Vasoactive intestinal peptide suppresses the NLRP3 inflammasome activation in lipopolysaccharide-induced acute lung injury mice and macrophages

Biomedicine & Pharmacotherapy 121 (2020) 109596

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Vasoactive intestinal peptide suppresses the NLRP3 inflammasome activation in lipopolysaccharide-induced acute lung injury mice and macrophages

T

Yong Zhoua, Chen-Yu Zhanga, Jia-Xi Duanb,c,d, Qing Lie, Hui-Hui Yanga, Chen-Chen Suna, Jun Zhange, Xiao-Qin Luoa, Shao-Kun Liub,c,* a

Department of Physiology, Xiangya School of Medicine, Central South University, Changsha, Hunan 410078, China Department of Respiratory Medicine, the Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, China Research Unit of Respiratory Disease, Central South University, Changsha, Hunan 410011, China d Diagnosis and Treatment Center of Respiratory Disease, Central South University, Changsha, Hunan 410011, China e Department of Physiology, Hunan University of Medicine, Huaihua, Hunan 418000, China b c

ARTICLE INFO

ABSTRACT

Keywords: vasoactive intestinal peptide NLRP3 inflammasome acute lung injury lipopolysaccharide macrophages

Vasoactive intestinal peptide (VIP) is a neuropeptide that exerts anti-inflammatory functions. We have reported that VIP mediated by lentivirus attenuates acute lung injury (ALI) in lipopolysaccharide (LPS)-induced murine model. However, the exact role of VIP in uncontrolled inflammation during ALI is largely unknown. Accumulating evidence indicates that the NLRP3 inflammasome has a critical role during ALI. In this study, we investigated the effects of VIP on the activation of NLRP3 inflammasome during the development of ALI in mice. Seven days after the intratracheal injection of VIP-lentivirus, a murine ALI model was induced by intratracheal injection of LPS. VIP-lentivirus significantly reduced the expression of NLRP3 inflammasome components in lung tissue, including NLRP3, pro-caspase-1, pro-IL-1β, and pro-IL-18. VIP-lentivirus also inhibited the formation of caspase-1 p10 and the maturation of IL-1β and IL-18. In vitro, exogenous VIP pre-treatment inhibited the priming of NLRP3 inflammasome in murine primary peritoneal macrophages, indicated by down-regulation of expression of NLRP3 inflammasome components. VIP pre-treatment effectively prevented the LPS-induced degradation of IκB and the synthesis of the downstream of NF-κB, including TNF-α and IL-17A. Furthermore, VIP pre-treatment pronouncedly suppressed the autoproteolysis of caspase-1 and the secretion of IL-1β and IL-18 induced by LPS plus ATP in macrophages. In addition, VIP inhibited the generation of reactive oxygen species in macrophages by decreasing NOX1 and NOX2 expression. These findings illustrate one mechanism that VIP attenuates ALI induced by LPS through inhibiting the activation of the NLRP3 inflammasome and encourage further studies assessing the therapeutic potential of VIP to ALI.

1. Introduction Vasoactive intestinal peptide (VIP) is a member of the secretin/ glucagon family of peptides. It is a 28-amino acid neuropeptide found largely in the brain and gastrointestinal [1]. VIP acts through three Gprotein coupled receptors, namely VPAC1, VPAC2, and PAC1, which are expressed in several organs [2]. Evidence has accumulated, suggesting that VIP and its receptors have been implicated in the homeostasis in the lung [3–5]. Our previous studies have shown that VIP enhances wound healing and proliferation of human bronchial epithelial cells, associated with activation of cAMP-response element-binding protein (CREB) via protein kinases A (PKA) and extracellular regulated

⁎

protein kinases (ERK) dependent pathways [6–8]. Acute lung injury (ALI) is a severe complication caused by stress situations such as trauma, burns, or sepsis, with high rates of morbidity and mortality. Up to now, ALI has no specific and effective treatment [9]. Recently, we found that VIP ameliorated ALI in lipopolysaccharide (LPS)-induced murine model [4]. Although we have reported that VIP inhibits the expression of interleukin (IL)-17A [10] and triggering receptors expressed on myeloid cells-1 (TREM-1), an inflammatory amplifier receptor [11], the exact mechanism remains to be fully elucidated. The inflammasome is an intracellular supramolecular complex, comprising a sensor molecule, an adaptor ASC, and an effector protease caspase-1 [12]. The NACHT, LRR, and PYD domains-containing protein 3

Corresponding author at: Department of Respiratory Medicine, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, China. E-mail address: [email protected] (S.-K. Liu).

https://doi.org/10.1016/j.biopha.2019.109596 Received 20 August 2019; Received in revised form 17 October 2019; Accepted 26 October 2019 0753-3322/ © 2019 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

(NLRP3) is the most well-characterized inflammasome sensor molecule [12]. The full activation of the NLRP3 inflammasome needs a minimum of two signals/steps in most cell types. The first signal primes the cell by initiating transcription of the NLRP3 gene called the priming of NLRP3 inflammasome. Priming occurs through the engagement of pattern recognition receptors (PRRs), such as Toll-like receptors (TLRs), which activate nuclear factor (NF)-κB [12,13]. The next step is the activation of NLRP3 when the primed cell is subjected to a permissive cellular context, inducing the formation of the NLRP3-ASC-caspase-1 complex [14]. Extracellular adenosine triphosphate (ATP) and cholesterol crystals could function as signal 2, leading to NLRP3 inflammasome assembly, autoproteolysis of caspase-1, and the maturation of IL-1β and IL-18 [15]. Activation of NLRP3 inflammasome involves numerous acute and chronic diseases, such as acute myocardial infarction [16] and atherosclerosis [15]. Accumulating evidence indicate that the NLRP3 inflammasome has a critical role during ALI [17,18]. LPS fails to induce ALI in nlrp3-/- or caspase-1-/- mice [17]. Interestingly, inhibition of NLRP3 inflammasome is the critical mechanism for some mediators, which exert a protective effect against ALI, such as melatonin [19], pirfenidone [20], and xanthohumol [21]. To the best of our knowledge, there is no report about the effect of VIP on the activation of NLRP3 inflammasome. VIP is the most abundant neuropeptides of the human body and secreted in the central and peripheral nervous systems [22]. Upon binding to its receptors, VIP stimulates intracellular production of cyclic adenosine 3’5’-monophosphate (cAMP) in various cell types, including macrophages [2]. The increase of cAMP induced by VIP activates PKA and protein kinases C (PKC), which thereby inhibits NF-κB in macrophages [2]. In another study, VIP reduces reactive oxygen species (ROS) production by NADPH oxidase (NOX) in primary human phagocytes [23]. Since NF-κB activation and ROS are critical factors regulating the activation of the NLRP3 inflammasome, we hypothesized that VIP might inhibit the activation of the NLRP3 inflammasome, contributing to its therapeutic effect against ALI. In the present study, we have investigated the effect of VIP on the activation of NLRP3 inflammasome in LPS-induced ALI murine model in vivo and primary peritoneal macrophages in vitro.

undergone a series of detection as follows. All surgeries were performed under anesthesia with pentobarbital sodium (80 mg/kg). 2.3. Collection of bronchoalveolar lavage fluid (BALF) Six hours after the LPS injection, mice were sacrificed, and the blood was removed as far as possible. Then 0.8 mL chilled saline was intratracheally injected and recovered slowly. It was repeated three times, as we previously described [25]. Collected BALF was centrifuged at 1500 rpm for 5 min. The ATP content in the supernatant of BALF was detected by the corresponding kit (Beyotime, Jiangsu, China). 2.4. Isolation of murine primary peritoneal macrophages Murine primary peritoneal macrophages were isolated according to our previous study [26]. Briefly, mice were intraperitoneally injected with 3 mL 3% thioglycolate (Sigma-Aldrich). Four days later, peritoneal macrophages were lavaged with 5 mL cooled RPMI1640 (Gibco, LifeTechnology, Carlsbad, CA, USA). After centrifugation at 1500 rpm for 10 min at 4 ℃, the cell pellets were resuspended with RPMI1640 containing 10% fetal bovine serum (Gibco) and plated in cell culture plates at a density of 1 × 106 cells/ well. Two hours later, the culture medium was changed completely to remove nonadherent cells. Cells were cultured in a humified CO2 incubator at 37 ℃ and rested overnight before subsequent experiments. 2.5. Cell treatment To determine the role of VIP in the modulation of LPS-stimulated NLRP3 inflammasome priming, we treated primary peritoneal macrophages with LPS (500 ng/mL) with/without the pre-treatment of VIP (1, 10, and 100 nM, Sigma-Aldrich, USA). In some designed experimental, ATP stimuli (5 mM, Sigma-Aldrich) was added to activate the NLRP3 inflammasome following the LPS treatment (500 ng/mL), to assess the effect of VIP on the activation of NLRP3 inflammasome. N-acetyl-Lcysteine (NAC, 0.5 mM, Sigma-Aldrich), a ROS scavenger, was used to detect the effect of ROS on the NLRP3 inflammasome activation. At the designed time-points, cells or supernatant were collected.

2. Materials and Methods 2.1. Animal

2.6. RNA extraction and reverse transcription-polymerase chain reaction (PCR)

Adult Swiss mice (male, 18∼22 g) were purchased from Hunan SJA Laboratory Animal Co., Ltd (Hunan, China). Mice were housed in specific pathogen-free conditions and temperature-controlled (25 ± 2 ℃) facility with a 12-h light/dark cycle. All mice were free to access to water and food. All animal studies were approved by the Ethics Committee of Central South University in accordance with the guideline of the National Institutes of Health.

Total RNA was extracted using TRIzol according to the manufacturer’s instructions (Thermo Fisher Scientific, USA). Reverse transcription reaction was carried out from 1 μg total RNA using the random primers. Quantitative real-time PCR was carried out using SYBR green (Takara Bio Inc.) on a Deep Well Real-Time PCR Detection System (CFX96 Touch, BioRad, Hercules, CA, USA) and gene expression was normalized to GAPDH. Relative gene expression (fold change) was calculated using 2−ΔΔCt methods according to our previous study [27]. The sequences of primers used in this study were shown in Table 1.

2.2. Murine model of ALI and treatment Lentivirus carrying VIP (Lenti-VIP) and GFP (Lenti-control) were purchased from Genechem (Shanghai, China). Mice were randomly divided into four groups: the control group, ALI group, ALI + Lenticontrol group, and ALI + Lenti-VIP group. Lenti-control (5 × 107 TU/ kg, in 50 μL PBS) or Lenti-VIP (5 × 107 TU/kg, in 50 μL PBS) was intratracheally injected. According to our previous study [4], the expression of VIP will reach a peak in lung tissue at the 7th day after injection. So 7 d after the injection of lentivirus, the murine model of ALI was established by an intratracheal injection of LPS (5 mg/kg, O55:B4 from Escherichia coli, Sigma-Aldrich, USA) in 50 μL sterile saline according to our previous study [24]. For intratracheal injection, the trachea was surgically exposed, and solutions were injected with a 26-G syringe. Six hours after the LPS injection, mice were sacrificed and

Table 1 Sequences of primers used in this study.

2

Gene Name

Forward primer (5′→3′)

Reverse primer (5′→3′)

NLRP3 pro-caspase-1 pro-IL-18 pro-IL-1β TNF-α IL-17A NOX1 NOX2 GAPDH

TACGGCCGTCTACGTCTTCT CACAGCTCTGGAGATGGTGA ACGTGTTCCAGGACACAACA CAGGCAGGCAGTATCACTCA AGCCCCCAGTCTGTATCCTT TCTCTGATGCTGTTGCTGCT CGTTCTGACTTGGAGGAAGC GACTGCGGAGAGTTTGGAAG AATTCCATGGCACCGTCAAG

CGCAGATCACACTCCTCAAA CTTTCAAGCTTGGGCACTTC CAAACCCTCCCCACCTAACT AGCTCATATGGGTCCGACAG CTCCCTTTGCAGAACTCAGG CGTGGAACGGTTGAGGTAGT GCAGGTTCCCAGGATTTACA GGTGATGACCACCTTTTGCT TGGACTCCACGACGTACTCA

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

Fig. 1. Lenti-VIP suppressed the activation of NLRP3 inflammasome in the lung of LPS-induced ALI mice. Seven days after the injection of Lenti-VIP (5 × 107 TU/kg) or Lenti-control (5 × 107 TU/kg), mice received LPS injection (5 mg/kg, i.t.) or saline. Mice were sacrificed 6 h after LPS injection. The gene expressions of NLRP3 (A), pro-caspase-1 (B), pro-IL-1β (C), and pro-IL-18 (D) in mice lung were detected by RT-PCR. The protein expression of NLRP3 (E, F) and caspase-1 p10 (E, G) were detected by western blot. The contents of IL-1β (H) and IL-18 (I) in BALF of mice were detected by ELISA. Data were expressed as the mean ± SD. n = 8. *P < 0.05.

2.7. Protein extraction and western blotting

2.8. Measurement of intracellular ROS

The total protein of macrophages or lung tissue was extracted using RIPA (Beyotime, Jiangsu, China) containing protease inhibitor (Roche, USA). The concentration of total protein was determined using the BCA kit (Thermo Fisher Scientific, USA). Protein expression was determined by western blotting according to the previously described protocol [28,29]. Briefly, 30 μg protein was separated in 8% or 12% SDS-PAGE gel, transferred to PVDF membrane and blocked with 5% fat-free milk prior to detection with anti-NLRP3 (1:2000, Abcam, USA), anti-caspase1 p10 (1:1000, Santa Cruz, USA), anti-I-κB (1:2500, Abcam), and antiGAPDH (1:5000, CST, USA). Semi-quantitative protein quantifications were performed using the Quantity One software (Bio-Rad). Western blot experiments were performed in triplicate.

Macrophages were seeded at a density of 1 × 106 cells/well in a 12well plate with a low fluorescent/luminescent background. After treatment, the generation of ROS in macrophages was measured by 2’,7’-dichlorofluorescin diacetate (DCFH-DA, Sigma-Aldrich), which is converted to fluorescent 2’,7’-dichlorofluorescin (DCF) in the presence of peroxides as described earlier [30]. 2.9. Measurement of cytokines Secretion of the mature form of IL-1β and IL-18 in BALF of mice and supernatants of macrophages, and the IL-17A and tumor necrosis factor (TNF)-α released by macrophages in culture media samples were analyzed

3

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

Fig. 2. VIP inhibited the expression of NLRP3 inflammasome primed by LPS in primary peritoneal macrophages. Macrophages were primed by LPS (500 ng/mL) with or without VIP pre-treatment (1, 10, and 100 nM for A-D; 10 nM for E-G). Three hours after the LPS administration, the gene expressions of NLRP3 (A), pro-caspase-1 (B), pro-IL-1β (C), and pro-IL-18 (D) in macrophages were detected by RT-PCR. Twelve hours after the LPS administration, the protein expressions of NLRP3 and proIL-1β in macrophages (E-G) were detected by western blot. Data were expressed as the mean ± SD. n = 3. *P < 0.05, ** P < 0.01, *** P < 0.001. Fig. 3. VIP inhibited the activation of NF-κB induced by LPS in murine macrophages in vitro. Macrophages were primed by LPS (500 ng/mL) with or without VIP pre-treatment (10 nM). Three hours after the LPS administration, the protein content of I-κB (A-B) in macrophages was detected by western blot. The gene expressions of TNF-α (C) and IL-17A (E) in macrophages were detected by RT-PCR. The contents of TNF-α (D) and IL-17A (F) in the supernatant of macrophages were detected by ELISA. Data were expressed as the mean ± SD. n = 4. *P < 0.05, ** P < 0.01, *** P < 0.001.

using the corresponding enzyme-linked immunosorbent assays (ELISA), following the manufacturer’s instructions (BioLegend, USA).

performed using the SPSS 17.0 software (IBM Co., USA). Differences between two groups were determined by unpaired t-test. Differences among multiple groups were evaluated using ANOVA. Tukey’s test was used as a post-hoc test to make pair-wise comparisons. Differences were considered statistically significant when the P < 0.05.

2.10. Statistical analysis Data were expressed as means ± SD. Statistical analyses were 4

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

Fig. 4. VIP inhibited the activation of NLRP3 inflammasome challenged by LPS plus ATP in primary peritoneal macrophages. (A) Mice were received LPS injection (5 mg/kg, i.t.) or saline. Six hours later, the BALF was collected, and the ATP content in the BALF was detected. (B) The protocol for the two-signal treatment to activate the NLRP3 inflammasome in macrophages. (C-D) The protein expression of caspase-1 p10 was detected by western blot. (E-G) The expressions of pro-IL-1β and IL-1β p17 in the supernatant of macrophages were detected by western blot. (H-I) The contents of IL-1β and IL-18 in the supernatant of macrophages were detected by ELISA. Data were expressed as the mean ± SD. n = 3. *P < 0.05, ** P < 0.01, *** P < 0.001.

3. Results

inflammatory characteristic of VIP.

3.1. Lenti-VIP suppressed the activation of NLRP3 inflammasome in the lung of LPS-induced ALI mice

3.2. VIP inhibited the expression of NLRP3 inflammasome primed by LPS in murine macrophages in vitro

Although we have reported that Lenti-VIP attenuated LPS-induced ALI via suppression of inflammation [4], the underlying mechanism remains unclearly. Here, we wondered whether the suppression of NLRP3 inflammasome activation was involved in the protective effect of VIP against ALI. Our results showed that LPS injection (5 mg/kg, i.t.) profoundly increased the expression of components of NLRP3 inflammasome, including NLRP3 mRNA (Fig. 1A), pro-caspase-1 mRNA (Fig. 1B), pro-IL-1β mRNA (Fig. 1C), pro-IL-18 mRNA (Fig. 1D), and NLRP3 protein (Fig. 1E, H). While, Lenti-VIP partly reduced these upregulations in ALI mice, indicating that VIP inhibited the priming of NLRP3 inflammasome in ALI mice. Upon activation, pro-caspase-1 undergoes autoproteolysis to form heterodimers of active caspase-1, p10, and p20, leading to the maturation and release of IL-1β and IL-18 [31]. We also found that Lenti-VIP strongly lowered the expression of caspase-1 p10 in lung tissue (Fig. 1E, G), and the contents of IL-1β and IL-18 in BALF (Fig. 1H-I) of ALI mice. We also found that Lenti-control had no effect on the activation of NLRP3 inflammasome (Fig. 1). Collectively, these data indicate that Lenti-VIP suppresses the activation of NLRP3 inflammasome in the lung of ALI mice, contributing to the anti-

The first step of NLRP3 inflammasome activation is to prime the macrophages with pathogen-associated molecular patterns, like LPS. To explore the exact effect of VIP on NLRP3 inflammasome activation, LPS was employed to prime the macrophages in vitro. As shown in Fig. 2A-D, LPS treatment (500 ng/mL) for 3 h effectively increased the gene expressions of NLRP3, pro-caspase-1, pro-IL-1β, and pro-IL-18 in macrophages, which was partly inhibited by VIP in a dose-depended manner. Additionally, pre-treatment with VIP (10 nM) remarkably reduced the protein expressions of NLRP3 and pro-IL-1β induced by LPS treatment for 12 h in macrophages (Fig. 2E-G). These results indicate that VIP inhibits the priming of NLRP3 inflammasome challenged by LPS in murine macrophages. 3.3. VIP inhibited the activation of NF-κB induced by LPS in murine macrophages in vitro NF-κB plays a critical role in the priming of NLRP3 inflammasome induced by LPS. Then, we wondered whether VIP inhibited the expression of NLRP3 inflammasome via suppression of NF-κB. As shown in 5

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

Fig. 3A-B, LPS treatment (500 ng/mL) for 3 h significantly promoted the degradation of I-κB, a negative regulator of NF-κB. VIP pre-treatment (10 nM) partly restored the content of I-κB in LPS-challenged macrophages. Besides, we found that VIP pre-treatment dramatically decreased the gene and protein expression of downstream targets of NFκB, including TNF-α (Fig. 3C-D) and IL-17A (Fig. 3E-F). Altogether, these data implicate that VIP inhibits the priming of the NLRP3 inflammasome, maybe through suppressing the activation of NF-κB in macrophages.

this study. In an experimental autoimmune myocarditis model, the production of IL-17A is dampened by VIP [35]. TREM-1 is an inflammation amplifier receptor, and blockade of TREM-1 attenuates ALI in an LPS-induced murine model [25]. We have reported that VIP reduces the expression of TREM-1 in LPS-challenged macrophages, contributing to the anti-inflammatory effect of VIP [11]. In this study, we reported that VIP exerted an inhibitory effect on NLRP3 inflammasome in macrophages both at the priming and activation of NLRP3 inflammasome. To the best of our knowledge, this is the first report that VIP suppresses the activation of NLRP3 inflammasome in macrophages. Altogether, we hold the view that VIP exerts an anti-inflammatory effect against ALI via multiple mechanisms. Suppression of NLRP3 inflammasome, at least, is the nonnegligible one by which VIP alleviates ALI. Moreover, we investigated the underlying mechanism of VIP’s inhibitory effect on NLRP3 inflammasome activation. NF-κB signaling is the key event during the priming of NLRP3 inflammasome [12,13]. It can be activated when the PRRs, such as TLR4, are recognized by corresponding ligands, including LPS [36]. Our data demonstrate that LPS stimulation significantly increases the expression of NLRP3, caspase-1, and pro-IL-1β, both in vivo and in vitro, which partly restores by the treatment of VIP. And VIP pre-treatment prevents the degradation of I-κB. This evidence is in agreement with previous data showing that VIP inhibits the activation of NF-κB in human immunodeficiency virus (HIV)-1-infected macrophages [2], synoviocytes of osteoarthritis [37], and colon of experimental colitis rats [38]. Our and other previous papers demonstrated that VIP induces the activation of CREB [2,6], which involves the inhibition of NF-κB [39]. These findings support our

3.4. VIP inhibited the activation of NLRP3 inflammasome in murine macrophages in vitro The second step of NLRP3 inflammasome activation is the assembly of the NLRP3 inflammasome, triggered by numerous stimuli. Extracellular ATP is one of the most important stimuli, the second signal for the activation of NLRP3 inflammasome [32]. We found that the concentration of ATP in BALF of ALI mice was pronouncedly higher than that in the Control group (Fig. 4A). Therefore, LPS (500 ng/mL) plus ATP (5 mM) was employed to activate the NLRP3 inflammasome (Fig. 4B). We found that two-signal stimulation strongly increased the caspase-1 p10 content in macrophages, which was dramatically suppressed by VIP (10 nM) pre-treatment (Fig. 4C-D). The contents of IL-1β and IL-18 in the supernatant of macrophages were detected to assess the activation of NLRP3 inflammasome. As shown in Fig. 4E-I, VIP pretreatment pronouncedly lowered the secretion of IL-1β and IL-18 by macrophages. These results suggest that VIP inhibits the activation of NLRP3 inflammasome in murine macrophages in vitro. 3.5. VIP inhibited the activation of NLRP3 inflammasome via suppression of ROS generation in murine macrophages Lastly, we investigated the underlying mechanism for the inhibitory effect of VIP on NLRP3 inflammasome activation. ROS is one of the most important factors which can induce the assembly of NLRP3 inflammasome. We found that NAC (0.5 mM), a ROS scavenger, effectively decreased the secretion of IL-1β and IL-18 induced by LPS plus ATP treatment in macrophages (Fig. 5A-B). Consequently, we detected the ROS content in macrophages treated by LPS plus ATP with or without VIP. The result showed that VIP pre-treatment (10 nM) pronouncedly decreased the ROS content induced by LPS plus ATP in macrophages (Fig. 5C). In additionally, VIP pre-treatment partly reduced the gene expression of NOX1 and NOX2, the main resources of ROS in macrophages (Fig. 5D). Collectively, these data indicate that VIP inhibits the activation of NLRP3 inflammasome via suppression of ROS generation in macrophages in vitro. 4. Discussion Our findings have shown that VIP has the ability to inhibit the activation of NLRP3 inflammasome in lung tissue of an LPS-induced ALI murine model. In vitro, VIP suppresses the priming of NLRP3 inflammasome via inhibition of NF-κB, and the activation of NLRP3 inflammasome via downregulation of ROS generation in murine macrophages. We provided a powerful mechanism by which VIP exerts the anti-inflammatory effect against ALI. A characteristic feature of this present study is that VIP inhibits the activation of NLRP3 inflammasome in the LPS-induced ALI murine model and macrophages. VIP is a negative regulator for inflammation. For instance, during pregnancy, VIP synthesized by trophoblast cells produces an anti-inflammatory microenvironment by modulating the functional profile of monocytes, macrophages, and regulatory T cells [33]. Indeed, VIP has distinct anti-inflammatory effects. It downregulates TNF-α production in macrophages [4,34], one most important pro-inflammatory cytokines. Our previous study indicates VIP inhibits the production of IL-17A in macrophages [10], which is also found in

Fig. 5. VIP decreased the ROS generation in macrophages in vitro. Macrophages were treated with LPS (500 ng/mL) plus ATP (5 mM) with/without VIP (10 nM) or NAC (0.5 mM) pre-treatment. The contents of IL-1β (A) and IL-18 (B) in the supernatant of macrophages were detected by ELISA. The relative content of ROS (C) in macrophages was detected by DCFH-DA. The gene expressions of NOX1 and NOX2 (D) in macrophages were detected by RT-PCR. Data were expressed as the mean ± SD. n = 3. ** P < 0.01, *** P < 0.001. 6

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

Fig. 6. A schematic of a model of the anti-inflammatory effect of VIP through suppressing NLRP3 inflammasome activation in macrophages during the progression of ALI. Binding of VIP with its receptors activates intracellular adenylyl cyclase (AC), resulting in an increase of cAMP. Subsequently, inhibition of NF-κB results in suppression of NLRP3 inflammasome priming and decrease of ROS produced by NOX1/2 results in the downregulation of NLRP3 inflammasome activation, contributing to the anti-inflammatory effects of VIP in LPSchallenged macrophages.

5. Data Availability

hypothesis that VIP dampens the priming of NLRP3 inflammasome via suppression of NF-κB through cAMP/CREB in macrophages. Several signals server as the second stimuli to activate NLRP3 inflammasome, including extracellular ATP, cholesterol crystals, potassium efflux, and oxidative stress [15]. Extracellular ATP is a well-known endogenous danger signal and widely used for canonical activation of the NLRP3 inflammasome [40]. We found that the ATP content in the BALF of ALI mice is pronouncedly increased. It provides a microenvironment to activate the NLRP3 inflammasome in the lung of ALI mice. In vitro, twosignal stimulation (LPS + ATP) was employed to fully activate the NLRP3 inflammasome in macrophages, which is in accord with previous papers [41]. The stimulation of LPS + ATP induces significant production of ROS, which contributes to the activation of the NLRP3 inflammasome [40]. Clearance of ROS interrupts the formation of NLRP3 inflammasome in THP-1 macrophages after LPS-combined ATP stimulation [42]. Our data show that VIP reduces the generation of ROS in macrophages, as well as in lung tissue of ALI mice characterized by a lower level of malonaldehyde (MDA) [4]. In addition, we find that VIP inhibits the expression of NOX1 and NOX2, the main resources for intracellular ROS. It indicates that VIP suppresses the activation of NLRP3 inflammasome through a decrease of ROS generation. This hypothesis is supported by another report that NOX inhibitor markedly suppresses the activation of NLRP3 inflammasome [43]. Our results do not answer the question of whether VIP suppresses the activation of NLRP3 inflammasome directly or indirectly. A previous study points out that VIP inhibits the up-regulation of human monocyte TLR4 induced by LPS [44]. While, down-regulation of TLR4 could result in the decrease of inflammatory reactions induced by LPS, including the activation of NF-κB. Investigating the effect of VIP on NLRP3 inflammasome activated by different stimulation patterns, such as nigericin, could figure out the exact role of VIP in the activation of NLRP3 inflammasome [45]. Finally, our findings indicate that the binding of VIP with its receptors results in an increase of cAMP. Subsequently, inhibition of NF-κB results in suppression of NLRP3 inflammasome priming and decrease of ROS produced by NOX1/2 results in the downregulation of NLRP3 inflammasome activation, contributing to the anti-inflammatory effects of VIP in LPSchallenged macrophages (Fig. 6). In conclusion, our findings illustrate one mechanism through which VIP attenuates LPS-induced ALI via inhibition of the activation of the NLRP3 inflammasome, and encourage further studies assessing the therapeutic potential of VIP to ALI.

The data used to support the findings of this study are available from the corresponding author upon request. Acknowledgments This study was supported by the National Natural Science Foundation of China (81500065), the Hunan Provincial Natural Science Foundation of China (2016JJ6107, 2019JJ40453, 2019JJ70008), and the Research Foundation of Education Bureau of Hunan Province, China (16A153, 18A491). Conflicts of interest None. Author Contributions YZ and SKL conceived and designed the experiments. YZ, CYZ, JXD, QL, HHY, CCS, and XQL performed the experiments. YZ, CYZ, HHY, and JZ analyzed the data. YZ and SKL contributed reagents/materials/ analysis tools. YZ and CYZ wrote the paper. SKL critically reviewed the manuscript. References [1] M. Khedr, A.M. Abdelmotelb, T.A. Bedwell, A. Shtaya, M.N. Alzoubi, M. Abu Hilal, S.I. Khakoo, Vasoactive intestinal peptide induces proliferation of human hepatocytes, Cell Prolif 51 (5) (2018) e12482. [2] J.R. Temerozo, S.S.D. de Azevedo, D.B.R. Insuela, R.C. Vieira, P.L.C. Ferreira, V.F. Carvalho, G. Bello, D.C. Bou-Habib, The Neuropeptides Vasoactive Intestinal Peptide and Pituitary Adenylate Cyclase-Activating Polypeptide Control HIV-1 Infection in Macrophages Through Activation of Protein Kinases A and C, Front Immunol 9 (2018) 1336. [3] D. Czovek, F. Petak, Y. Donati, X. Belin, J.C. Pache, C. Barazzone Argiroffo, W. Habre, Prevention of hyperoxia-induced bronchial hyperreactivity by sildenafil and vasoactive intestinal peptide: impact of preserved lung function and structure, Respir Res 15 (2014) 81. [4] G.Y. Sun, H.H. Yang, X.X. Guan, W.J. Zhong, Y.P. Liu, M.Y. Du, X.Q. Luo, Y. Zhou, C.X. Guan, Vasoactive intestinal peptide overexpression mediated by lentivirus attenuates lipopolysaccharide-induced acute lung injury in mice by inhibiting inflammation, Mol Immunol 97 (2018) 8–15. [5] H.H. Leuchte, C. Prechtl, J. Callegari, T. Meis, S. Haziraj, D. Bevec, J. Behr,

7

Biomedicine & Pharmacotherapy 121 (2020) 109596

Y. Zhou, et al.

[6] [7] [8] [9] [10]

[11] [12] [13]

[14] [15] [16] [17] [18] [19] [20]

[21] [22] [23]

[24]

[25]

[26]

[27] M. Shao, Z.B. Wen, H.H. Yang, C.Y. Zhang, J.B. Xiong, X.X. Guan, W.J. Zhong, H.L. Jiang, C.C. Sun, X.Q. Luo, X.F. He, Y. Zhou, C.X. Guan, Exogenous angiotensin (1-7) directly inhibits epithelial-mesenchymal transformation induced by transforming growth factor-beta1 in alveolar epithelial cells, Biomed Pharmacother 117 (2019) 109193. [28] Y. Zhou, J. Yang, G.Y. Sun, T. Liu, J.X. Duan, H.F. Zhou, K.S. Lee, B.D. Hammock, X. Fang, J.X. Jiang, C.X. Guan, Soluble epoxide hydrolase inhibitor 1-trifluoromethoxyphenyl-3- (1-propionylpiperidin-4-yl) urea attenuates bleomycin-induced pulmonary fibrosis in mice, Cell Tissue Res 363 (2) (2016) 399–409. [29] X.T. Huang, C. Li, X.P. Peng, J. Guo, S.J. Yue, W. Liu, F.Y. Zhao, J.Z. Han, Y.H. Huang, L. Yang, Q.M. Cheng, Z.G. Zhou, C. Chen, D.D. Feng, Z.Q. Luo, An excessive increase in glutamate contributes to glucose-toxicity in beta-cells via activation of pancreatic NMDA receptors in rodent diabetes, Sci Rep 7 (2017) 44120. [30] X.T. Huang, S.J. Yue, C. Li, Y.H. Huang, Q.M. Cheng, X.H. Li, C.X. Hao, L.Z. Wang, J.P. Xu, M. Ji, C. Chen, D.D. Feng, Z.Q. Luo, A Sustained Activation of Pancreatic NMDARs Is a Novel Factor of beta-Cell Apoptosis and Dysfunction, Endocrinology 158 (11) (2017) 3900–3913. [31] B. Guey, M. Bodnar, S.N. Manie, A. Tardivel, V. Petrilli, Caspase-1 autoproteolysis is differentially required for NLRP1b and NLRP3 inflammasome function, Proc Natl Acad Sci U S A 111 (48) (2014) 17254-9. [32] F. Di Virgilio, G. Schmalzing, F. Markwardt, The Elusive P2X7 Macropore, Trends Cell Biol 28 (5) (2018) 392–404. [33] R. Ramhorst, G. Calo, D. Paparini, D. Vota, V. Hauk, L. Gallino, F. Merech, E. Grasso, C.P. Leiros, Control of the inflammatory response during pregnancy: potential role of VIP as a regulatory peptide, Ann N Y Acad Sci 1437 (1) (2019) 15–21. [34] R. Zhang, C.N. Leeper, X. Wang, T.A. White, B.D. Ulery, Immunomodulatory vasoactive intestinal peptide amphiphile micelles, Biomater Sci 6 (7) (2018) 1717–1722. [35] R. Benitez, V. Delgado-Maroto, M. Caro, I. Forte-Lago, M. Duran-Prado, F. O’Valle, A.H. Lichtman, E. Gonzalez-Rey, M. Delgado, Vasoactive Intestinal Peptide Ameliorates Acute Myocarditis and Atherosclerosis by Regulating Inflammatory and Autoimmune Responses, J Immunol 200 (11) (2018) 3697–3710. [36] H. Yin, Q. Guo, X. Li, T. Tang, C. Li, H. Wang, Y. Sun, Q. Feng, C. Ma, C. Gao, F. Yi, J. Peng, Curcumin Suppresses IL-1beta Secretion and Prevents Inflammation through Inhibition of the NLRP3 Inflammasome, J Immunol 200 (8) (2018) 2835–2846. [37] Y. Liang, S. Chen, Y. Yang, C. Lan, G. Zhang, Z. Ji, H. Lin, Vasoactive intestinal peptide alleviates osteoarthritis effectively via inhibiting NF-kappaB signaling pathway, J Biomed Sci 25 (1) (2018) 25. [38] C.L. Xu, Y. Guo, L. Qiao, L. Ma, Y.Y. Cheng, Recombinant expressed vasoactive intestinal peptide analogue ameliorates TNBS-induced colitis in rats, World J Gastroenterol 24 (6) (2018) 706–715. [39] C. Li, T. Chen, H. Zhou, Y. Feng, M.P.M. Hoi, D. Ma, C. Zhao, Y. Zheng, S.M.Y. Lee, BHDPC Is a Novel Neuroprotectant That Provides Anti-neuroinflammatory and Neuroprotective Effects by Inactivating NF-kappaB and Activating PKA/CREB, Front Pharmacol 9 (2018) 614. [40] E.K. Jo, J.K. Kim, D.M. Shin, C. Sasakawa, Molecular mechanisms regulating NLRP3 inflammasome activation, Cell Mol Immunol 13 (2) (2016) 148-59. [41] A. Lopategi, R. Flores-Costa, B. Rius, C. Lopez-Vicario, J. Alcaraz-Quiles, E. Titos, J. Claria, Frontline Science: Specialized proresolving lipid mediators inhibit the priming and activation of the macrophage NLRP3 inflammasome, J Leukoc Biol 105 (1) (2019) 25–36. [42] L. Chen, Q. You, L. Hu, J. Gao, Q. Meng, W. Liu, X. Wu, Q. Xu, The Antioxidant Procyanidin Reduces Reactive Oxygen Species Signaling in Macrophages and Ameliorates Experimental Colitis in Mice, Front Immunol 8 (2017) 1910. [43] Y.Y. Qin, M. Li, X. Feng, J. Wang, L. Cao, X.K. Shen, J. Chen, M. Sun, R. Sheng, F. Han, Z.H. Qin, Combined NADPH and the NOX inhibitor apocynin provides greater anti-inflammatory and neuroprotective effects in a mouse model of stroke, Free Radic Biol Med 104 (2017) 333–345. [44] N. Foster, S.R. Lea, P.M. Preshaw, J.J. Taylor, Pivotal advance: vasoactive intestinal peptide inhibits up-regulation of human monocyte TLR2 and TLR4 by LPS and differentiation of monocytes to macrophages, J Leukoc Biol 81 (4) (2007) 893–903. [45] X. Liu, T. Pichulik, O.O. Wolz, T.M. Dang, A. Stutz, C. Dillen, M. Delmiro Garcia, H. Kraus, S. Dickhofer, E. Daiber, L. Munzenmayer, S. Wahl, N. Rieber, J. Kummerle-Deschner, A. Yazdi, M. Franz-Wachtel, B. Macek, M. Radsak, S. Vogel, B. Schulte, J.S. Walz, D. Hartl, E. Latz, S. Stilgenbauer, B. Grimbacher, L. Miller, C. Brunner, C. Wolz, A.N.R. Weber, Human NACHT, LRR, and PYD domain-containing protein 3 (NLRP3) inflammasome activity is regulated by and potentially targetable through Bruton tyrosine kinase, J Allergy Clin Immunol 140 (4) (2017) 1054–1067 e10.

Augmentation of the effects of vasoactive intestinal peptide aerosol on pulmonary hypertension via coapplication of a neutral endopeptidase 24.11 inhibitor, Am J Physiol Lung Cell Mol Physiol 308 (6) (2015) L563–8. C.X. Guan, Y.R. Cui, G.Y. Sun, F. Yu, C.Y. Tang, Y.C. Li, H.J. Liu, X. Fang, Role of CREB in vasoactive intestinal peptide-mediated wound healing in human bronchial epithelial cells, Regul Pept 153 (1–3) (2009) 64-9. C.X. Guan, Y.R. Cui, M. Zhang, H.B. Bai, R. Khunkhun, X. Fang, Intracellular signaling molecules involved in vasoactive intestinal peptide-mediated wound healing in human bronchial epithelial cells, Peptides 28 (9) (2007) 1667-73. C.X. Guan, M. Zhang, X.Q. Qin, Y.R. Cui, Z.Q. Luo, H.B. Bai, X. Fang, Vasoactive intestinal peptide enhances wound healing and proliferation of human bronchial epithelial cells, Peptides 27 (12) (2006) 3107-14. K. Parvathaneni, S. Belani, D. Leung, C.J. Newth, R.G. Khemani, Evaluating the Performance of the Pediatric Acute Lung Injury Consensus Conference Definition of Acute Respiratory Distress Syndrome, Pediatr Crit Care Med 18 (1) (2017) 17–25. W.Z. Ran, L. Dong, C.Y. Tang, Y. Zhou, G.Y. Sun, T. Liu, Y.P. Liu, C.X. Guan, Vasoactive intestinal peptide suppresses macrophage-mediated inflammation by downregulating interleukin-17A expression via PKA- and PKC-dependent pathways, Int J Exp Pathol 96 (4) (2015) 269-75. G.Y. Sun, C.X. Guan, Y. Zhou, Y.P. Liu, S.F. Li, H.F. Zhou, C.Y. Tang, X. Fang, Vasoactive intestinal peptide re-balances TREM-1/TREM-2 ratio in acute lung injury, Regul Pept 167 (1) (2011) 56–64. M.S.J. Mangan, E.J. Olhava, W.R. Roush, H.M. Seidel, G.D. Glick, E. Latz, Targeting the NLRP3 inflammasome in inflammatory diseases, Nat Rev Drug Discov 17 (8) (2018) 588–606. F.G. Bauernfeind, G. Horvath, A. Stutz, E.S. Alnemri, K. MacDonald, D. Speert, T. Fernandes-Alnemri, J. Wu, B.G. Monks, K.A. Fitzgerald, V. Hornung, E. Latz, Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression, J Immunol 183 (2) (2009) 787-91. M.D. Tate, A. Mansell, An update on the NLRP3 inflammasome and influenza: the road to redemption or perdition? Curr Opin Immunol 54 (2018) 80–85. A. Grebe, F. Hoss, E. Latz, NLRP3 Inflammasome and the IL-1 Pathway in Atherosclerosis, Circ Res 122 (12) (2018) 1722–1740. S. Toldo, A. Abbate, The NLRP3 inflammasome in acute myocardial infarction, Nat Rev Cardiol 15 (4) (2018) 203–214. J.J. Grailer, B.A. Canning, M. Kalbitz, M.D. Haggadone, R.M. Dhond, A.V. Andjelkovic, F.S. Zetoune, P.A. Ward, Critical role for the NLRP3 inflammasome during acute lung injury, J Immunol 192 (12) (2014) 5974-83. S. Han, W. Cai, X. Yang, Y. Jia, Z. Zheng, H. Wang, J. Li, Y. Li, J. Gao, L. Fan, D. Hu, ROS-Mediated NLRP3 Inflammasome Activity Is Essential for Burn-Induced Acute Lung Injury, Mediators Inflamm 2015 (2015) 720457. Y. Zhang, X. Li, J.J. Grailer, N. Wang, M. Wang, J. Yao, R. Zhong, G.F. Gao, P.A. Ward, D.X. Tan, X. Li, Melatonin alleviates acute lung injury through inhibiting the NLRP3 inflammasome, J Pineal Res 60 (4) (2016) 405-14. Y. Li, H. Li, S. Liu, P. Pan, X. Su, H. Tan, D. Wu, L. Zhang, C. Song, M. Dai, Q. Li, Z. Mao, Y. Long, Y. Hu, C. Hu, Pirfenidone ameliorates lipopolysaccharide-induced pulmonary inflammation and fibrosis by blocking NLRP3 inflammasome activation, Mol Immunol 99 (2018) 134–144. H. Lv, Q. Liu, Z. Wen, H. Feng, X. Deng, X. Ci, Xanthohumol ameliorates lipopolysaccharide (LPS)-induced acute lung injury via induction of AMPK/GSK3betaNrf2 signal axis, Redox Biol 12 (2017) 311–324. A.K. Verma, M. Manohar, S. Upparahalli Venkateshaiah, A. Mishra, Neuroendocrine cells derived chemokine vasoactive intestinal polypeptide (VIP) in allergic diseases, Cytokine Growth Factor Rev 38 (2017) 37–48. P. Chedid, T. Boussetta, P.M. Dang, S.A. Belambri, V. Marzaioli, M. Fasseau, F. Walker, A. Couvineau, J. El-Benna, J.C. Marie, Vasoactive intestinal peptide dampens formyl-peptide-induced ROS production and inflammation by targeting a MAPK-p47(phox) phosphorylation pathway in monocytes, Mucosal Immunol 10 (2) (2017) 332–340. Y. Zhou, T. Liu, J.X. Duan, P. Li, G.Y. Sun, Y.P. Liu, J. Zhang, L. Dong, K.S.S. Lee, B.D. Hammock, J.X. Jiang, C.X. Guan, Soluble Epoxide Hydrolase Inhibitor Attenuates Lipopolysaccharide-Induced Acute Lung Injury and Improves Survival in Mice, Shock 47 (5) (2017) 638–645. T. Liu, Y. Zhou, P. Li, J.X. Duan, Y.P. Liu, G.Y. Sun, L. Wan, L. Dong, X. Fang, J.X. Jiang, C.X. Guan, Blocking triggering receptor expressed on myeloid cells-1 attenuates lipopolysaccharide-induced acute lung injury via inhibiting NLRP3 inflammasome activation, Sci Rep 6 (2016) 39473. W.J. Zhong, H.H. Yang, X.X. Guan, J.B. Xiong, C.C. Sun, C.Y. Zhang, X.Q. Luo, Y.F. Zhang, J. Zhang, J.X. Duan, Y. Zhou, C.X. Guan, Inhibition of glycolysis alleviates lipopolysaccharide-induced acute lung injury in a mouse model, J Cell Physiol 234 (4) (2019) 4641–4654.

8