-regulated 24 and 48 h Up-regulated 24 and 48 h Constant

match in Genbank. A second sequence was present in five of the 30 clones (16% of the pool), and was similar to a serine-threonine kinase. Three of the clones (or 10% of the pool) were similar to an HSP (heat shock protein) binding protein, two clones (or 6% of the pool) were similar to mitochondrial NADP-isocitrate dehydrogenase, and two clones (6% of the pool) were similar to glycogen synthase kinase. The remaining 10 of the 15 sequences were unique, represented by only a single clone (or 3% of the pool each). Both glycogen synthase kinase and serine-threonine kinase were independently cloned from other bands that were differentially expressed in response to stress (Table 2), but in situations such as this, it is difficult to determine which of the clones obtained from this band is responsible for the observed differential expression. This observation underlines the necessity for confirming the differential expression of the sequences obtained by ddPCR, although we should emphasize that the majority of the bands we sequenced yielded only a single product. As a first step towards confirming differential expression, we performed Northern analysis on several randomly selected clones.

4=10y37

1=10y22

5=10y44 9=10y13

Northern analysis supported the results of the ddPCR (data not shown), suggesting that the ddPCR technique produced reasonably reliable results. 3.2. Comparison of gene expression in Northern and Southern F. heteroclitus Using the ddPCR technique, we then compared gene expression in the livers of F. heteroclitus from the Northern and the Southern population at rest and then exposed to stress for 7 days. Fig. 2 shows a typical example of these ddPCR gels. The primary impression from these analyses is of high inter-individual variation. Few bands were uniformly expressed in all individuals within a treatment group (despite the observation in preliminary experiments that multiple replicate ddPCRs from a single individual always yielded the same banding pattern; Fig. 1). The majority of bands did not show any consistent differences between populations or in response to stress within a population. However, we were able to identify putatively differentially expressed bands on most gels, as indicated by the arrow.

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

Fig. 2. Effects of 7 days of repeated stress on gene expression in Northern and Southern populations of F. heteroclitus. Representative ddPCR reactions using primers A2yA4 of four individuals from each population of F. heteroclitus, either at rest (North Control; South Control) or following stress (North Stress; South Stress).

To further explore differences in gene expression in response to stress between these two populations, we next chose six genes (indicated in bold in Table 2) that were a priori expected to be involved in the stress response, based on work in other species, and examined their expression using real-time (kinetic) PCR. It was not possible to design effective real-time PCR primers for cdc42, likely because the clone isolated by ddPCR was less than 100 bp in length, so this clone was not analyzed further. In addition, we selected one gene (Warm acclimation-related protein) that did not change in response to stress in ddPCR. This gene has been implicated in thermal acclimation in goldfish (Kikuchi et al., 1995), and thus is an interesting candidate gene that might relate to thermal acclimation or adaptation in F. heteroclitus. The results of the real-time PCR analyses are presented in Fig. 3. Three of these genes showed similar expression patterns (glucokinase, serinethreonine kinase and cRAF). For these genes,

211

expression differed between populations at rest, and mRNA levels increased in response to stress in the Southern, but not the Northern populations. For glucokinase, there was a significant interaction term (Ps0.006) in two-way ANOVAs, so the data were analyzed independently. These tests indicated that there was a significant difference between the Northern and Southern controls (P-0.01), with levels of glucokinase mRNA being higher in Northern fish than in Southern fish. In Southern fish, glucokinase mRNA increased significantly in response to stress (P-0.05). In contrast, in Northern fish, glucokinase mRNA declined in response to stress, although this difference was not quite significant (Ps0.051). For serine-threonine kinase, there was a significant effect of population (Ps0.003), a significant effect of treatment (Ps 0.045), and a significant interaction term (Ps 0.042). In post-tests, there was a significant change in serine-threonine kinase mRNA level in response to stress (Ps0.013) in the Southern population, and a significant difference between populations in control fish (P-0.05). There were substantial differences in the variances among groups for cRAF, but two-way ANOVA detected a significant interaction term for the log-transformed data (P0.05), and post-tests indicated a marginally significant difference between Northern and Southern controls (Ps0.052), and a nearly significant effect of stress in the Southern population (Ps0.051), a pattern similar to that observed for glucokinase and serine-threonine kinase. The results of real-time PCR analyses did not support differential expression in response to stress for PEPCK or glycogen synthase kinase, in either population. However, for glycogen synthase kinase, there was a significant effect of population in the two-way ANOVA (Ps0.029), although this apparent difference between populations could not be detected in post-hoc analyses. Southern fish had generally higher levels of glycogen synthase kinase mRNA than did Northern fish, for both control and stressed fish. Warm acclimation-related protein showed a significant effect of population (Ps0.001), but no significant effect of treatment (Ps0.997) and no significant interaction term (Ps0.849), with mRNA levels being approximately eight-fold higher in Southern fish than in Northern fish.

212

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

Fig. 3. Interpopulation differences and changes in gene expression in response to stress in two populations of F. heteroclitus. Panel A. glucokinase. Panel B. serine-threonine kinase. Panel C. cRAF. Panel D. PEPCK. Panel E. glycogen synthase kinase. Panel F. warmacclimation-related protein. All values are signal for the gene of interest relative to actin (arbitrary units). Note that mRNA levels determined by real-time PCR are normalized to standard curve generated from a randomly chosen control individual. †Significantly different between populations (P-0.05); *Significantly different from controls (P-0.05). ns6–8 per group.

4. Discussion 4.1. Optimization of ddPCR and isolation of putative differentially expressed genes Half of the genes isolated from ddPCR gels of F. heteroclitus livers had no known match in Genbank or matched to sequences with no known function. This result is typical of expressed sequence surveys in a variety of different organisms. For example, in a survey of expressed sequences in hamster testes, approximately 60% of the isolated cDNAs were either novel or matched to genes with no known function (Oduru

et al., 2003). Similarly, in a recent screen of zebrafish ESTs, approximately 50% of the isolated ESTs failed to match known or predicted proteins in the non-redundant database (Lo et al., 2003), and only 38% of the differentially expressed genes could be identified in a survey of differential gene expression in response to cold acclimation in the brain of channel catfish (Ju et al., 2002). The observation of isolation of large numbers of unidentified genes is unlikely to simply be a product of a bias towards isolation of rapidly evolving untranslated regions in EST and ddPCR screens, since most genomes contain a high proportion of unidentifiable genes. For example, approximately

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

41% of the predicted protein coding sequences in the complete genome of filamentous fungus, Neurospora crassa, lack similarity to known proteins (Galagan et al., 2003). One of the striking features revealed by the ddPCR was the high level of inter-individual variation. On average, approximately 15% of the bands observed in a given ddPCR experiment varied among individuals. This is very similar to the level of inter-individual variation revealed by microarray analysis of gene expression in F. heteroclitus hearts (Oleksiak et al., 2002), in which 18% of genes exhibited statistically significant variation in expression among individuals within a population, and underlines the importance of examining multiple individuals when surveying gene expression patterns in natural populations. Using ddPCR, we isolated 10 putatively differentially expressed cDNA fragments from Northern fish that had strong matches to genes of known function (Table 2). For four of these genes (apical like protein, PACSIN, transferrin and glutathioneS-transferase), there is no a priori evidence of differential expression in response to stress from experiments in other species. However, PACSIN (Ritter et al., 1999; Houle et al., 2003), transferrin (Hentze and Kuhn, 1996), and glutathione-S-transferase (see for example Hayes and Strange, 2000) may be involved in the response to oxidative stress in mammals. It has previously been suggested that exposure to chronically high levels of glucocorticoids can induce oxidative stress in mammals (Briehl et al., 1997; Orzechowski et al., 2002). However, since the connection between these genes and the glucocorticoid-mediated stress response is unlikely to be direct, they were not selected for further analysis, and their differentially expressed status in F. heteroclitus should be regarded as unconfirmed. Six of the ten differentially expressed genes isolated by ddPCR are known to be glucocorticoidregulated in other organisms. PEPCK, glucokinase and glycogen synthase kinase are central metabolic enzymes involved in glycolysisygluconeogenesis. Glucocorticoids induce PEPCK in mammals (Sharma and Patnaik, 1983) and fish (Vijayan et al., 1997). Glucokinase has been shown to be induced by glucocorticoids in rat hepatocytes (Schudt, 1979), and glucocorticoids may also play a role in the regulation of glycogen synthase kinase (Exton et al., 1981; Gunin et al., 2003). The remaining three genes (cdc42, cRAF, and serine-

213

threonine kinase-10) are involved in stress-regulated signal transduction. Cdc42 has been shown to participate in a stress-activated pathway in rat hepatocytes (Auer et al., 1998). Raf1 (cRAF) has been shown to interact with the glucocorticoid receptor (Widen et al., 2000), and the promoter of A-raf contains glucocorticoid-responsive elements (Lee et al., 1996). Serine-threonine kinase 10 is a polo-like kinase that is known to be involved in variety of stress-regulated pathways (Bahassi et al., 2002). 4.2. Analysis of expression in Northern and Southern populations To test the hypothesis that there is a relationship between the stress response and differences in gene expression between F. heteroclitus populations, we selected these six putative stress-regulated genes for further analysis in both Northern and Southern populations, because we and others, (for example see Roschier et al., 2000) have observed a potentially high rate of false positives in ddPCR, it is critical to confirm putatively differentially expressed genes using another technique. We were able to assess the expression of five of these six putatively stress-regulated genes using real-time (kinetic) PCR (appropriate primers could not be designed for cdc42). Real-time PCR has a number of advantages over ddPCR, microarray and Northern blotting as a means of quantitatively assessing gene expression. It has an extremely wide linear dynamic range, allowing accurate quantification of gene expression, and is relatively fast and inexpensive to perform, allowing multiple samples to be assessed in parallel. Using real-time PCR, we found that two of the five putatively glucocorticoid-regulated genes were differentially expressed in response to 7 days of chronic stress in F. heteroclitus livers (glucokinase and serinethreonine kinase 10), and an additional gene (cRAF) had nearly significant changes in expression. All three of these genes increased in expression in Southern fish when exposed to stress, but did not change in Northern fish. Only one gene showed some change in expression in Northern fish in response to stress; mean glucokinase level decreased slightly in response to stress in the Northern fish (Ps0.051). Note that this observation is in direct contrast to our results from ddPCR, since all of these genes were selected because of putative differential expression in response to

214

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

stress in Northern fish. Either these genes represent fortuitous false positives generated by the ddPCR technique or these genes may respond to stress in some individuals of the Northern population, but not in sufficient numbers or to a sufficient degree to result in a statistically significant change in gene expression when assessed using real-time PCR. It is possible, for example, that Northern fish require a more pronounced or prolonged exposure to a stressor in order to respond at the molecular level, but that the nature of the response, and the genes involved might be similar between populations. All of the genes that we confirmed as being regulated by chronic stress in Southern populations of F. heteroclitus also differed between the Northern and Southern populations in control (‘unstressed’) fish. This observation is consistent with our hypothesis that there is some connection between an altered stress-response and differences in gene expression among populations in ‘unstressed’ F. heteroclitus acclimated to laboratory conditions (DeKoning et al., 2003). Three out of five (or 60%) of the putatively stress-regulated genes that we examined (and all of the genes that we confirmed as stress regulated in the Southern population) differed between populations in control fish. This is a surprisingly high proportion of genes that differ between populations, given that the original differential display screen was performed on Northern fish only in an effort to locate stress-regulated genes. In a survey of 907 genes expressed in F. heteroclitus and Fundulus grandis hearts, Oleksiak et al. (2002) found only approximately 2% of the genes examined differed in expression between Northern and Southern populations of F. heteroclitus. When gene expression data from Southern F. heteroclitus and Fundulus grandis were pooled, approximately 3% of the genes examined differed in the Northern population of F. heteroclitus. Either far more genes differ in expression between populations in the livers than in hearts of F. heteroclitus or selecting for stress-regulated genes enriches for genes that differ between populations. Alternatively, it is possible that microarray is an insensitive measure of differential expression compared with real-time PCR. The patterns of gene expression that we observed for the genes surveyed here differed from that observed for Ldh-B (Schulte et al., 2000; DeKoning et al., 2003). Glucokinase and cRAF expression were greater in the Northern fish, while

serine-threonine kinase and glycogen-synthase kinase were greater in the Southern fish, and exposure to chronic stress did not remove the differences between populations. In fact, for serinethreonine kinase, the difference in expression between the populations was increased by exposure to chronic handling stress. These results indicate that the relationship between the stress-response and liver gene expression in this species, if any, is likely to be complex. In addition, one gene that was not confirmed as stress-responsive (glycogen synthase kinase) differed between populations as detected by two-way ANOVA, confirming that any link between the stress-response and differences between populations does not exclude differences among populations in genes that are not involved in the stress response. We also selected for analysis one gene that had high and constant expression in ddPCR of Northern fish, because of its possible role in thermal acclimation in fish (Kikuchi et al., 1995). This gene, warm-acclimated-related protein did not respond to stress in either population (consistent with the results of the ddPCR in Northern fish), but differed markedly between populations (approximately eight-fold; P-0.001). Warm-acclimation-related protein was first identified as a differentially expressed protein in two-dimensional electrophoretic analysis of goldfish (Carassius auratus) acclimated at 10 and 30 8C (Kikuchi et al., 1993). The gene coding for this protein has subsequently been cloned in goldfish (Kikuchi et al., 1995), common carp (Cyprinus carpio; Kinoshita et al., 2001), and rainbow trout (Miot et al., 1996), and has been shown to be upregulated in the liver in response to acclimation to elevated environmental temperatures in several fish species. The fish used in the present study were acclimated to a common temperature of 20 8C, a temperature at the lower end of the thermal range for Southern populations of F. heteroclitus, and at the higher end of the natural thermal range for Northern populations. However, we observed higher levels of this protein in the Southern fish, suggesting a possible role in adaptation to warm temperatures, in addition to its previously implicated role in thermal acclimation in fish. Warm-acclimationrelated protein shares some similarities with mammalian hemopexin, a serum glycoprotein that transports heme to the liver, but the function of the protein in fish remains unknown. In mammals, it has been suggested that hemopexin may also

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

protect the liver against oxidative stress (Brass et al., 1998). This observation opens the possibility of a link between oxidative stress and thermal adaptation or acclimation, which has been previously suggested (Portner, 2002). Overall, we have shown that a number of genes are differentially regulated by chronic stress in F. heteroclitus liver, and that differential expression in response to stress is observed in fish from the Southern, but not the Northern populations. All of the genes that we confirmed to respond to stress in the Southern population also differed between populations in unstressed fish, providing support to the hypothesis that there is a relationship between the stress-response and differences in liver gene regulation between Northern and Southern populations of F. heteroclitus. However, some genes that did not respond to stress also differed in expression between populations, suggesting a more complex regulatory pattern underlying differences in gene expression between populations. Acknowledgments This work was supported by a Natural Sciences and Engineering Research Council (NSERC) of Canada discovery grant and an NSERC strategic projects grant to P.M. Schulte. We thank Aline Fiebig for her assistance in stress experiments involving Northern fish and Kathleen Pendlebury for technical assistance. References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., et al., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Auer, K.L., Contessa, J., Brenz-Verca, S., Pirola, L., Rusconi, S., Cooper, G., et al., 1998. The RasyRac1yCdc42ySEKy JNKyc-Jun cascade is a key pathway by which agonists stimulate DNA synthesis in primary cultures of rat hepatocytes. Mol. Biol. Cell 9, 561–573. Bahassi, el.-M., Conn, C.W., Myer, D.L., Hennigan, R.F., McGowan, C.H., Sanchez, Y., et al., 2002. Mammalian Polo-like kinase 3 (Plk3) is a multifunctional protein involved in stress response pathways. Oncogene 21, 6633–6640. Briehl, M.M., Baker, A.F., Siemankowski, L.M., Morreale, J., 1997. Modulation of antioxidant defenses during apoptosis. Oncol. Res. 9, 281–285. Brass, C.A., Immenschuh, S., Song, D.X., Liem, H.H., Eberhard, U.M., 1998. Hemopexin decreases spontaneous chemiluminescence of cold preserved liver after reperfusion. Biochem. Biophys. Res. Commun. 248, 574–577.

215

Brown, B.L., Chapman, R.W., 1991. Gene flow and mitochondrial DNA variation in the killifish, Fundulus heteroclitus. Evolution 45, 1147–1161. Crawford, D.L., Powers, D.A., 1992. Evolutionary adaptation to different thermal environments via transcriptional regulation. Mol. Biol. Evol. 9, 806–813. DeKoning, A.B.L., Picard, D.J., Bond, S.R. Schulte, P.M., 2003. Stress and inter-population variation in glycolytic enzyme activity and expression in a teleost fish, Fundulus heteroclitus. Physiol. Biochem. Zool. (in press). DiMichele, L., Powers, D.A., 1982. Physiological basis for swimming endurance differences between LDH-B genotypes of Fundulus heteroclitus. Science 216, 1014–1016. DiMichele, L., Paynter, K.T., Powers, D.A., 1991. Evidence of lactate dehydrogenase-B allozyme effects in the teleost, Fundulus heteroclitus. Science 253, 898–900. Exton, J.H., Blackmore, P.F., El-Refai, M.F., Dehaye, J.P., Strickland, W.G., Cherrington, A.D., et al., 1981. Mechanisms of hormonal regulation of liver metabolism. Adv. Cyclic. Nucleotide Res. 14, 491–505. Galagan, J.E., Calvo, S.E., Borkovich, K.A., Selker, E.U., Read, N.D., Jaffe, D., et al., 2003. The genome sequence of the filamentous fungus Neurospora crassa. Nature 422, 859–868. Gunin, A.G., Emelianov, V.U., Tolmachev, A.S., 2003. Expression of estrogen receptor-alpha, glucocorticoid receptor, beta-catenin and glycogen synthase kinase-3beta in the uterus of mice following long-term treatment with estrogen and glucocorticoid hormones. Eur. J. Obstet. Gynecol. Reprod. Biol. 107, 62–67. Hayes, J.D., Strange, R.C., 2000. Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology 61, 154–166. Hentze, M.W., Kuhn, L.C., 1996. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc. Natl. Acad. Sci. USA 93, 8175–8182. Houle, F., Rousseau, S., Morrice, N., Luc, M., Mongrain, S., Turner, C.E., et al., 2003. Extracellular signal-regulated kinase mediates phosphorylation of tropomyosin-1 to promote cytoskeleton remodeling in response to oxidative stress: impact on membrane blebbing. Mol. Biol. Cell 14, 1418–1432. Ju, Z., Dunham, R.A., Liu, Z., 2002. Differential gene expression in the brain of channel catfish (Ictalurus punctatus) in response to cold acclimation. Mol. Genet. Genomics 268, 87–95. Kikuchi, K., Yamashita, M., Watabe, S., Aida, K., 1995. The warm temperature acclimation-related 65-kDa protein, Wap65, in goldfish and its gene expression. J. Biol. Chem. 270, 17 087–17 092. Kikuchi, K., Watabe, S., Suzuki, Y., Aida, K., Nakajima, H., 1993. The 65-Kda cytosolic protein associated with warm temperature acclimation in goldfish, Carassius auratus. J. Comp. Physiol. B 163, 349–354. Kinoshita, S., Itoi, S., Watabe, S., 2001. cDNA cloning and characterization of the warm-temperature-acclimation-associated protein Wap65 from carp, Cyprinus carpio. Fish Physiol. Biochem. 24, 125–134. Lee, J.E., Beck, T.W., Wojnowski, L., Rapp, U.R., 1996. Regulation of A-raf expression. Oncogene 12, 1669–1677.

216

D.J. Picard, P.M. Schulte / Comparative Biochemistry and Physiology Part A 137 (2004) 205–216

Lo, J., Lee, S., Xu, M., Liu, F., Ruan, H., Eun, A., et al., 2003. 15 000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis. Genome Res. 13, 455–466. Lotrich, V.A., 1975. Summer home range and movements of Fundulus heteroclitus (Pisces: Cyprinodontidae) in a tidal creek. Ecology 56, 191–198. Miot, S., Duval, J., Le Goff, P., 1996. Molecular cloning of a hemopexin-like cDNA from rainbow trout liver. DNA Sequence 6, 311–318. Oduru, S., Campbell, J.L., Karri, S., Hendry 3rd, W.J., Khan, S.A., Williams, S.C., 2003. Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs. BMC Genomics 4, 22. Oleksiak, M.F., Churchill, G.A., Crawford, D.L., 2002. Variation in gene expression within and among natural populations. Nat. Genet. 32, 261–266. Orzechowski, A., Ostaszewski, P., Wilczak, J., Jank, M., Balasinska, B., Wareski, P., et al., 2002. Rats with a glucocorticoid-induced catabolic state show symptoms of oxidative stress and spleen atrophy: the effects of age and recovery. J. Vet. Med. A. Physiol. Pathol. Clin. Med. 49, 256–263. Pierce, V.A., Crawford, D.L., 1997. Phylogenetic analysis of glycolytic enzyme expression. Science 276, 256–259. Place, A.R., Powers, D.A., 1984. Kinetic characterization of the lactate dehydrogenase (LDH-B4 ) allozymes of Fundulus heteroclitus. J. Biol. Chem. 259, 1309–1318. Portner, H.O., 2002. Climate variations and the physiological basis of temperature dependent biogeography: systemic to molecular hierarchy of thermal tolerance in animals. Comp. Biochem. Physiol. A 132, 739–761.

Powers, D.A., Schulte, P.M., 1998. Evolutionary adaptations of gene structure and gene expression in natural populations in relation to a changing environment: a multidisciplinary approach to address the million-year saga of a small fish. J. Exp. Zool. 282, 71–94. Ritter, B., Modregger, J., Paulsson, M., Plomann, M., 1999. PACSIN 2, a novel member of the PACSIN family of cytoplasmic adapter proteins. FEBS Lett. 454, 356–362. Roschier, M., Kuusisto, E., Salminen, A., 2000. A differential display protocol to identify differentially expressed mRNAs in potassium-deprived cerebellar granule cells. Brain Res. Brain Res. Protoc. 5, 121–131. Schudt, C., 1979. Hormonal regulation of glucokinase in primary cultures of rat hepatocytes. Eur. J. Biochem. 98, 77–82. Schulte, P.M., Glemet, H.C., Fiebig, A.A., Powers, D.A., 2000. Adaptive variation in lactate dehydrogenase-B gene expression: role of a stress-responsive regulatory element. Proc. Natl. Acad. Sci. USA 97, 6597–6602. Sharma, R., Patnaik, S.K., 1983. Induction of phosphoenolpyruvate carboxykinase by hydrocortisone in rat liver and brain as a function of age. Biochem. Int. 7, 535–540. Vijayan, M.M., Pereira, C., Forsyth, R.B., Kennedy, C.J., Iwama, G.K., 1997. Handling stress does not affect the expression of hepatic heat shock protein 70 and conjugation enzymes in rainbow trout treated with beta-naphthoflavone. Life Sci. 61, 117–127. Widen, C., Zilliacus, J., Gustafsson, J.A., Wikstrom, A.C., 2000. Glucocorticoid receptor interaction with 14-3-3 and Raf-1, a proposed mechanism for cross-talk of two signal transduction pathways. J. Biol. Chem. 275, 39 296–39 301.