- Email: [email protected]
Wound repair and proliferation of bronchial epithelial cells enhanced by bombesin receptor subtype 3 activation
peptides 27 (2006) 1852–1858
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/peptides
Wound repair and proliferation of bronchial epithelial cells enhanced by bombesin receptor subtype 3 activation Yu-Rong Tan a,1, Ming-Ming Qi a,1, Xiao-Qun Qin a,*, Yang Xiang a, Xiang Li b, Yue Wang a, Fei Qu a, Hui-Jun Liu a, Jian-Song Zhang b a b
Xiangya School of Medicine, Central South University, Changsha 410078, Hunan, China Hunan Normal University, Changsha 410013, Hunan, China
article info
abstract
Article history:
The present study was designed to investigate the role of bombesin receptor subtype 3 (BRS-
Received 9 September 2005
3) in airway wound repair. The results showed that: (1) There was few expression of BRS-3
Received in revised form
mRNA in the control group. In contrast, the expression of BRS-3 mRNA was gradually
19 December 2005
increased in the early 2 days, and peaked on the fourth day, and then decreased in the
Accepted 19 December 2005
ozone-stressed AHR animal. BRS-3 mRNA was distributed in the ciliated columnar epithe-
Published on line 19 January 2006
lium, monolayer columnar epithelium cells, scattered mesenchymal cells and Type II alveolar cells; (2) The wound repair and proliferation of bronchial epithelial cells (BECs)
Keywords:
were accelerated in a concentration-dependent manner by BRS-3 activation with P3513,
Bombesin receptor subtype 3 (BRS-3)
which could be inhibited by PKA inhibitor H89. The study demostrated that activation of
Airway hyperresponsiveness (AHR)
BRS-3 may play an important role in wound repair of AHR. # 2006 Elsevier Inc. All rights reserved.
Bronchial epithelium cells (BECs) Abbreviations: BRS-3, bombesin receptor subtype 3 AHR, airway hyperresponsiveness BECs, bronchial epithelium cells ASO, antisense oligonucleotide ISH, in situ hybridization
1.
Introduction
BRS-3 is a 399-amino acid protein and has 51% and 47% amino acid sequence homology to the other two members of the bombesin receptor family, the gastrin-releasing peptide (GRP) receptor and the neuromedin B (NMB) receptor, respectively.
Unlike GRP and NMB receptors which have a widespread distribution in the central nervous system and peripheral tissues [10,11,13,14], distribution of BRS-3 is just limited to secondary spermatocytes [5], pregnant uterus [7], a few brain tissues [8], human lungs [3], adipose tissues [1], epidermal cancer cell lines [6], etc. As of now, biological effects of BRS-3
* Corresponding author. Tel.: +86 731 2650341. E-mail address: [email protected] (X.-Q. Qin). 1 First two authors have made equal contributions to this work. 0196-9781/$ – see front matter # 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2005.12.012
peptides 27 (2006) 1852–1858
have still remained unknown. According to certain reports, the expression level of BRS-3 in organism normal tissues is low, but its level in developing lungs [4,19] and certain lung carcinomas is high [17,21], indicating that BRS-3 may be involved in cell growth and wound repair. As of now, there have no papers published about the expression of BRS-3 in adult lungs and whether it is involved in wound repair or cell proliferation during airway inflammation or airway hyperresponsiveness (AHR). The aim of this study is to investigate the temporal and spatial distribution of BRS-3 mRNA in a novel zone-stressed AHR model. P3513 [22], a synthesized bombesin-derived ligand, can specifically bind to BRS-3 with high affinity. It was used in this present experiment to activate BRS-3 in order to observe the effect of BRS-3 on the repair and proliferation of BECs and its signal pathway.
2.
Materials and methods
2.1.
Animals model
1853
A novel animal AHR model was prepared as described in detail previously [16]. Briefly, New Zealand rabbits were placed in 40 cm 30 cm 25 cm boxes. The animals in control group inhaled fresh air, while the animals in stress groups inhaled a mixture of 1.5 ppm ozone and fresh air for 2, 4, and 8 days, respectively, with 1 h for each day. After the stress, the airway resistance of the animals was measured, and then cell numbers and proteins in bronchial-alveolar lavage were identified after killing the animals, and lung tissue sections were prepared for structure examination, in order to clarify a successful establishment of the model.
Fig. 1 – In situ hybridization of BRS-3 mRNA in AHR and in cultured human BECs. It was shown that the structure of lung tissues was seriously damaged after being stressed with ozone. The expression of BRS-3 mRNA was increased with the elongation of ozone stress, peaked on the fourth day, and then decreased. (A) Hybridization signal of BRS-3 mRNA was distributed in the ciliated epithelium of bronchiole; (B) Hybridization signal was distributed in the columnar epithelium cells of terminal bronchiole; (C) Hybridization signal was distributed in Type II alveolar cells; (D) There was few expression of BRS-3 mRNA in the unstressed human BECs, but it was increased in the ozone-stressed BECs. Original magnification: 100 for all images.
1854
peptides 27 (2006) 1852–1858
Fig. 2 – Typical video micrographs of BEC monolayer wound closure from P3513 (10S7 M) group (2.841 mm2 starting area). Wound edges were somewhat irregular but easily visualized and traced on the digitized image. Monolayer images were digitized for 0, 4, 8, 12, 16, and 20 h and the wound area was calculated by image pro plus system automatically. The remaining wound area in mm2 was shown for each image. Original magnification: 100 for all images.
2.2.
Cells culture
An immortalized human BEC line was kindly provided by Professor Gruenernt from San Francisco Branch Campus, University of California and was cultured in a mixture medium of DMEM:F12 (1:1) containing 100 u/mL penicillin, 100 u/mL streptomycin, and 10% heat inactivated fetal bovine serum and incubated at 37 8C in 5% CO2.
2.3.
In situ hybridization (ISH)
The following probes were used for the in situ hybridization to localize mRNAs of BRS-3: 50 -GCCTCACTCACCTAATCAGACTTTAATTTC-30 (nucleotides163–193 bp from ATG), 50 -TGTGCCATCTATATCACTTATGCTGTGATC-30 (nucleotides 291–320 bp from ATG), 50 -AATCCATGCAAAC AGTTCCA AATATTTTCA-30 (nucleotides 316–345 bp from ATG). They were labeled with digoxin at the 50 -end by TaKaRa Biotechnology Company, Dalian, China. Briefly, the lung tissues were fixed in 10% paraformaldehyde, embeded in paraffin, cut into 6 mm paraffin sections and placed on slides. The slides were incubated with 30% H2O2 and 5% pepsin in turn and then hybridized at 42 8C overnight with labeled probes (2.0 g/mL). After washing, the slides were then sequentially incubated with blocking buffers, biotin labled mouse-anti-digoxin antibodies, streptavidin biotin peroxidase complex (sABC) and biotin labled peroxidase, followed by rinsing with PBS after every step. The peroxidant activity was visualized by the 3, 30 diaminobenzidine tetrahydrochloride (DAB). The slides were incubated with normal mouse serum instead of the mouse-anti-digoxin antibody in absence of the labeled probes for the negative control.
2.4.
with P3513 (kindly provided by Dr. Weber from Boston University) in various concentrations and calmodulin inhibitor W7 (106 M), MEK inhibitor PD98059 (106 M) and PKA inhibitor H89 (106 M). W7, PD98059 and H89 were provided by Sigma, St. Louis, MO, USA.
2.5.
Proliferation assay
The cells were trypsinized in a 0.25% trypsin solution and seeded in a 96-well plate at a density of 104 cells/(0.1 mL/well). After the cells were grown for 24 h to approximately 80% subconfluent state, 0.1 mL serum-free medium was added to
Wound repair assay
Immortalized human BECs were cultured in 12-well plates with DMEM: F12 (1:1), and a small wound was made in the confluent monolayer by mechanical scraping. The edge of wound was recognized and the remaining wound area was measured serially per 4 h in 24 h by video microscopy (Olympus Company, Japan). A linear regression equation of the remaining wound area to time was obtained. Repair index (RI), equal to the absolute value of slope, was used to judge the repair speed of BECs. In order to determine the effects and the signal pathway of BRS-3 activation in mediating wound repair of BECs, BECs were pretreated
Fig. 3 – Closure of monolayer wounds in BECs after treatment with P3513. There was substantial acceleration of wound closure in a concentration-dependent manner after treatment with P3513 (10S9, 5 10S9, 10S8, 5 10S8, 10S7, 5 10S7, and 10S6 M). Data represented the mean W S.E. of 10 separate experiments. *P < 0.05 vs. control.
peptides 27 (2006) 1852–1858
1855
Fig. 4 – Effect of H89 (10S6 M), W7 (10S6 M) and PD98059 (10S6 M) on closure of monolayer wounds in BECs induced by P3513 (10S7 M). (A) H89 inhibited the acceleration of wound closure induced by P3513; (B) W7 strengthened the acceleration of wound closure induced by P3513; (C) PD98059 strengthened the acceleration of wound closure induced by P3513. Data represented the mean W S.E. of 10 separate experiments. *P < 0.05 vs. P3513 group.
each well to synchronize the growth of cells for 24 h. Then various concentrations of P3513, W7, PD98059, H89 were added to each well and incubated for another 24 h. Each treatment was tested in at least six wells. Next, 15 (L of a 0.5% MTT solution was added to each well and incubated for 4 h. Then, the medium and MTT were removed and 150 (L of DMSO was added to each well. The mixture was shaken for 10 min to dissolve the crystal. The OD of each well solution was determined at 570 nm by using an ELISA reader.
2.6.
Antisense oligonucleotide (ASO)
BRS-3 ASO was designed according to the human BRS-3 mRNA sequence (exon-1, nucleotides 480–500, CTCCCCGTGAACGATGACTGG). The ASO was synthesized at TaKaRa Biotechnology Company as a 21-base phosphorothioate chemic oligonucleotides, where bases 1–5 and 17–21 were modified with 20 -O-(2methoxy)-ethyl [12]. BECs were transfected with a BRS-3 ASO and lipofectin (Sigma, St. Louis, MO, USA) mixture for 4 h in serum-free DMEM. Then the ASO reaction mixture was replaced with normal growth media (with 10% FBS) and the cells were incubated under normal conditions for an additional 16–20 h. The efficacy of the ASO in inhibiting the activity of BRS-3 was verified by ISH.
2.7.
Statistical analyses
The numerical data were analyzed using unpaired Student’s ttest. Values were expressed by mean S.E. P < 0.05 was considered as statistically significant.
3.
sign of inflammationary infiltration, mucosal exudation, and cavitary stricture and there was few expression of BRS-3 mRNA. However, inflammationary infiltration, mucosal exudation, cavitary stricture and bronchial epithelial denudation were observed in the ozone-stressed group. The expression of BRS-3 mRNA was detectable in the early two days after the ozone stress, increased with the elongation of ozone stress, peaked on the fourth day, and then reduced. BRS-3 mRNA was predominantly localized in the ciliated columnar epithelium of bronchioles (Fig. 1A), monolayer columnar epithelium cells of terminal bronchioles (Fig. 1B), scattered mesenchymal cells and Type I alveolar cells (Fig. 1C). No BRS-3 mRNA was detectable in Type I alveolar cells. The results also showed that few expression of BRS-3 mRNA was detectable in the unstressed human BECs, but its expression was explicitly increased in ozone-stressed BECs (Fig. 1D).
3.2.
Effects of BRS-3 activation on wound repair of BECs
A small wound was made in each well with an area of approximate 2.676 0.014 mm2 (Fig. 2). The remaining wound area in the control group was decreased to 40.40 8.35% of the initial area (RI, 0.1807) 24 h later. Satisfactory correlation was detectable between the time and the remaining wound area (r = 0.951, P < 0.01). The repair of BECs was accelerated by P3513 (109, 5 109, 108, 5 108, 107, 5 107, and 106 M) in a concentration-dependent manner (RI, 0.1812, 0.1779, 0.2201, 0.2706, 0.3270, 0.3147, and 0.2906, respectively) (Fig. 3). H89 could inhibit the accelerating effect induced by 107 M of P3513 (RI, 0.2158, P < 0.05) (Fig. 4A). Interestingly, W7 and PD98059 seemed to strengthen the effect of 107 M of P3513 on the repair of BECs (RI, 0.4135, P < 0.05; 0.4047, P < 0.05, respectively) (Fig. 4 B and C).
Results 3.3.
3.1. The expression of BRS-3 mRNA in lungs and cultured BECs In the normal group, the structure of bronchi walls and pulmonary alveoli were intact and regular, which showed no
Effects of BRS-3 activation on proliferation of BECs
Proliferation of BECs measured by MTT showed that BECs pretreatment with P3513 (above concentrations) could promote proliferation of BECs in a concentration-dependent manner (Fig. 5A). W7, H89 and PD98059 could obviously inhibit
1856
peptides 27 (2006) 1852–1858
Fig. 5 – Proliferation of BECs after treatment with P3513 and effect of H89 (10S6 M), W7 (10S6 M) and PD98059 (10S6 M) on proliferation of BECs induced by P3513 (10S7 M). (A) Results showed that BECs incubated with P3513 (10S9, 5 10S9, 10S8, 5 10S8, 10S7, 5 10S7, and 10S6 M) for 24 h were proliferated in a concentration-dependent manner (*P < 0.05 vs. control). (B) W7, H89 and PD98059 inhibited the proliferation of BECs induced by 10S7 M of P3513 (**P < 0.01 vs. control; #P < 0.05 vs. P3513 group). Data represented the mean W S.E. of 10 separate experiments.
the proliferation of BECs induced by 107 M of P3513 (P < 0.05; P < 0.05; P < 0.05, respectively) (Fig. 5B).
3.4. Effects of BRS-3 ASO on wound repair and proliferation of BECs The inhibitory effect of BRS-3 ASO (0.4, 0.8, and 1.2 mM) on BRS-3 expression was assayed by ISH (data not shown). The repair of BECs failed to be accelerated by 107 M of P3513 after pretreatment with 1.2 mM of BRS-3 ASO (RI, 0.1946) (Fig. 6A). MTT assay also showed that BECs incubated with 1.2 mM of BRS-3 ASO blocked the proliferation of BECs induced by P3513 (Fig. 6B).
4.
Disscussion
AHR is an important pathophysiological characteristic of bronchial asthma, which can explain many of the disease’s clinical features. The mechanism of AHR, however, has not yet been fully clarified. Previously, we found that a defect in structures and functions of airway epithelium may be the
initiator of AHR. In a stressed condition, airway epithelial cells transmit inflammatory signals to leucocytes and activate an inflammation reaction in the airway. During this process, BRS-3 may play the role as an important protective factor. We tried to observe the temporal and spatial distribution of BRS-3 mRNA expression in the lungs by using a novel animal model of AHR. The results demonstrated that the structure of lung tissues was seriously damaged after being stressed with ozone. Previously, we found that with the ozone stress, BECs were injuried and exfoliated, sensory nerve fibers in the basilar membrane were exposed and stimulated by inflammatory media, and the release of regulatory peptides was gradually increased. During this course, certain protective regulatory peptides released in the prophase such as vasoactive intestinal peptide and epidermal growth factor exerted downregulatory effects to lighten the inflammation, while certain regulatory peptides released in the metaphase and anaphase such as substance P and calcitonin gene-related peptides exerted upregulatory effects to aggravate the inflammation, which resulted in AHR [20]. In the present study, we observed that the expression of BRS-3 mRNA was gradually increased in the early 2 days, peaked on the fourth day, and then decreased. BRS-3 mRNA was predominantly localized in the ciliated columnar epithelium, monolayer columnar epithelium, scattered mesenchymal cells and Type II alveolar cells, indicating that BRS-3 functions in the prophase and modulates the function of various epithelial cells and mesenchymal cells. To further determine the effects of BRS-3 activation in AHR, we tried to observe the effects of BRS-3 activation on wound repair and proliferation of BECs. It is reported that the wound repair mainly depends on migration and proliferation. In the prophase of wound repair, the precursor cells around the wound initiate the migration and proliferation of BECs [2]. The migration and dissemination to the wound occur within 16– 20 h after damage and the proliferation occurs around 24 h after the damage [9]. The findings that the repair and proliferation of BECs were accelerated in a concentrationdependent manner by P3513 and slowed down after treatment with BRS-3 ASO indicate that BRS-3 may be beneficial for the recovery of wound or AHR. Since few native cell lines can express high levels of BRS-3, the transduction mechanism of BRS-3 has not yet known. Ryan et al. found that hBRS-3 receptor activation could increase the activity of phospholipase C, resulting in the generation of inositol phosphates and changes in [Ca2+], which could be also coupled to tyrosine kinase activation, but not to adenylate cyclase activation or inhibition [18]. However, we found that a novel selective human BRS-3 agonist could induce CREB phosphorylation and transactivation [15], indicating that the signal transduction of BRS-3 may be associated with adenylate cyclase activation. Results of our present study also showed that H89 could inhibit the accelerating effect of BRS-3 activation, indicating that the promoting repair and proliferation of BRS3 activation may be dependent on a PKA pathway. However, W7 and PD98059 seemed to strengthen the repair of BECs induced by P3513, but inhibit the proliferation, suggesting that repair and proliferation may have different signal transduction pathways.
peptides 27 (2006) 1852–1858
1857
Fig. 6 – Effects of BRS-3 ASO on wound repair and proliferation of BECs induced by P3513 (10S7 M). (A) BRS-3 ASO (1.2 mM) pretreatment inhibited the wound repair of BECs (*P < 0.05 vs. P3513 group); (B) BRS-3 ASO (1.2 mM) pretreatment inhibited the proliferation of BECs (**P < 0.01 vs. control; #P < 0.05 vs. P3513 group). Data represented the mean W S.E. of 10 separate experiments.
In a word, our present study demonstrates that upregulation and activation of BRS-3 in the lungs may play an important role in wound repair of AHR. BRS-3 activation can promote the migration or proliferation of BECs so as to help the repair of the airway, which were associated with the pathways of Ca2+/calmodulin-dependent protein kinase, cAMP-PKA, as well as TPK-Ras-MAPK.
Acknowledgements This work was supported by the Grant #30470755 from the National Natural Science Foundation of China. We thank Professor Gruenernt from San Francisco Branch Campus, the University of California for the gift of an immortalized human BEC line and Dr. Weber from Boston University for P3513.
[6]
[7]
[8]
[9]
[10]
references [11] [1] Aoki K, Sun YJ, Aoki S, Wada K, Wada E. Cloning, expression, and mapping of a gene that is upregulated in adipose tissue of mice deficient in bombesin receptor subtype-3. Biochem Biophys Res Commun 2002;290(4):1282–8. [2] Ayer MM, Jeffery PK. Proliferation and differentiation in mammalian airway epithelium. Eur Respir J 1988;1: 58–80. [3] Cullen A, Emanuel RL, Torday JS, Asokananthan N, Sikorski KA, Sunday ME. Bombesin-like peptide and receptors in lung injury models: diverse gene expression, similar function. Peptides 2000;21(11):1627–38. [4] Emanuel RL, Torday J, Shahsafaei A. Bombesin-like peptides and receptors in normal fetal baboon lung: roles in lung growth and maturation. Am J Physiol Lung Cell Mol Physiol 1999;277:L1003–7. [5] Fathi Z, Corjay MH, Shapira H, Wada E, Benya R, Jensen R, et al. BRS-3: a novel bombesin receptor subtype selectively
[12]
[13]
[14]
[15]
expressed in testis and lung carcinoma cells. J Biol Chem 1993;268(8):5979–84. Fathi Z, Way JW, Corjay MH, Viallet J, Sausville EA, Battey JF. Bombesin receptor structure and expression in human lung carcinoma cell lines. J Cell Biochem 1996;24: 237–46. Gorbulev V, Akhundova A, Grzeschik KH, Fahrenholz F. Organization and chromosomal localization of the gene for the human bombesin receptor subtype expressed in pregnant uterus. FEBS Lett 1994;340(3):260–4. Jennings CA, Harrison DC, Maycox PR, Crook B, Smart D, Hervieu GJ. The distribution of the orphan bombesin receptor subtype-3 in the rat CNS. Neuroscience 2003;120(2):309–24. Kim JS, Rabe KF, Magnussen H, Green J, White SR. Migration and proliferation of guinea pig and human airway epithelial cells in response to tachykinins. Am J Physiol 1995;269:119– 26. Ladenheim EE, Hampton LL, Whitney AC, White WO, Battey JF, Moran TH. Disruptions in feeding and body weight control in gastrin-releasing peptide receptor deficient mice. J Endocrinol 2002;174(2):273–81. Makarenkova VP, Shurin GV, Tourkova IL, Balkir L, Pirtskhalaishvili G, Perez L, et al. Lung cancer-derived bombesin-like peptides down-regulate the generation and function of human dendritic cells. J Neuroimmunol 2003;145(1–2):55–67. McKay RA, Miraglia LJ, Cummins LL, Owens SR, Sasmor H, Dean NM. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-expression. J Biol Chem 1999;274:1715–22. Milusheva EA, Kortezova NI, Mizhorkova ZN, Papasova M, Coy DH, Balint A, et al. Role of different bombesin receptor subtypes mediating contractile activity in cat upper gastrointestinal tract. Peptides 1998;19(3): 549–56. Moody TW, Merali Z. Bombesin-like peptides and associated receptors within the brain: distribution and behavioral implications. Peptides 2004;25(3):511–20. Qin X, Garla S, Qu X, Xiao D, Coy D, Weber HC. A novel selective human BRS-3 agonist induces CREB
1858
peptides 27 (2006) 1852–1858
phosphorylation and transactivation. Gastroenterology 2004;126(4):A-259. [16] Ren Y-H, Qin X-Q, Guan C-X, Luo Z-Q, Zhang C-Q, Sun X-H. Temporal and spatial distribution of VIP, CGRP and their receptors in the development of airway hyperresponsiveness in the lungs. Acta Physiol Sin 2004;56(2):137–46. [17] Reubi JC, Wenger S, Schmuckli-Maurer J, Schaer JC, Gugger M. Bombesin receptor subtypes in human cancers: detection with the universal radioligand (125) I- [D-TYR (6), beta-ALA (11), PHE (13) NLE (14)] bombesin (6–14). Clin Cancer Res 2002;8(4):1139–46. [18] Ryan RR, Weber HC, Hou W, Sainz E, Mantey SA, Battey JF, et al. Ability of various bombesin receptor agonists and antagonists to alter intracellular signaling of the human orphan receptor BRS-3. J Biol Chem 1998;273(22):13613–24.
[19] Shan L, Emanuel RL, Dewald D. Bombesin-like peptide receptor gene expression, regulation, and function in fetal murine lung. Am J Physiol Lung Cell Mol Physiol 2004;286(1):L165–73. [20] Qin X-Q, Wu H, Xiang Y, Ren Y-H, Guan C-X. Temporal and spatial distribution of substance P and its receptor regulated by calcitonin gene-related peptide in the development of airway hyperresponsiveness. FEBS J 2004;272(s1):M3-020P. [21] Toi-Scott M, Jones CL, Kane MA. Clinical correlates of bombesin-like peptide receptor subtype expression in human lung cancer cells. Lung Cancer 1996;15(3): 341–54. [22] Weber D, Berger C, Eickelmann P, Antel J, Kessler H. Design of selective peptidomimetic agonists for the human orphan receptor BRS-3. J Med Chem 2003;46(10):1918–30.
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/peptides
Wound repair and proliferation of bronchial epithelial cells enhanced by bombesin receptor subtype 3 activation Yu-Rong Tan a,1, Ming-Ming Qi a,1, Xiao-Qun Qin a,*, Yang Xiang a, Xiang Li b, Yue Wang a, Fei Qu a, Hui-Jun Liu a, Jian-Song Zhang b a b
Xiangya School of Medicine, Central South University, Changsha 410078, Hunan, China Hunan Normal University, Changsha 410013, Hunan, China
article info
abstract
Article history:
The present study was designed to investigate the role of bombesin receptor subtype 3 (BRS-
Received 9 September 2005
3) in airway wound repair. The results showed that: (1) There was few expression of BRS-3
Received in revised form
mRNA in the control group. In contrast, the expression of BRS-3 mRNA was gradually
19 December 2005
increased in the early 2 days, and peaked on the fourth day, and then decreased in the
Accepted 19 December 2005
ozone-stressed AHR animal. BRS-3 mRNA was distributed in the ciliated columnar epithe-
Published on line 19 January 2006
lium, monolayer columnar epithelium cells, scattered mesenchymal cells and Type II alveolar cells; (2) The wound repair and proliferation of bronchial epithelial cells (BECs)
Keywords:
were accelerated in a concentration-dependent manner by BRS-3 activation with P3513,
Bombesin receptor subtype 3 (BRS-3)
which could be inhibited by PKA inhibitor H89. The study demostrated that activation of
Airway hyperresponsiveness (AHR)
BRS-3 may play an important role in wound repair of AHR. # 2006 Elsevier Inc. All rights reserved.
Bronchial epithelium cells (BECs) Abbreviations: BRS-3, bombesin receptor subtype 3 AHR, airway hyperresponsiveness BECs, bronchial epithelium cells ASO, antisense oligonucleotide ISH, in situ hybridization
1.
Introduction
BRS-3 is a 399-amino acid protein and has 51% and 47% amino acid sequence homology to the other two members of the bombesin receptor family, the gastrin-releasing peptide (GRP) receptor and the neuromedin B (NMB) receptor, respectively.
Unlike GRP and NMB receptors which have a widespread distribution in the central nervous system and peripheral tissues [10,11,13,14], distribution of BRS-3 is just limited to secondary spermatocytes [5], pregnant uterus [7], a few brain tissues [8], human lungs [3], adipose tissues [1], epidermal cancer cell lines [6], etc. As of now, biological effects of BRS-3
* Corresponding author. Tel.: +86 731 2650341. E-mail address: [email protected] (X.-Q. Qin). 1 First two authors have made equal contributions to this work. 0196-9781/$ – see front matter # 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2005.12.012
peptides 27 (2006) 1852–1858
have still remained unknown. According to certain reports, the expression level of BRS-3 in organism normal tissues is low, but its level in developing lungs [4,19] and certain lung carcinomas is high [17,21], indicating that BRS-3 may be involved in cell growth and wound repair. As of now, there have no papers published about the expression of BRS-3 in adult lungs and whether it is involved in wound repair or cell proliferation during airway inflammation or airway hyperresponsiveness (AHR). The aim of this study is to investigate the temporal and spatial distribution of BRS-3 mRNA in a novel zone-stressed AHR model. P3513 [22], a synthesized bombesin-derived ligand, can specifically bind to BRS-3 with high affinity. It was used in this present experiment to activate BRS-3 in order to observe the effect of BRS-3 on the repair and proliferation of BECs and its signal pathway.
2.
Materials and methods
2.1.
Animals model
1853
A novel animal AHR model was prepared as described in detail previously [16]. Briefly, New Zealand rabbits were placed in 40 cm 30 cm 25 cm boxes. The animals in control group inhaled fresh air, while the animals in stress groups inhaled a mixture of 1.5 ppm ozone and fresh air for 2, 4, and 8 days, respectively, with 1 h for each day. After the stress, the airway resistance of the animals was measured, and then cell numbers and proteins in bronchial-alveolar lavage were identified after killing the animals, and lung tissue sections were prepared for structure examination, in order to clarify a successful establishment of the model.
Fig. 1 – In situ hybridization of BRS-3 mRNA in AHR and in cultured human BECs. It was shown that the structure of lung tissues was seriously damaged after being stressed with ozone. The expression of BRS-3 mRNA was increased with the elongation of ozone stress, peaked on the fourth day, and then decreased. (A) Hybridization signal of BRS-3 mRNA was distributed in the ciliated epithelium of bronchiole; (B) Hybridization signal was distributed in the columnar epithelium cells of terminal bronchiole; (C) Hybridization signal was distributed in Type II alveolar cells; (D) There was few expression of BRS-3 mRNA in the unstressed human BECs, but it was increased in the ozone-stressed BECs. Original magnification: 100 for all images.
1854
peptides 27 (2006) 1852–1858
Fig. 2 – Typical video micrographs of BEC monolayer wound closure from P3513 (10S7 M) group (2.841 mm2 starting area). Wound edges were somewhat irregular but easily visualized and traced on the digitized image. Monolayer images were digitized for 0, 4, 8, 12, 16, and 20 h and the wound area was calculated by image pro plus system automatically. The remaining wound area in mm2 was shown for each image. Original magnification: 100 for all images.
2.2.
Cells culture
An immortalized human BEC line was kindly provided by Professor Gruenernt from San Francisco Branch Campus, University of California and was cultured in a mixture medium of DMEM:F12 (1:1) containing 100 u/mL penicillin, 100 u/mL streptomycin, and 10% heat inactivated fetal bovine serum and incubated at 37 8C in 5% CO2.
2.3.
In situ hybridization (ISH)
The following probes were used for the in situ hybridization to localize mRNAs of BRS-3: 50 -GCCTCACTCACCTAATCAGACTTTAATTTC-30 (nucleotides163–193 bp from ATG), 50 -TGTGCCATCTATATCACTTATGCTGTGATC-30 (nucleotides 291–320 bp from ATG), 50 -AATCCATGCAAAC AGTTCCA AATATTTTCA-30 (nucleotides 316–345 bp from ATG). They were labeled with digoxin at the 50 -end by TaKaRa Biotechnology Company, Dalian, China. Briefly, the lung tissues were fixed in 10% paraformaldehyde, embeded in paraffin, cut into 6 mm paraffin sections and placed on slides. The slides were incubated with 30% H2O2 and 5% pepsin in turn and then hybridized at 42 8C overnight with labeled probes (2.0 g/mL). After washing, the slides were then sequentially incubated with blocking buffers, biotin labled mouse-anti-digoxin antibodies, streptavidin biotin peroxidase complex (sABC) and biotin labled peroxidase, followed by rinsing with PBS after every step. The peroxidant activity was visualized by the 3, 30 diaminobenzidine tetrahydrochloride (DAB). The slides were incubated with normal mouse serum instead of the mouse-anti-digoxin antibody in absence of the labeled probes for the negative control.
2.4.
with P3513 (kindly provided by Dr. Weber from Boston University) in various concentrations and calmodulin inhibitor W7 (106 M), MEK inhibitor PD98059 (106 M) and PKA inhibitor H89 (106 M). W7, PD98059 and H89 were provided by Sigma, St. Louis, MO, USA.
2.5.
Proliferation assay
The cells were trypsinized in a 0.25% trypsin solution and seeded in a 96-well plate at a density of 104 cells/(0.1 mL/well). After the cells were grown for 24 h to approximately 80% subconfluent state, 0.1 mL serum-free medium was added to
Wound repair assay
Immortalized human BECs were cultured in 12-well plates with DMEM: F12 (1:1), and a small wound was made in the confluent monolayer by mechanical scraping. The edge of wound was recognized and the remaining wound area was measured serially per 4 h in 24 h by video microscopy (Olympus Company, Japan). A linear regression equation of the remaining wound area to time was obtained. Repair index (RI), equal to the absolute value of slope, was used to judge the repair speed of BECs. In order to determine the effects and the signal pathway of BRS-3 activation in mediating wound repair of BECs, BECs were pretreated
Fig. 3 – Closure of monolayer wounds in BECs after treatment with P3513. There was substantial acceleration of wound closure in a concentration-dependent manner after treatment with P3513 (10S9, 5 10S9, 10S8, 5 10S8, 10S7, 5 10S7, and 10S6 M). Data represented the mean W S.E. of 10 separate experiments. *P < 0.05 vs. control.
peptides 27 (2006) 1852–1858
1855
Fig. 4 – Effect of H89 (10S6 M), W7 (10S6 M) and PD98059 (10S6 M) on closure of monolayer wounds in BECs induced by P3513 (10S7 M). (A) H89 inhibited the acceleration of wound closure induced by P3513; (B) W7 strengthened the acceleration of wound closure induced by P3513; (C) PD98059 strengthened the acceleration of wound closure induced by P3513. Data represented the mean W S.E. of 10 separate experiments. *P < 0.05 vs. P3513 group.
each well to synchronize the growth of cells for 24 h. Then various concentrations of P3513, W7, PD98059, H89 were added to each well and incubated for another 24 h. Each treatment was tested in at least six wells. Next, 15 (L of a 0.5% MTT solution was added to each well and incubated for 4 h. Then, the medium and MTT were removed and 150 (L of DMSO was added to each well. The mixture was shaken for 10 min to dissolve the crystal. The OD of each well solution was determined at 570 nm by using an ELISA reader.
2.6.
Antisense oligonucleotide (ASO)
BRS-3 ASO was designed according to the human BRS-3 mRNA sequence (exon-1, nucleotides 480–500, CTCCCCGTGAACGATGACTGG). The ASO was synthesized at TaKaRa Biotechnology Company as a 21-base phosphorothioate chemic oligonucleotides, where bases 1–5 and 17–21 were modified with 20 -O-(2methoxy)-ethyl [12]. BECs were transfected with a BRS-3 ASO and lipofectin (Sigma, St. Louis, MO, USA) mixture for 4 h in serum-free DMEM. Then the ASO reaction mixture was replaced with normal growth media (with 10% FBS) and the cells were incubated under normal conditions for an additional 16–20 h. The efficacy of the ASO in inhibiting the activity of BRS-3 was verified by ISH.
2.7.
Statistical analyses
The numerical data were analyzed using unpaired Student’s ttest. Values were expressed by mean S.E. P < 0.05 was considered as statistically significant.
3.
sign of inflammationary infiltration, mucosal exudation, and cavitary stricture and there was few expression of BRS-3 mRNA. However, inflammationary infiltration, mucosal exudation, cavitary stricture and bronchial epithelial denudation were observed in the ozone-stressed group. The expression of BRS-3 mRNA was detectable in the early two days after the ozone stress, increased with the elongation of ozone stress, peaked on the fourth day, and then reduced. BRS-3 mRNA was predominantly localized in the ciliated columnar epithelium of bronchioles (Fig. 1A), monolayer columnar epithelium cells of terminal bronchioles (Fig. 1B), scattered mesenchymal cells and Type I alveolar cells (Fig. 1C). No BRS-3 mRNA was detectable in Type I alveolar cells. The results also showed that few expression of BRS-3 mRNA was detectable in the unstressed human BECs, but its expression was explicitly increased in ozone-stressed BECs (Fig. 1D).
3.2.
Effects of BRS-3 activation on wound repair of BECs
A small wound was made in each well with an area of approximate 2.676 0.014 mm2 (Fig. 2). The remaining wound area in the control group was decreased to 40.40 8.35% of the initial area (RI, 0.1807) 24 h later. Satisfactory correlation was detectable between the time and the remaining wound area (r = 0.951, P < 0.01). The repair of BECs was accelerated by P3513 (109, 5 109, 108, 5 108, 107, 5 107, and 106 M) in a concentration-dependent manner (RI, 0.1812, 0.1779, 0.2201, 0.2706, 0.3270, 0.3147, and 0.2906, respectively) (Fig. 3). H89 could inhibit the accelerating effect induced by 107 M of P3513 (RI, 0.2158, P < 0.05) (Fig. 4A). Interestingly, W7 and PD98059 seemed to strengthen the effect of 107 M of P3513 on the repair of BECs (RI, 0.4135, P < 0.05; 0.4047, P < 0.05, respectively) (Fig. 4 B and C).
Results 3.3.
3.1. The expression of BRS-3 mRNA in lungs and cultured BECs In the normal group, the structure of bronchi walls and pulmonary alveoli were intact and regular, which showed no
Effects of BRS-3 activation on proliferation of BECs
Proliferation of BECs measured by MTT showed that BECs pretreatment with P3513 (above concentrations) could promote proliferation of BECs in a concentration-dependent manner (Fig. 5A). W7, H89 and PD98059 could obviously inhibit
1856
peptides 27 (2006) 1852–1858
Fig. 5 – Proliferation of BECs after treatment with P3513 and effect of H89 (10S6 M), W7 (10S6 M) and PD98059 (10S6 M) on proliferation of BECs induced by P3513 (10S7 M). (A) Results showed that BECs incubated with P3513 (10S9, 5 10S9, 10S8, 5 10S8, 10S7, 5 10S7, and 10S6 M) for 24 h were proliferated in a concentration-dependent manner (*P < 0.05 vs. control). (B) W7, H89 and PD98059 inhibited the proliferation of BECs induced by 10S7 M of P3513 (**P < 0.01 vs. control; #P < 0.05 vs. P3513 group). Data represented the mean W S.E. of 10 separate experiments.
the proliferation of BECs induced by 107 M of P3513 (P < 0.05; P < 0.05; P < 0.05, respectively) (Fig. 5B).
3.4. Effects of BRS-3 ASO on wound repair and proliferation of BECs The inhibitory effect of BRS-3 ASO (0.4, 0.8, and 1.2 mM) on BRS-3 expression was assayed by ISH (data not shown). The repair of BECs failed to be accelerated by 107 M of P3513 after pretreatment with 1.2 mM of BRS-3 ASO (RI, 0.1946) (Fig. 6A). MTT assay also showed that BECs incubated with 1.2 mM of BRS-3 ASO blocked the proliferation of BECs induced by P3513 (Fig. 6B).
4.
Disscussion
AHR is an important pathophysiological characteristic of bronchial asthma, which can explain many of the disease’s clinical features. The mechanism of AHR, however, has not yet been fully clarified. Previously, we found that a defect in structures and functions of airway epithelium may be the
initiator of AHR. In a stressed condition, airway epithelial cells transmit inflammatory signals to leucocytes and activate an inflammation reaction in the airway. During this process, BRS-3 may play the role as an important protective factor. We tried to observe the temporal and spatial distribution of BRS-3 mRNA expression in the lungs by using a novel animal model of AHR. The results demonstrated that the structure of lung tissues was seriously damaged after being stressed with ozone. Previously, we found that with the ozone stress, BECs were injuried and exfoliated, sensory nerve fibers in the basilar membrane were exposed and stimulated by inflammatory media, and the release of regulatory peptides was gradually increased. During this course, certain protective regulatory peptides released in the prophase such as vasoactive intestinal peptide and epidermal growth factor exerted downregulatory effects to lighten the inflammation, while certain regulatory peptides released in the metaphase and anaphase such as substance P and calcitonin gene-related peptides exerted upregulatory effects to aggravate the inflammation, which resulted in AHR [20]. In the present study, we observed that the expression of BRS-3 mRNA was gradually increased in the early 2 days, peaked on the fourth day, and then decreased. BRS-3 mRNA was predominantly localized in the ciliated columnar epithelium, monolayer columnar epithelium, scattered mesenchymal cells and Type II alveolar cells, indicating that BRS-3 functions in the prophase and modulates the function of various epithelial cells and mesenchymal cells. To further determine the effects of BRS-3 activation in AHR, we tried to observe the effects of BRS-3 activation on wound repair and proliferation of BECs. It is reported that the wound repair mainly depends on migration and proliferation. In the prophase of wound repair, the precursor cells around the wound initiate the migration and proliferation of BECs [2]. The migration and dissemination to the wound occur within 16– 20 h after damage and the proliferation occurs around 24 h after the damage [9]. The findings that the repair and proliferation of BECs were accelerated in a concentrationdependent manner by P3513 and slowed down after treatment with BRS-3 ASO indicate that BRS-3 may be beneficial for the recovery of wound or AHR. Since few native cell lines can express high levels of BRS-3, the transduction mechanism of BRS-3 has not yet known. Ryan et al. found that hBRS-3 receptor activation could increase the activity of phospholipase C, resulting in the generation of inositol phosphates and changes in [Ca2+], which could be also coupled to tyrosine kinase activation, but not to adenylate cyclase activation or inhibition [18]. However, we found that a novel selective human BRS-3 agonist could induce CREB phosphorylation and transactivation [15], indicating that the signal transduction of BRS-3 may be associated with adenylate cyclase activation. Results of our present study also showed that H89 could inhibit the accelerating effect of BRS-3 activation, indicating that the promoting repair and proliferation of BRS3 activation may be dependent on a PKA pathway. However, W7 and PD98059 seemed to strengthen the repair of BECs induced by P3513, but inhibit the proliferation, suggesting that repair and proliferation may have different signal transduction pathways.
peptides 27 (2006) 1852–1858
1857
Fig. 6 – Effects of BRS-3 ASO on wound repair and proliferation of BECs induced by P3513 (10S7 M). (A) BRS-3 ASO (1.2 mM) pretreatment inhibited the wound repair of BECs (*P < 0.05 vs. P3513 group); (B) BRS-3 ASO (1.2 mM) pretreatment inhibited the proliferation of BECs (**P < 0.01 vs. control; #P < 0.05 vs. P3513 group). Data represented the mean W S.E. of 10 separate experiments.
In a word, our present study demonstrates that upregulation and activation of BRS-3 in the lungs may play an important role in wound repair of AHR. BRS-3 activation can promote the migration or proliferation of BECs so as to help the repair of the airway, which were associated with the pathways of Ca2+/calmodulin-dependent protein kinase, cAMP-PKA, as well as TPK-Ras-MAPK.
Acknowledgements This work was supported by the Grant #30470755 from the National Natural Science Foundation of China. We thank Professor Gruenernt from San Francisco Branch Campus, the University of California for the gift of an immortalized human BEC line and Dr. Weber from Boston University for P3513.
[6]
[7]
[8]
[9]
[10]
references [11] [1] Aoki K, Sun YJ, Aoki S, Wada K, Wada E. Cloning, expression, and mapping of a gene that is upregulated in adipose tissue of mice deficient in bombesin receptor subtype-3. Biochem Biophys Res Commun 2002;290(4):1282–8. [2] Ayer MM, Jeffery PK. Proliferation and differentiation in mammalian airway epithelium. Eur Respir J 1988;1: 58–80. [3] Cullen A, Emanuel RL, Torday JS, Asokananthan N, Sikorski KA, Sunday ME. Bombesin-like peptide and receptors in lung injury models: diverse gene expression, similar function. Peptides 2000;21(11):1627–38. [4] Emanuel RL, Torday J, Shahsafaei A. Bombesin-like peptides and receptors in normal fetal baboon lung: roles in lung growth and maturation. Am J Physiol Lung Cell Mol Physiol 1999;277:L1003–7. [5] Fathi Z, Corjay MH, Shapira H, Wada E, Benya R, Jensen R, et al. BRS-3: a novel bombesin receptor subtype selectively
[12]
[13]
[14]
[15]
expressed in testis and lung carcinoma cells. J Biol Chem 1993;268(8):5979–84. Fathi Z, Way JW, Corjay MH, Viallet J, Sausville EA, Battey JF. Bombesin receptor structure and expression in human lung carcinoma cell lines. J Cell Biochem 1996;24: 237–46. Gorbulev V, Akhundova A, Grzeschik KH, Fahrenholz F. Organization and chromosomal localization of the gene for the human bombesin receptor subtype expressed in pregnant uterus. FEBS Lett 1994;340(3):260–4. Jennings CA, Harrison DC, Maycox PR, Crook B, Smart D, Hervieu GJ. The distribution of the orphan bombesin receptor subtype-3 in the rat CNS. Neuroscience 2003;120(2):309–24. Kim JS, Rabe KF, Magnussen H, Green J, White SR. Migration and proliferation of guinea pig and human airway epithelial cells in response to tachykinins. Am J Physiol 1995;269:119– 26. Ladenheim EE, Hampton LL, Whitney AC, White WO, Battey JF, Moran TH. Disruptions in feeding and body weight control in gastrin-releasing peptide receptor deficient mice. J Endocrinol 2002;174(2):273–81. Makarenkova VP, Shurin GV, Tourkova IL, Balkir L, Pirtskhalaishvili G, Perez L, et al. Lung cancer-derived bombesin-like peptides down-regulate the generation and function of human dendritic cells. J Neuroimmunol 2003;145(1–2):55–67. McKay RA, Miraglia LJ, Cummins LL, Owens SR, Sasmor H, Dean NM. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-expression. J Biol Chem 1999;274:1715–22. Milusheva EA, Kortezova NI, Mizhorkova ZN, Papasova M, Coy DH, Balint A, et al. Role of different bombesin receptor subtypes mediating contractile activity in cat upper gastrointestinal tract. Peptides 1998;19(3): 549–56. Moody TW, Merali Z. Bombesin-like peptides and associated receptors within the brain: distribution and behavioral implications. Peptides 2004;25(3):511–20. Qin X, Garla S, Qu X, Xiao D, Coy D, Weber HC. A novel selective human BRS-3 agonist induces CREB
1858
peptides 27 (2006) 1852–1858
phosphorylation and transactivation. Gastroenterology 2004;126(4):A-259. [16] Ren Y-H, Qin X-Q, Guan C-X, Luo Z-Q, Zhang C-Q, Sun X-H. Temporal and spatial distribution of VIP, CGRP and their receptors in the development of airway hyperresponsiveness in the lungs. Acta Physiol Sin 2004;56(2):137–46. [17] Reubi JC, Wenger S, Schmuckli-Maurer J, Schaer JC, Gugger M. Bombesin receptor subtypes in human cancers: detection with the universal radioligand (125) I- [D-TYR (6), beta-ALA (11), PHE (13) NLE (14)] bombesin (6–14). Clin Cancer Res 2002;8(4):1139–46. [18] Ryan RR, Weber HC, Hou W, Sainz E, Mantey SA, Battey JF, et al. Ability of various bombesin receptor agonists and antagonists to alter intracellular signaling of the human orphan receptor BRS-3. J Biol Chem 1998;273(22):13613–24.
[19] Shan L, Emanuel RL, Dewald D. Bombesin-like peptide receptor gene expression, regulation, and function in fetal murine lung. Am J Physiol Lung Cell Mol Physiol 2004;286(1):L165–73. [20] Qin X-Q, Wu H, Xiang Y, Ren Y-H, Guan C-X. Temporal and spatial distribution of substance P and its receptor regulated by calcitonin gene-related peptide in the development of airway hyperresponsiveness. FEBS J 2004;272(s1):M3-020P. [21] Toi-Scott M, Jones CL, Kane MA. Clinical correlates of bombesin-like peptide receptor subtype expression in human lung cancer cells. Lung Cancer 1996;15(3): 341–54. [22] Weber D, Berger C, Eickelmann P, Antel J, Kessler H. Design of selective peptidomimetic agonists for the human orphan receptor BRS-3. J Med Chem 2003;46(10):1918–30.