- Email: [email protected]
Xenopus tropicalis allurin: Expression, purification, and characterization of a sperm chemoattractant that exhibits cross-species activity
Available online at www.sciencedirect.com
Developmental Biology 316 (2008) 408 – 416 www.elsevier.com/developmentalbiology
Xenopus tropicalis allurin: Expression, purification, and characterization of a sperm chemoattractant that exhibits cross-species activity Lindsey A. Burnett, Serenity Boyles, Christopher Spencer, Allan L. Bieber, Douglas E. Chandler ⁎ Molecular and Cellular Biology Program, School of Life Sciences and Department of Chemistry and Biochemistry, Arizona State University, Tempe, AZ 85287-4501, USA Received for publication 19 December 2007; revised 30 January 2008; accepted 31 January 2008 Available online 15 February 2008
Abstract Previously we reported the identification of the first vertebrate sperm chemoattractant, allurin, in the frog Xenopus laevis (Xl) and demonstrated that it was a member of the CRISP family of proteins. Here we report identification, purification, and characterization of Xenopus tropicalis (Xt) allurin, a homologous protein in X. tropicalis. “Egg water” as well as purified allurin from both species exhibit efficient crossspecies sperm chemoattractant activity. Western blots show that Xt egg water contains a single anti-allurin cross-reactive protein whose molecular weight (20,497 Da by MALDI MS) agrees well with the molecular weight of the hypothetical gene product for a newly recognized “Crisp A” gene in the X. tropicalis genome. A recombinant form of the protein, expressed in 3T3 cells, exhibits chemoattraction for both Xt and Xl sperm and cross reacts with anti-allurin antibodies. Examination of Crisp protein expression in the Xt oviduct using RT-PCR showed that of five documented Xt Crisp genes (Crisps 2, 3, LD1, LD2 and A) only Crisp A was expressed. In contrast, Crisp 2, Crisp 3, Crisp LD1, and Crisp LD2, but not Crisp A, were all found to be expressed in the Xt testes while subsets of Crisp proteins where expressed in the Xt ovary. These data suggest that Crisp proteins in amphibians may play multiple roles in sperm production, maturation and guidance just as they are thought to in mammals indicating that Crisp protein involvement in reproduction may not be limited to mammals. © 2008 Elsevier Inc. All rights reserved. Keywords: Fertilization; Egg jelly; Sperm chemotaxis; CRISP proteins; Crisp A gene
Introduction Successful fertilization requires a well-choreographed series of events that include sperm chemotaxis, acrosomal exocytosis, and sperm–egg binding and fusion (Wassarman et al., 2001; Evans and Florman, 2002; Hoodbhoy and Dean, 2004). In particular, directed motility of sperm, that is, chemotaxis, is thought to play an instrumental role in fertilization of both vertebrate and invertebrate eggs (Eisenbach and Giojalas, 2006; Kaupp et al., 2006; Burnett et al., in press). Sperm chemotaxis has been studied extensively in marine species with external fertilization including sea urchins, starfish, ascidians, abalone, and coral (Ward et al., 1985; Shiba et al., 2005; Miller, 1985; Neill and Vacquier, 2004; Nishigaki et al., 1996; Yoshida et al., 2002; Riffell et al., 2002, 2004; Morita et ⁎ Corresponding author. Fax: +1 480 965 9699. E-mail address: [email protected] (D.E. Chandler). 0012-1606/$ - see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2008.01.046
al., 2006). The chemical identity of the attractants used ranges from amino acids and peptides to lipids and sulfated steroids. Species specificity of sperm chemoattractants has been documented in a number of these marine organisms and is thought to be required because fertilization is external, gametes from multiple species are spawned simultaneously and gametes are broadly distributed by currents. Among vertebrates, sperm chemotaxis has been studied largely in mammals. In all mammalian species studied, follicular fluid has been demonstrated to elicit chemotaxis although the specific factors involved in this response remain unclear (Ralt et al., 1991; Cohen-Dayag et al., 1995; Oliveira et al., 1999). In vitro studies have indicated that steroids such as progesterone and odorants such as bourgeonal have sperm chemoattractant activity (Teves et al., 2006; Villanueva-Diaz et al., 1995; Spehr et al., 2003, 2006). Progesterone is thought to be secreted by both the mammalian egg and cumulus cells and therefore is hypothesized to act in vivo as a chemoattractant
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
(Sun et al., 2005). In contrast, odorants have not been demonstrated to be present in reproductive fluids and therefore the significance of their activity is yet to be understood. In contrast to marine invertebrates, heterospecies chemotaxis of mammalian sperm to both follicular fluid and progesterone has been reported, implying that mammals likely do not rely on chemotaxis as a mechanism to prevent interspecies fertilization (Sun et al., 2003). Recent studies in lower vertebrates such as frogs have demonstrated the existence of a protein sperm chemoattractant – allurin – that is released from jellied eggs upon spawning (AlAnzi and Chandler, 1998; Olson et al., 2001; Xiang et al., 2004, 2005). Allurin is a member of the Cysteine-RIch Secretory Protein (CRISP) family which includes a number of venom and allergen proteins as well as a series of sperm binding proteins found in the mammalian male reproductive tract during spermatogenesis (Kratzschmar et al., 1996; Gibbs and O'Bryan, 2007). Crisp family proteins in mammals have been implicated in a number of important roles in the fertilization process including spermatogenesis, epididymal maturation, regulation of capacitation, and sperm–egg fusion (Rochwerger et al., 1992; Cohen et al., 2007; Roberts et al., 2003, 2007). Growing evidence suggests that Crisp family proteins are involved in sperm binding during many fertilization events (Ellerman et al., 2006; Busso et al., 2007; Cohen et al., 2007). In this study we provide evidence for conservation of allurinmediated sperm chemotaxis in Xenopus tropicalis and demonstrate the ability of allurins to elicit heterospecies chemotaxis. In addition, we demonstrate that X. tropicalis allurin (Xt allurin) purified from egg water exhibits a molecular weight by mass spectroscopy that is nearly identical to that of a sequence RTPCR amplified from X. tropicalis oviduct RNA using primers designed from entries in EST databases. Further, we show that a recombinant form of this protein can be produced in mouse 3T3 cells having the same molecular weight and antibody reactivity as Xt allurin found in egg water; this recombinant protein can also effectively elicit sperm chemotaxis. Materials and methods In silico identification of Crisp family genes in X. tropicalis Crisp 2 and Crisp 3 have already been identified and annotated in a X. tropicalis genome browser (http://genome.ucsc.edu/). Crisp LD1 and Crisp LD2 were identified as putative Crisp family genes in X. tropicalis by similarity of gene structure to murine genes of the same name. A tblastn search using the amino acid sequence for Xenopus laevis allurin to query the Sanger Institute EST database for X. tropicalis revealed an oviductal cDNA that predicted a protein with high amino acid similarity to X. laevis allurin and a similar molecular weight. This cDNA transcript was then used to blat the X. tropicalis genome and identify the location of the Xt allurin gene.
Tissue and gamete procurement Male and female X. laevis and X. tropicalis were obtained commercially (Carolina Biological or NASCO or Pacific Biotech) and kept on a 12 h/12 h light/dark cycle at 25 °C. Testes were obtained from sexually mature euthanized male frogs for cDNA preparation and sperm isolation. Sperm were obtained from euthanized frogs by dissection and perfusion of the testes with 1.5 × oocyte Ringer's medium (OR2) (124 mM NaCl, 3.75 mM KCl, 1.5 mM CaCl2, 1.5 mM
409
MgCl2, 1.5 mM Na2HPO4, 10 mM Hepes, pH 7.8) (X. laevis) or L-15/10% Fetal Calf Serum (X. tropicalis) and stored on ice until use, typically within 2 h. Oviduct was obtained from sexually mature Xenopus injected with 1000 IU of human chorionic gonadotropin (hCG; Sigma) 8 h prior. Eggs were also obtained from hormonally primed animals approximately 8–12 h post injection in X. laevis and 6–8 h post injection in X. tropicalis.
cDNA preparation for determination of Crisp gene expression Tissue for cDNA isolation was obtained as described above, homogenized with Trizol reagent (Invitrogen) and RNA was isolated by chloroform extraction and isopropanol precipitation. Complementary DNA (cDNA) was generated by reverse transcription of total RNA using the Superscript First Strand Synthesis System (Invitrogen); mock controls in which the Superscript was left out during cDNA synthesis were concurrently performed. Crisp family gene expression was assessed by PCR using specific gene primers designed and generated from the X. tropicalis genome (Crisp 2 Forward: GGCTTCCTATCCAGCCTCTT, Reverse: TTTGGGCCAGTTTTATACGG; Crisp 3 Forward: AACCCAACTGCATCCAACAT, Reverse: GGGTATAATGCCCAATGACG; Crisp LD1 Forward: AGTCATTGGGCAGAATTTGG, Reverse: CACCAATTTCCCTTTGGAGA; Crisp LD2 Forward: TCCAGGCTTGGTATGATGAA, Reverse: GGCAAGCAGAACAAGGATGT; Crisp A Forward: GGAGGAACGCCAATGTTAGA, Reverse: AATCAGGCTTCGCAGTTGTT). PCR products were visualized by running a 1% agarose gel in TAE (Tris Acetate EDTA) and stained with ethidium bromide.
Electrophoresis and western blotting SDS-PAGE was performed using 4–12% gradient gels (NuPage) with a MES running buffer (Invitrogen) and either stained with Coomassie Blue (Simply Blue, Invitrogen) for densitometry, or electrophoretically transferred to PVDF membrane in the presence of Towbin buffer (25 mM Tris, 193 mM glycine, 0.1% SDS, pH 8.4, 20% methanol v/v) for western blotting. Nonspecific membrane binding sites were blocked with a 5% solution of non-fat milk powder in Tris-buffered saline with Tween (TBST; 12.5 mM Tris, 140 mM NaCl, 0.1% v/v Tween, pH 7.6) and the membrane was probed in TBST with a polyclonal anti-allurin antibody (Rockland) characterized previously (Xiang et al., 2005). Goat anti-rabbit IgG antibodies (Sigma) conjugated to alkaline phosphatase were then used to probe the primary antibodies. A chemifluorescent substrate (ECF; Amersham) was used to stain for phosphatase activity and the product visualized on a Molecular Dynamics Storm 840 PhosphoImager. Densitometry of Coomassie Blue-stained gels was carried out by digital photography of the wet gel on a 5000 K light box followed by analysis of the electronic image using Scion Image software.
Preparation of egg water and purification of Xt allurin Egg water for biological assays was prepared by incubating approximately 1 g of freshly spawned eggs in 4 ml of F-1 buffer (41.25 mM NaCl, 1.25 mM KCl, 0.25 mM CaCl2, 0.06 mM MgCl2, 0.5 mM Na2HPO4, 2.5 mM Hepes, pH 7.8) for 1 h at room temperature. Densitometry traces indicated that a likely Xt allurin candidate at 22 kDa constituted 9.8% of the total egg water protein, a value similar to that for allurin in Xl egg water (8.5%). It is noted, however, that Xt egg water contains much higher amounts of protein (440 μg/ml compared to 130 μg/ml for Xl egg water) and therefore higher amounts of putative Xt allurin than does Xl egg water (data not shown). Egg water for Xt allurin purification was prepared by incubating approximately 1 g of freshly spawned eggs in 4 ml 50 mM Na2HPO4, pH 7.45 for 10 min at room temperature and the protein components separated by FPLC anion exchange chromatography. Thirty milliliters of egg water, containing 440 μg protein/ml was applied to a DEAE Q Hyper D ceramic resin column (17 cm by 1 cm; Life Technologies) using a BioCAD SPRINT Perfusion Chromatography System; the column was equilibrated with 50 mM Na2HPO4 at pH 7.45. Proteins were eluted with a linear gradient of 1 M NaCl in equilibration buffer. Fractions were then analyzed by SDS-PAGE, western blotting, and assayed for chemattractant activity. Xt allurin used for mass spectral analysis was additionally purified by reverse phase HPLC using a BioCAD SPRINT Perfusion Chromatography
410
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
System unit equipped with a Vydac C4 analytical column (Cat. # 214TP54) equilibrated with 0.1% trifluoroacetic acid in water and eluted with a linear gradient from 0 to 100% acetonitrile over 30 min. This purification resulted in a sharp peak of Xt allurin at 62.9% acetonitrile that was greater than 95% pure. The identity of this peak was confirmed by mass spectroscopy.
Cloning and expression of recombinant Xt allurin Cloning of Xt allurin was performed by amplification of the full-length Xt allurin transcript (Forward: TATCGATCGATCGCCACCATGGATACTTTCAACTTCATCATTTG, Reverse: GATACTCTAGAGGTTTGGAAACATTTTATGAAGC). The full-length transcript was then cut with Cla1 and Xba1 and ligated into a CS2MT vector cut with the same restriction enzymes for bacterial cloning. Plasmid DNA isolated from clones was then sequenced to verify identity and used to transiently transfect 3T3 cells using Lipofectamine (Invitrogen) according to the manufacturer's instructions. Serum free media was then obtained from these cells and analyzed by SDS-PAGE and western blotting to assess the presence of anti-allurin cross-reacting proteins.
Two-chamber transwell assay Egg water extracts were assayed for chemoattractant activity as previously described (Sugiyama et al., 2004) using Corning-Costar transwell assay plates consisting of two chambers separated by a polycarbonate membrane with 12 μm pores. Xenopus sperm were placed in the top chamber insert and a 100 μl bolus of the chemoattractant to be tested was carefully pipetted onto the floor of the bottom chamber. After incubation for 45 min at 24 °C, the top chamber was removed and sperm that had passed through the membrane into the bottom chamber were collected and counted using a hemocytometer. All assay data represent means and standard errors for at least three replicate experiments.
Results X. tropicalis egg water elicits sperm chemotaxis and contains an allurin-like protein Egg water from X. tropicalis prepared in F-1 buffer was assayed for sperm chemoattractant activity using a two-chamber assay. Chemoattractant activity increased with protein concentration and reached a peak at 15 μg/well with sperm movement into the bottom chamber increasing 4.5-fold over that seen in buffer controls (Fig. 1). Concentrations as low as 0.5 μg/well were sufficient to elicit 3.5-fold sperm movement to the bottom chamber compared to buffer controls (Fig. 1) Activity declined with increasing concentrations resulting in a biphasic curve similar to that seen for X. laevis egg water (Al-Anzi and Chandler, 1998). We predicted that this activity is likely due to the presence of an allurin-like chemoattractant in Xt egg water and this fact was confirmed by SDS PAGE and western blotting. As shown in Fig. 2, X. laevis (Xl) and X. tropicalis (Xt) egg waters have a similar but not identical protein makeup with bands ranging from 10 to 150 kDa relative mobility in each case. Of particular interest is that Xt egg water contains two bands at 19 and 22 kDa (arrows, lane 3) that are similar to Xl allurin (asterisk, lane 2) in relative mobility. Western blotting (lanes 4 and 5, Fig. 2) demonstrated that the 22 kDa band in X. tropicalis egg water labels with a polyclonal anti-allurin antibody (arrow, lane 5) and consequently we designated this protein Xt allurin.
Fig. 1. X. tropicalis egg water elicits a biphasic chemotactic response from X. tropicalis sperm in a two-chamber assay. The data are means and standard errors for three experiments.
Purification of Xt allurin Our initial approach was to isolate Xt allurin by anion exchange chromatography of egg water as previously described for purification of Xl allurin (Olson et al., 2001). However, this approach was complicated by the fact that Xt allurin did not bind to the column but instead appeared in the pass-through fraction. Since Xt allurin was predicted to bind based on its theoretical isoelectric point (pH 4.8), we hypothesized that the allurin was being competitively displaced from the column by other egg water proteins. Indeed, multiple passages of the Xt allurin-containing void fraction resulted in elution of a series of column-bound proteins on the third pass using a gradient of 0 to 0.65 M NaCl over a 45-min period (Fig. 3A). The first peak, collected at 14% NaCl, was analyzed by SDS-PAGE and western blotting and identified as purified Xt allurin (Fig. 3A, inset). This FPLC-separated Xt allurin was used to assess the biological activity of the protein. Xt allurin was additionally purified by reverse phase HPLC for mass spectroscopic analysis (Fig. 3B). The molecular weight of Xt allurin was determined to be 20,497 Da (isotopically averaged) by MALDI-MS (Fig. 3C). This mass corresponds well with the mass of a protein predicted to be 20,493 Da based on cDNA data from the Sanger Institute EST database and the UCSC genome browser; these data also suggest that no posttranslational modifications including glycosylation are made to Xt allurin. Interestingly, two accompanying molecular ion peaks of 20,426 and 20,111 kDa corresponded precisely to the same protein truncated at the C-terminal by one and four amino acids respectively. Egg water and purified allurins elicit heterospecies chemotaxis We assessed the ability of egg water, purified Xl allurin and purified Xt allurin to elicit sperm chemotaxis in each of the two species. There was no significant difference found between the ability of egg water from X. laevis and egg water from X. tropicalis to elicit chemotaxis in X. laevis sperm (Fig. 4A). The
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
411
number of sperm crossing into the bottom chamber in the presence of X. tropicalis egg water was 95% of that seen with X. laevis egg water. In addition, purified Xl allurin and Xt allurin exhibited nearly identical chemoattractant activity toward Xl sperm (Fig. 4A). Cross-species chemotaxis was also elicited when X. tropicalis sperm were presented with either egg water or purified allurin from X. laevis (Fig. 4B). Egg water from X. laevis actually stimulated greater sperm movement than X. tropicalis egg water at the concentrations used. Upon purification, however, Xt allurin stimulated approximately 20% more Xt sperm movement than purified Xl allurin. Nevertheless, Xl allurin still elicited a strong chemotactic response with more than a 2.5-fold increase in sperm movement compared to controls (Fig. 4B). Cloning, expression and activity of recombinant Xt allurin
Fig. 2. Comparison of X. laevis egg water and X. tropicalis egg water in protein composition. Lanes 1–3: Coomassie blue-stained SDS-PAGE gel showing that Xl and Xt egg waters are of similar complexity (lanes 2 and 3 respectively). Xl egg water contains one band in the 18–25 kDa range (asterisk) while Xt egg water contains two bands in this range (arrows). Lanes 4 and 5: Western blotting of equivalent samples using a polyclonal anti-allurin antibody identifies Xl allurin (asterisk, lane 4) and Xt allurin (arrow, lane 5). The arrows in lanes 3 and 5 correspond to the same protein with a relative mobility of 22 kDa. The asterisks in lanes 2 and 4 correspond to the same protein with a relative mobility of 23 kDa. These results are representative of three different preparations of egg water in each species.
To identify putative transcripts for an allurin-like protein in X. tropicalis, an in silico tblastn was performed using the Xl allurin amino acid sequence to query the Sanger Institute X. tropicalis EST database. Five high scoring results were found corresponding to a single transcript in the X. tropicalis oviduct that predicted a secreted protein of 20,493 Da with 62% similarity to allurin in X. laevis (see below). Blatting of this sequence against the X. tropicalis genome was used to predict the sequence of the full-length cDNA and to design primers for amplifying and cloning this cDNA using mRNA isolated from Xt oviduct. To confirm that this transcript produced Xt allurin we performed a tryptic digest of native Xt allurin purified from egg water and compared these fragments to those for the
Fig. 3. Purification of X. tropicalis allurin. (A) Elution profile of the third pass of Xt egg water through a Hyper QD anion exchange column. Inset: Coomassie-stained gel and western blot with anti-allurin antibodies identifies peak one as Xt allurin. (B) Xt allurin was additionally purified by RP-HPLC and eluted at 62.9% acetonitrile as indicated. (C) The MALDI-MS spectrum of this peak indicates that Xt allurin has a molecular weight of 22,497 Da. Peaks at 20,426 and 20,111 Da correspond to two truncated forms of Xt allurin missing one and four amino acids from the C terminus, respectively. These results were similar in two different preparations of Xt allurin.
412
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
Identification of the Crisp A Gene
Fig. 4. Cross-species sperm chemoattractant activities of X. laevis and X. tropicalis allurin. (A) X. laevis sperm respond to egg water and purified allurins from both species with a 3- to 5-fold increase in sperm crossing a barrier into the chemoattractant-containing chamber. (B) X. tropicalis sperm respond to egg water and purified allurins from both species. The total protein present in each assay well for Xt allurin, Xt egg water, Xl allurin, and Xl egg water were 2 μg, 40 μg, 0.5 μg and 30 μg respectively. The data are means and standard errors for three experiments.
predicted protein. MALDI mass spectrometry documented fragments covering approximately 83% of the predicted sequence; one fragment representing 9% of the predicted sequence (residues 37–53) was sequenced by electrospray TOF/ TOF mass spectrometry and found identical to the predicted fragment sequence (data not shown). We then cloned this transcript and expressed it in transiently transfected mouse 3T3 cells in culture; since this protein is predicted to be secreted, the medium from transfected cells was removed and characterized by electrophoresis and western blot. Contained in the medium from Xt allurintransfected cells is a strong anti-allurin cross-reacting protein (asterisk, lane 2, Fig. 5A) having the same relative mobility (22 kDa) as Xt allurin purified from Xt egg water; in contrast, medium from cells transfected with an empty vector does not contain this protein (lane 3, Fig. 5A). These medium samples were then assayed for chemotactic activity using a twochamber assay. Medium from Xt allurin-transfected cells demonstrated a 4-fold increase in sperm movement compared to buffer controls and compared to medium from cells transfected with empty vector (Fig. 5B).
The EST sequence hypothesized previously to encode Xt allurin was blatted against the X. tropicalis genome to determine the location and exon structure for this gene. The genome location scoring highest (736, 17 times higher than the score for second place) is the negative strand of Scaffold 63: 1285105– 1297632, a region that has not yet been annotated as a gene. The new gene, denoted Crisp A, consists of eight exons, seven of which code for the protein and one of which codes for the 3′ untranslated portion of the mRNA. Fig. 6A shows the amino acid sequence of Xt allurin, the protein product of this gene, as obtained by three different methods: 1) back translation of five overlapping ESTs from the Sanger Institute database, 2) sequencing of the cDNA prepared by RT-PCR of Xt oviduct RNA using gene-specific primers and 3) blatting of the EST sequence against the X. tropicalis genome to determine the genomic nucleotide sequence. The back translated amino acid sequence from these three methods were in complete agreement. Alignment of this sequence with those of mouse Crisp 1 and 2 demonstrates the overall homology between Xt allurin and mammalian Crisps, the 10 cysteines whose positions are conserved in all three proteins (asterisks) and the stretch of 36 amino acids found in full length Crisp 1 and 2 but not in Xt allurin. Preliminary data indicate these conserved cysteines present in Xt allurin are involved in disulfide linkages (Burnett, unpublished results). The exon and coding structure of the Crisp A gene shows a striking parallel to the Crisp 1 gene of mouse (Fig. 6B). Both genes have 7 exons that code for the amino acid sequence as indicated by the thin continuous line above the exon structure for each gene. In Fig. 6A, the sequences contributed by each
Fig. 5. Expression and sperm chemoattractant activity of recombinant Xt allurin. (A) Western blot of allurin purified from Xl egg water (lane 1), medium from 3T3 cells expressing recombinant Xt allurin (lane 2), and medium from 3T3 cells transfected with an empty vector (lane 3). (B) Sperm chemoattractant activity of the medium from Xt allurin-transfected 3T3 cells compared to that of Xt egg water using a two-chamber assay. Data are means and standard errors for three experiments. Note that in (A) purified Xl allurin forms a ladder of multimers that are used as molecular weight standards. The molecular weight values given are actual size, not relative mobility. Both Xt and Xl allurin have a relative mobility that is 2 kDa higher than their actual size.
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
413
Fig. 6. Characterization of the Crisp A gene. (A) Pair-wise sequence alignment of Xt allurin with Xl allurin, mouse Crisp 1 and Crisp 2; the sequences contributed by sequential exons are demarcated with alternating bold and normal fonts (the exon structure for Xl allurin is unknown). Dots indicate identical residues in the proteins shown and asterisks indicate cysteines conserved between Xt allurin and mouse Crisp 1 and Crisp 2. (B) The exon structure of the Crisp A gene compared to the exon structure for the mouse Crisp 1 gene. These genes both have seven coding exons. The coding regions are indicated by the lines above the exon structure. (C) The genomic region surrounding Crisp A contains four additional putative Crisp genes. This clustering of Crisp genes is also seen in human, mouse and rat as shown in regional genomic maps.
exon are denoted by alternating bold and regular face type and close inspection shows that the exon boundaries within these amino acid sequences of Xt allurin, mouse Crisp 1 and mouse Crisp 2 are remarkably consistent. A further parallel is that the X. tropicalis Crisp A gene is found to be adjacent to 4 other Crisp genes—Crisp2, Crisp 3, Crisp 1/4 (putative and possibly a Crisp 4), and MGC108118 which encodes a predicted protein in the Crisp family (Fig. 6C). These paralogous genes likely arose from gene duplications in an earlier era. This clustering of Crisp family genes is seen in a number of species including rat, mouse and human (Fig. 6C). Although the exact order and positions of these genes varies between species they are confined to regions delineated by the
presence of the Rhag gene and the Tcap gene cluster in each species. Crisp gene and protein expression in the reproductive system of X. tropicalis We used RT-PCR to assess expression of Crisp family genes in the reproductive tissues of X. tropicalis. A number of Crisp family members are found in both male and female reproductive tissues in X. tropicalis (Fig. 7, “+” columns). Crisp A expression was found only in the female reproductive tract and was restricted to the oviduct. This agrees with our previous findings in X. laevis that indicate allurin expression is principally in the
414
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
Fig. 7. Determination of Crisp protein expression in X. tropicalis reproductive tissues by RT-PCR and western blotting. The Crisp A gene is expressed exclusively in the oviduct whereas a combination of Crisp genes are expressed in other reproductive tissues such as the testes and ovary; however, the egg appears to express no Crisp proteins. PCR amplification reactions were carried out using cDNA prepared either in the presence of reverse transcriptase (+) to detect mRNA templates or in the absence of reverse transcriptase (−) to detect contaminating genomic DNA templates.
oviduct (Xiang et al., 2004). On the other hand, multiple Crisps are expressed in the ovary and testes; in the ovary Crisp LD1 and Crisp LD2 are expressed as well as a low level of Crisp 2. In the testes, Crisp 2, Crisp 3, Crisp LD1, and Crisp LD2 are all expressed. In contrast, Fig. 7 shows that mature eggs do not express any of these Crisp genes implying that any Crisp family proteins found with them are likely produced by other cells associated with the egg at different developmental stages. This is true of Xt allurin; Xt allurin is clearly associated with the egg and diffuses out of the jelly layers of the mature egg whereas the gene is exclusively expressed in the oviduct. Discussion Here we document a new vertebrate gene in the X. tropicalis genome—Crisp A. The Crisp A gene has not yet been documented in other genomes but it is closely related to the Crisp gene family of mammals that includes Crisps 1 through 4, Crisp LD1 and Crisp LD2. In fact, the exon structure of the amphibian gene is strikingly similar to mammalian Crisp genes (e.g. Crisp 1) with the exon boundaries in the amino acid sequence being highly conserved (see Fig. 6). In addition, this amphibian gene lies within a Crisp gene cluster that most likely arose from gene duplication events. The cluster of Crisp genes found in the X. tropicalis genome is again remarkably similar to the clusters found in mammalian genomes, for example, those of mice, rats and humans. Thus, we would speculate that this gene cluster arose earlier in vertebrate evolution than has been previously assumed. The Crisp family of genes associated with reproductive function, previously speculated to be mammalian in origin, appear to be vertebrate in origin, being found in both lower and higher vertebrates. The protein product of the Crisp A gene – Xt allurin – is also distinctly of the Crisp family. A full typical length Crisp protein
(e.g. Crisp 1) contains three domains—a pathogenesis-related (PR) domain first characterized in plant pathogenesis-related proteins, a smaller hinge domain, and an ion channel regulatory (ICR) domain, the last having structural features and physiological properties akin to peptide toxins that block K+ channels and ryanodine channels (Kratzschmar et al., 1996; Gibbs and O'Bryan, 2007; Gibbs et al., 2006; Castaneda et al., 1995). Although Xt allurin is a truncated Crisp (it is missing the ICR domain) its first two domains, the PR domain and hinge domain, have 39% identity and 60% conserved similarity respectively to these domains in mammalian Crisp proteins (these values are for Crisp 1). In addition, Xt allurin has 10 cysteines positioned identically to those in the same domains of the mammalian proteins (asterisks, Fig. 6A). The apparent function of Xt allurin – sperm chemoattraction – is also consistent with the fact that Crisp proteins in mammals are thought to shepherd sperm through a number of transitions in their life history. Crisp 2, found in the testis, is thought to act as a spermatocyte–Seritoli cell adhesion molecule and is also packaged into the sperm acrosomal granule (Hardy et al., 1988; Foster and Gerton, 1996; Maeda et al., 1998). Crisp 1, secreted in the epididymis, binds to sperm and accompanies sperm into the female tract during ejaculation. Here, Crisp 1 is thought to modulate capacitation, possibly acting as a decapacitation factor, and, in addition, appears to be capable of modulating sperm–zona pellucida binding and of participating in sperm– egg fusion (Busso et al., 2007; Cohen et al., 2007; Roberts et al., 2003, 2007). Interestingly, although Xt allurin is derived from a Crisp gene, and is clearly a Crisp protein with a conserved biological role in sperm function, it differs from other well-characterized Crisps in a unique way—it originates from the female reproductive tract. To date, Crisp family members have been reported only in the male reproductive tract of mammals; in contrast, Xl allurin and Xt allurin are both expressed in the female reproductive tract, specifically in an accessory tissue—the oviduct. However, ongoing studies make it apparent that Crisp family members are expressed in the female reproductive tract of mammals as well. For example, PCR amplification using appropriate primers shows the presence of Crisp 1, Crisp LD1 and Crisp LD2 mRNA in mouse ovary (Burnett, unpublished results). In addition, this study documents a potential conservation of Crisp family function in the male reproductive tract. Crisp protein expression in X. tropicalis is found in both the male and the female tracts with testis, ovary and oviduct all showing presence of mRNA products from one or more Crisp genes. Indeed, the X. tropicalis testis expresses 4 different Crisp proteins—as many different Crisp proteins as are found in the mammalian male reproductive tract (potentially accounting for the absence of an epididymis or prostate gland in Xenopus). This suggests that these proteins may be significant for frog spermatogenesis and sperm maturation as has already been established in mammals (Roberts et al., 2007). The biological activity of Xt allurin sheds further light on species conservation of sperm chemoattraction mechanisms. Despite the fact that Xl and Xt allurins share only 62% identity
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
(reflecting the fact that these species are separated by millions of years of evolution) allurins from both species demonstrate cross-species activity, each attracting the sperm of the other species with ability almost equal to that for sperm of the same species. This cross-species activity is divergent from the paradigm found in most aquatic organisms, most notably marine invertebrates, where very different molecules such as peptides, lipids and sulfated steroids have all been implicated in sperm chemotaxis (Ward et al., 1985; Shiba et al., 2005; Miller, 1985; Neill and Vacquier, 2004; Nishigaki et al., 1996; Yoshida et al., 2002; Riffell et al., 2002, 2004; Morita et al., 2006). Marine invertebrates have devised not only different mechanisms to elicit chemotaxis, but also typically maintain speciesspecificity of these mechanisms. In contrast, mammalian sperm, like Xenopus sperm, seem to be attracted to similar molecules independent of species. The sperm chemoattractants found in follicular fluid (progesterone and others that are as yet uncharacterized) universally attract rabbit, bovine and human sperm (Sun et al., 2003). This similarity foreshadows a broad spectrum of species whose sperm might be attracted by Crisp proteins. Are mammalian sperm attracted by Crisp family proteins and are Crisp proteins found in mammalian follicular fluid or in oviductal secretions? One intriguing possibility is that both the male and female reproductive tracts of mammals produce truncated Crisps that are not unlike Xt allurin. The rat epididymis not only secretes Crisp 1 but also proteolytically processes the protein by truncating its C-terminal end, thereby removing the ICR domain that Xt allurin is missing (Roberts et al., 2002, 2007). This shortened form contains the same two domains as Xt allurin and has been shown to bind tightly to rat sperm and possibly remains bound even to the point of sperm–egg fusion. Likewise, humans are known to produce, by alternative splicing, a short isoform of Crisp 1 that contains the same domain structure as allurin. In this case, however, the range of tissues in which this isoform is expressed has not been determined. In summary, this report demonstrates the presence of a Crisp gene cluster in X. tropicalis, a lower vertebrate, that recapitulates those of mammals and further demonstrates that this cluster is expressed in reproductive tissues. This leads us to believe that the elucidation of Crisp protein reproductive functions in amphibians could have broader implications for higher vertebrates including mammals. The conservation of Crisp family member expression in the male reproductive tract of frogs suggests that the roles of these proteins in spermatogenesis might be evolutionarily conserved from frogs to mammals. Likewise, the broad distribution of Crisp family gene expression in the female reproductive tract suggests additional roles for Crisp family members in egg maturation and egg-directed sperm–egg interactions. Acknowledgments We thank the Protein Analysis Laboratory at ASU for use of their FPLC-HPLC unit for protein purification and the Nucleic Acid Analysis Laboratory at ASU for performing nucleic acid
415
sequencing. Likewise, we are indebted to the W.M. Keck Bioimaging Laboratory at ASU for use of their Leica NTS and SP2 laser scanning confocal microscopy units and to Dr. Randall Nelson for performing the TOF-TOF mass spectroscopy analysis of Xt allurin. We have benefited from many helpful discussions with Dr. Alan Rawls and Doug Anderson who provided advice on genome browsers and expression of proteins in mammalian cell culture. This study was supported by National Science Foundation grant IBN-0615435. References Al-Anzi, B., Chandler, D.E., 1998. A sperm chemoattractant is released from Xenopus egg jelly during spawning. Dev. Biol. 198, 366–375. Burnett, L., Xiang, X., Bieber, A., Chandler, D., in press. Crisp proteins and sperm chemotaxis: discovery in amphibians and explorations in mammals. Int J of Dev Biol. Busso, D., Cohen, D.J., Maldera, J.A., Dematteis, A., Cuasnicu, P.S., 2007. A novel function for CRISP1 in rodent fertilization: involvement in sperm– zona pellucida interaction. Biol. Reprod. 77, 848–854. Castaneda, O., Sotolongo, V., Amor, A.M., Stocklin, R., Anderson, A.J., Harvey, A.L., Engstrom, A., Wernstedt, C., Karlsson, E., 1995. Characterization of a potassium channel toxin from the Caribbean Sea anemone Stichodactyla helianthus. Toxicon 33, 603–613. Cohen, D.J., Da Ros, V.G., Busso, D., Ellerman, D.A., Maldera, J.A., Goldweic, N., Cuasnicu, P.S., 2007. Participation of epididymal cysteine-rich secretory proteins in sperm–egg fusion and their potential use for male fertility regulation. Asian J. Androl. 9, 528–532. Cohen-Dayag, A., Tur-Kaspa, I., Dor, J., Mashiach, S., Eisenbach, M., 1995. Sperm capacitation in humans is transient and correlates with chemotactic responsiveness to follicular factors. Proc. Natl. Acad. Sci. U. S. A. 92, 11039–11043. Eisenbach, M., Giojalas, L.C., 2006. Sperm guidance in mammals — an unpaved road to the egg. Nat. Rev., Mol. Cell Biol. 7, 276–285. Ellerman, D.A., Cohen, D.J., Da Ros, V.G., Morgenfeld, M.M., Busso, D., Cuasnicu, P.S., 2006. Sperm protein “DE” mediates gamete fusion through an evolutionarily conserved site of the CRISP family. Dev. Biol. 297, 228–237. Evans, J.P., Florman, H.M., 2002. The state of the union: the cell biology of fertilization. Nat. Cell Biol. 4 Suppl., s57–s63. Foster, J.A., Gerton, G.L., 1996. Autoantigen 1 of the guinea pig sperm acrosome is the homologue of mouse Tpx-1 and human TPX1 and is a member of the cysteine-rich secretory protein (CRISP) family. Mol. Reprod. Dev. 44, 221–229. Gibbs, G.M., O'Bryan, M.K., 2007. Cysteine rich secretory proteins in reproduction and venom. Soc. Reprod. Fertil. Suppl. 65, 261–267. Gibbs, G.M., Scanlon, M.J., Swarbrick, J., Curtis, S., Gallant, E., Dulhunty, A.F., O'Bryan, M.K., 2006. The cysteine-rich secretory protein domain of Tpx-1 is related to ion channel toxins and regulates ryanodine receptor Ca2+ signaling. J. Biol. Chem. 281, 4156–4163. Hardy, D.M., Huang Jr., T.T., Driscoll, W.J., Tung, K.K., Wild, G.C., 1988. Purification and characterization of the primary acrosomal autoantigen of guinea pig epididymal spermatozoa. Biol. Reprod. 38, 423–437. Hoodbhoy, T., Dean, J., 2004. Insights into the molecular basis of sperm–egg recognition in mammals. Reproduction 127, 417–422. Kaupp, U.B., Hildebrand, E., Weyand, I., 2006. Sperm chemotaxis in marine invertebrates — molecules and mechanisms. J. Cell. Physiol. 208, 487–494. Kratzschmar, J., Haendler, B., Eberspaecher, U., Roosterman, D., Donner, P., Schleuning, W.D., 1996. The human cysteine-rich secretory protein (CRISP) family. Primary structure and tissue distribution of CRISP-1, CRISP-2 and CRISP-3. Eur. J. Biochem. 236, 827–836. Maeda, T., Sakashita, M., Ohba, Y., Nakanishi, Y., 1998. Molecular cloning of the rat Tpx-1 responsible for the interaction between spermatogenic and Sertoli cells. Biochem. Biophys. Res. Commun. 248, 140–146. Miller, R., 1985. Sperm chemo-orientation in the metazoa. In: Metz, C., Monroy, A. (Eds.), Biology of Fertilization, Vol. 2. Academic Press, New York, pp. 275–337.
416
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
Morita, M., Nishikawa, A., Nakajima, A., Iguchi, A., Sakai, K., Takemura, A., Okuno, M., 2006. Eggs regulate sperm flagellar motility initiation, chemotaxis and inhibition in the coral Acropora digitifera, A. gemmifera and A. tenuis. J. Exp. Biol. 209, 4574–4579. Neill, A.T., Vacquier, V.D., 2004. Ligands and receptors mediating signal transduction in sea urchin spermatozoa. Reproduction 127, 141–149. Nishigaki, T., Chiba, K., Miki, W., Hoshi, M., 1996. Structure and function of asterosaps, sperm-activating peptides from the jelly coat of starfish eggs. Zygote 4, 237–245. Oliveira, R.G., Tomasi, L., Rovasio, R.A., Giojalas, L.C., 1999. Increased velocity and induction of chemotactic response in mouse spermatozoa by follicular and oviductal fluids. J. Reprod. Fertil. 115, 23–27. Olson, J.H., Xiang, X., Ziegert, T., Kittelson, A., Rawls, A., Bieber, A.L., Chandler, D.E., 2001. Allurin, a 21-kDa sperm chemoattractant from Xenopus egg jelly, is related to mammalian sperm-binding proteins. Proc. Natl. Acad. Sci. U. S. A. 98, 11205–11210. Ralt, D., Goldenberg, M., Fetterolf, P., Thompson, D., Dor, J., Mashiach, S., Garbers, D.L., Eisenbach, M., 1991. Sperm attraction to a follicular factor(s) correlates with human egg fertilizability. Proc. Natl. Acad. Sci. U. S. A. 88, 2840–2844. Riffell, J.A., Krug, P.J., Zimmer, R.K., 2002. Fertilization in the sea: the chemical identity of an abalone sperm attractant. J. Exp. Biol. 205, 1439–1450. Riffell, J.A., Krug, P.J., Zimmer, R.K., 2004. The ecological and evolutionary consequences of sperm chemoattraction. Proc. Natl. Acad. Sci. U. S. A. 101, 4501–4506. Roberts, K.P., Ensrud, K.M., Hamilton, D.W., 2002. A comparative analysis of expression and processing of the rat epididymal fluid and sperm-bound forms of proteins D and E. Biol. Reprod. 67, 525–533. Roberts, K.P., Wamstad, J.A., Ensrud, K.M., Hamilton, D.W., 2003. Inhibition of capacitation-associated tyrosine phosphorylation signaling in rat sperm by epididymal protein Crisp-1. Biol. Reprod. 69, 572–581. Roberts, K.P., Johnston, D.S., Nolan, M.A., Wooters, J.L., Waxmonsky, N.C., Piehl, L.B., Ensrud-Bowlin, K.M., Hamilton, D.W., 2007. Structure and function of epididymal protein cysteine-rich secretory protein-1. Asian J. Androl. 9, 508–514. Rochwerger, L., Cohen, D.J., Cuasnicu, P.S., 1992. Mammalian sperm–egg fusion: the rat egg has complementary sites for a sperm protein that mediates gamete fusion. Dev. Biol. 153, 83–90.
Shiba, K., Ohmuro, J., Mogami, Y., Nishigaki, T., Wood, C.D., Darszon, A., Tatsu, Y., Yumoto, N., Baba, S.A., 2005. Sperm-activating peptide induces asymmetric flagellar bending in sea urchin sperm. Zool. Sci. 22, 293–299. Spehr, M., Gisselmann, G., Poplawski, A., Riffell, J.A., Wetzel, C.H., Zimmer, R.K., Hatt, H., 2003. Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science 299, 2054–2058. Spehr, M., Schwane, K., Riffell, J.A., Zimmer, R.K., Hatt, H., 2006. Odorant receptors and olfactory-like signaling mechanisms in mammalian sperm. Mol. Cell. Endocrinol. 250, 128–136. Sugiyama, H., Al-Anzi, B., McGaughey, R.W., Chandler, D.E., 2004. Assays for vertebrate sperm chemotaxis. Methods Mol. Biol. 253, 27–48. Sun, F., Giojalas, L.C., Rovasio, R.A., Tur-Kaspa, I., Sanchez, R., Eisenbach, M., 2003. Lack of species-specificity in mammalian sperm chemotaxis. Dev. Biol. 255, 423–427. Sun, F., Bahat, A., Gakamsky, A., Girsh, E., Katz, N., Giojalas, L.C., Tur-Kaspa, I., Eisenbach, M., 2005. Human sperm chemotaxis: both the oocyte and its surrounding cumulus cells secrete sperm chemoattractants. Hum. Reprod. 20, 761–767. Teves, M.E., Barbano, F., Guidobaldi, H.A., Sanchez, R., Miska, W., Giojalas, L.C., 2006. Progesterone at the picomolar range is a chemoattractant for mammalian spermatozoa. Fertil. Steril. 86, 745–749. Villanueva-Diaz, C., Arias-Martinez, J., Bermejo-Martinez, L., Vadillo-Ortega, F., 1995. Progesterone induces human sperm chemotaxis. Fertil. Steril. 64, 1183–1188. Ward, G.E., Brokaw, C.J., Garbers, D.L., Vacquier, V.D., 1985. Chemotaxis of Arbacia punctulata spermatozoa to resact, a peptide from the egg jelly layer. J. Cell Biol. 101, 2324–2329. Wassarman, P.M., Jovine, L., Litscher, E.S., 2001. A profile of fertilization in mammals. Nat. Cell Biol. 3, E59–E64. Xiang, X., Burnett, L., Rawls, A., Bieber, A., Chandler, D., 2004. The sperm chemoattractant “allurin” is expressed and secreted from the Xenopus oviduct in a hormone-regulated manner. Dev. Biol. 275, 343–355. Xiang, X., Kittelson, A., Olson, J., Bieber, A., Chandler, D., 2005. Allurin, a 21 kD sperm chemoattractant, is rapidly released from the outermost jelly layer of the Xenopus egg by diffusion and medium convection. Mol. Reprod. Dev. 70, 344–360. Yoshida, M., Murata, M., Inaba, K., Morisawa, M., 2002. A chemoattractant for ascidian spermatozoa is a sulfated steroid. Proc. Natl. Acad. Sci. U. S. A. 99, 14831–14836.
Developmental Biology 316 (2008) 408 – 416 www.elsevier.com/developmentalbiology
Xenopus tropicalis allurin: Expression, purification, and characterization of a sperm chemoattractant that exhibits cross-species activity Lindsey A. Burnett, Serenity Boyles, Christopher Spencer, Allan L. Bieber, Douglas E. Chandler ⁎ Molecular and Cellular Biology Program, School of Life Sciences and Department of Chemistry and Biochemistry, Arizona State University, Tempe, AZ 85287-4501, USA Received for publication 19 December 2007; revised 30 January 2008; accepted 31 January 2008 Available online 15 February 2008
Abstract Previously we reported the identification of the first vertebrate sperm chemoattractant, allurin, in the frog Xenopus laevis (Xl) and demonstrated that it was a member of the CRISP family of proteins. Here we report identification, purification, and characterization of Xenopus tropicalis (Xt) allurin, a homologous protein in X. tropicalis. “Egg water” as well as purified allurin from both species exhibit efficient crossspecies sperm chemoattractant activity. Western blots show that Xt egg water contains a single anti-allurin cross-reactive protein whose molecular weight (20,497 Da by MALDI MS) agrees well with the molecular weight of the hypothetical gene product for a newly recognized “Crisp A” gene in the X. tropicalis genome. A recombinant form of the protein, expressed in 3T3 cells, exhibits chemoattraction for both Xt and Xl sperm and cross reacts with anti-allurin antibodies. Examination of Crisp protein expression in the Xt oviduct using RT-PCR showed that of five documented Xt Crisp genes (Crisps 2, 3, LD1, LD2 and A) only Crisp A was expressed. In contrast, Crisp 2, Crisp 3, Crisp LD1, and Crisp LD2, but not Crisp A, were all found to be expressed in the Xt testes while subsets of Crisp proteins where expressed in the Xt ovary. These data suggest that Crisp proteins in amphibians may play multiple roles in sperm production, maturation and guidance just as they are thought to in mammals indicating that Crisp protein involvement in reproduction may not be limited to mammals. © 2008 Elsevier Inc. All rights reserved. Keywords: Fertilization; Egg jelly; Sperm chemotaxis; CRISP proteins; Crisp A gene
Introduction Successful fertilization requires a well-choreographed series of events that include sperm chemotaxis, acrosomal exocytosis, and sperm–egg binding and fusion (Wassarman et al., 2001; Evans and Florman, 2002; Hoodbhoy and Dean, 2004). In particular, directed motility of sperm, that is, chemotaxis, is thought to play an instrumental role in fertilization of both vertebrate and invertebrate eggs (Eisenbach and Giojalas, 2006; Kaupp et al., 2006; Burnett et al., in press). Sperm chemotaxis has been studied extensively in marine species with external fertilization including sea urchins, starfish, ascidians, abalone, and coral (Ward et al., 1985; Shiba et al., 2005; Miller, 1985; Neill and Vacquier, 2004; Nishigaki et al., 1996; Yoshida et al., 2002; Riffell et al., 2002, 2004; Morita et ⁎ Corresponding author. Fax: +1 480 965 9699. E-mail address: [email protected] (D.E. Chandler). 0012-1606/$ - see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2008.01.046
al., 2006). The chemical identity of the attractants used ranges from amino acids and peptides to lipids and sulfated steroids. Species specificity of sperm chemoattractants has been documented in a number of these marine organisms and is thought to be required because fertilization is external, gametes from multiple species are spawned simultaneously and gametes are broadly distributed by currents. Among vertebrates, sperm chemotaxis has been studied largely in mammals. In all mammalian species studied, follicular fluid has been demonstrated to elicit chemotaxis although the specific factors involved in this response remain unclear (Ralt et al., 1991; Cohen-Dayag et al., 1995; Oliveira et al., 1999). In vitro studies have indicated that steroids such as progesterone and odorants such as bourgeonal have sperm chemoattractant activity (Teves et al., 2006; Villanueva-Diaz et al., 1995; Spehr et al., 2003, 2006). Progesterone is thought to be secreted by both the mammalian egg and cumulus cells and therefore is hypothesized to act in vivo as a chemoattractant
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
(Sun et al., 2005). In contrast, odorants have not been demonstrated to be present in reproductive fluids and therefore the significance of their activity is yet to be understood. In contrast to marine invertebrates, heterospecies chemotaxis of mammalian sperm to both follicular fluid and progesterone has been reported, implying that mammals likely do not rely on chemotaxis as a mechanism to prevent interspecies fertilization (Sun et al., 2003). Recent studies in lower vertebrates such as frogs have demonstrated the existence of a protein sperm chemoattractant – allurin – that is released from jellied eggs upon spawning (AlAnzi and Chandler, 1998; Olson et al., 2001; Xiang et al., 2004, 2005). Allurin is a member of the Cysteine-RIch Secretory Protein (CRISP) family which includes a number of venom and allergen proteins as well as a series of sperm binding proteins found in the mammalian male reproductive tract during spermatogenesis (Kratzschmar et al., 1996; Gibbs and O'Bryan, 2007). Crisp family proteins in mammals have been implicated in a number of important roles in the fertilization process including spermatogenesis, epididymal maturation, regulation of capacitation, and sperm–egg fusion (Rochwerger et al., 1992; Cohen et al., 2007; Roberts et al., 2003, 2007). Growing evidence suggests that Crisp family proteins are involved in sperm binding during many fertilization events (Ellerman et al., 2006; Busso et al., 2007; Cohen et al., 2007). In this study we provide evidence for conservation of allurinmediated sperm chemotaxis in Xenopus tropicalis and demonstrate the ability of allurins to elicit heterospecies chemotaxis. In addition, we demonstrate that X. tropicalis allurin (Xt allurin) purified from egg water exhibits a molecular weight by mass spectroscopy that is nearly identical to that of a sequence RTPCR amplified from X. tropicalis oviduct RNA using primers designed from entries in EST databases. Further, we show that a recombinant form of this protein can be produced in mouse 3T3 cells having the same molecular weight and antibody reactivity as Xt allurin found in egg water; this recombinant protein can also effectively elicit sperm chemotaxis. Materials and methods In silico identification of Crisp family genes in X. tropicalis Crisp 2 and Crisp 3 have already been identified and annotated in a X. tropicalis genome browser (http://genome.ucsc.edu/). Crisp LD1 and Crisp LD2 were identified as putative Crisp family genes in X. tropicalis by similarity of gene structure to murine genes of the same name. A tblastn search using the amino acid sequence for Xenopus laevis allurin to query the Sanger Institute EST database for X. tropicalis revealed an oviductal cDNA that predicted a protein with high amino acid similarity to X. laevis allurin and a similar molecular weight. This cDNA transcript was then used to blat the X. tropicalis genome and identify the location of the Xt allurin gene.
Tissue and gamete procurement Male and female X. laevis and X. tropicalis were obtained commercially (Carolina Biological or NASCO or Pacific Biotech) and kept on a 12 h/12 h light/dark cycle at 25 °C. Testes were obtained from sexually mature euthanized male frogs for cDNA preparation and sperm isolation. Sperm were obtained from euthanized frogs by dissection and perfusion of the testes with 1.5 × oocyte Ringer's medium (OR2) (124 mM NaCl, 3.75 mM KCl, 1.5 mM CaCl2, 1.5 mM
409
MgCl2, 1.5 mM Na2HPO4, 10 mM Hepes, pH 7.8) (X. laevis) or L-15/10% Fetal Calf Serum (X. tropicalis) and stored on ice until use, typically within 2 h. Oviduct was obtained from sexually mature Xenopus injected with 1000 IU of human chorionic gonadotropin (hCG; Sigma) 8 h prior. Eggs were also obtained from hormonally primed animals approximately 8–12 h post injection in X. laevis and 6–8 h post injection in X. tropicalis.
cDNA preparation for determination of Crisp gene expression Tissue for cDNA isolation was obtained as described above, homogenized with Trizol reagent (Invitrogen) and RNA was isolated by chloroform extraction and isopropanol precipitation. Complementary DNA (cDNA) was generated by reverse transcription of total RNA using the Superscript First Strand Synthesis System (Invitrogen); mock controls in which the Superscript was left out during cDNA synthesis were concurrently performed. Crisp family gene expression was assessed by PCR using specific gene primers designed and generated from the X. tropicalis genome (Crisp 2 Forward: GGCTTCCTATCCAGCCTCTT, Reverse: TTTGGGCCAGTTTTATACGG; Crisp 3 Forward: AACCCAACTGCATCCAACAT, Reverse: GGGTATAATGCCCAATGACG; Crisp LD1 Forward: AGTCATTGGGCAGAATTTGG, Reverse: CACCAATTTCCCTTTGGAGA; Crisp LD2 Forward: TCCAGGCTTGGTATGATGAA, Reverse: GGCAAGCAGAACAAGGATGT; Crisp A Forward: GGAGGAACGCCAATGTTAGA, Reverse: AATCAGGCTTCGCAGTTGTT). PCR products were visualized by running a 1% agarose gel in TAE (Tris Acetate EDTA) and stained with ethidium bromide.
Electrophoresis and western blotting SDS-PAGE was performed using 4–12% gradient gels (NuPage) with a MES running buffer (Invitrogen) and either stained with Coomassie Blue (Simply Blue, Invitrogen) for densitometry, or electrophoretically transferred to PVDF membrane in the presence of Towbin buffer (25 mM Tris, 193 mM glycine, 0.1% SDS, pH 8.4, 20% methanol v/v) for western blotting. Nonspecific membrane binding sites were blocked with a 5% solution of non-fat milk powder in Tris-buffered saline with Tween (TBST; 12.5 mM Tris, 140 mM NaCl, 0.1% v/v Tween, pH 7.6) and the membrane was probed in TBST with a polyclonal anti-allurin antibody (Rockland) characterized previously (Xiang et al., 2005). Goat anti-rabbit IgG antibodies (Sigma) conjugated to alkaline phosphatase were then used to probe the primary antibodies. A chemifluorescent substrate (ECF; Amersham) was used to stain for phosphatase activity and the product visualized on a Molecular Dynamics Storm 840 PhosphoImager. Densitometry of Coomassie Blue-stained gels was carried out by digital photography of the wet gel on a 5000 K light box followed by analysis of the electronic image using Scion Image software.
Preparation of egg water and purification of Xt allurin Egg water for biological assays was prepared by incubating approximately 1 g of freshly spawned eggs in 4 ml of F-1 buffer (41.25 mM NaCl, 1.25 mM KCl, 0.25 mM CaCl2, 0.06 mM MgCl2, 0.5 mM Na2HPO4, 2.5 mM Hepes, pH 7.8) for 1 h at room temperature. Densitometry traces indicated that a likely Xt allurin candidate at 22 kDa constituted 9.8% of the total egg water protein, a value similar to that for allurin in Xl egg water (8.5%). It is noted, however, that Xt egg water contains much higher amounts of protein (440 μg/ml compared to 130 μg/ml for Xl egg water) and therefore higher amounts of putative Xt allurin than does Xl egg water (data not shown). Egg water for Xt allurin purification was prepared by incubating approximately 1 g of freshly spawned eggs in 4 ml 50 mM Na2HPO4, pH 7.45 for 10 min at room temperature and the protein components separated by FPLC anion exchange chromatography. Thirty milliliters of egg water, containing 440 μg protein/ml was applied to a DEAE Q Hyper D ceramic resin column (17 cm by 1 cm; Life Technologies) using a BioCAD SPRINT Perfusion Chromatography System; the column was equilibrated with 50 mM Na2HPO4 at pH 7.45. Proteins were eluted with a linear gradient of 1 M NaCl in equilibration buffer. Fractions were then analyzed by SDS-PAGE, western blotting, and assayed for chemattractant activity. Xt allurin used for mass spectral analysis was additionally purified by reverse phase HPLC using a BioCAD SPRINT Perfusion Chromatography
410
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
System unit equipped with a Vydac C4 analytical column (Cat. # 214TP54) equilibrated with 0.1% trifluoroacetic acid in water and eluted with a linear gradient from 0 to 100% acetonitrile over 30 min. This purification resulted in a sharp peak of Xt allurin at 62.9% acetonitrile that was greater than 95% pure. The identity of this peak was confirmed by mass spectroscopy.
Cloning and expression of recombinant Xt allurin Cloning of Xt allurin was performed by amplification of the full-length Xt allurin transcript (Forward: TATCGATCGATCGCCACCATGGATACTTTCAACTTCATCATTTG, Reverse: GATACTCTAGAGGTTTGGAAACATTTTATGAAGC). The full-length transcript was then cut with Cla1 and Xba1 and ligated into a CS2MT vector cut with the same restriction enzymes for bacterial cloning. Plasmid DNA isolated from clones was then sequenced to verify identity and used to transiently transfect 3T3 cells using Lipofectamine (Invitrogen) according to the manufacturer's instructions. Serum free media was then obtained from these cells and analyzed by SDS-PAGE and western blotting to assess the presence of anti-allurin cross-reacting proteins.
Two-chamber transwell assay Egg water extracts were assayed for chemoattractant activity as previously described (Sugiyama et al., 2004) using Corning-Costar transwell assay plates consisting of two chambers separated by a polycarbonate membrane with 12 μm pores. Xenopus sperm were placed in the top chamber insert and a 100 μl bolus of the chemoattractant to be tested was carefully pipetted onto the floor of the bottom chamber. After incubation for 45 min at 24 °C, the top chamber was removed and sperm that had passed through the membrane into the bottom chamber were collected and counted using a hemocytometer. All assay data represent means and standard errors for at least three replicate experiments.
Results X. tropicalis egg water elicits sperm chemotaxis and contains an allurin-like protein Egg water from X. tropicalis prepared in F-1 buffer was assayed for sperm chemoattractant activity using a two-chamber assay. Chemoattractant activity increased with protein concentration and reached a peak at 15 μg/well with sperm movement into the bottom chamber increasing 4.5-fold over that seen in buffer controls (Fig. 1). Concentrations as low as 0.5 μg/well were sufficient to elicit 3.5-fold sperm movement to the bottom chamber compared to buffer controls (Fig. 1) Activity declined with increasing concentrations resulting in a biphasic curve similar to that seen for X. laevis egg water (Al-Anzi and Chandler, 1998). We predicted that this activity is likely due to the presence of an allurin-like chemoattractant in Xt egg water and this fact was confirmed by SDS PAGE and western blotting. As shown in Fig. 2, X. laevis (Xl) and X. tropicalis (Xt) egg waters have a similar but not identical protein makeup with bands ranging from 10 to 150 kDa relative mobility in each case. Of particular interest is that Xt egg water contains two bands at 19 and 22 kDa (arrows, lane 3) that are similar to Xl allurin (asterisk, lane 2) in relative mobility. Western blotting (lanes 4 and 5, Fig. 2) demonstrated that the 22 kDa band in X. tropicalis egg water labels with a polyclonal anti-allurin antibody (arrow, lane 5) and consequently we designated this protein Xt allurin.
Fig. 1. X. tropicalis egg water elicits a biphasic chemotactic response from X. tropicalis sperm in a two-chamber assay. The data are means and standard errors for three experiments.
Purification of Xt allurin Our initial approach was to isolate Xt allurin by anion exchange chromatography of egg water as previously described for purification of Xl allurin (Olson et al., 2001). However, this approach was complicated by the fact that Xt allurin did not bind to the column but instead appeared in the pass-through fraction. Since Xt allurin was predicted to bind based on its theoretical isoelectric point (pH 4.8), we hypothesized that the allurin was being competitively displaced from the column by other egg water proteins. Indeed, multiple passages of the Xt allurin-containing void fraction resulted in elution of a series of column-bound proteins on the third pass using a gradient of 0 to 0.65 M NaCl over a 45-min period (Fig. 3A). The first peak, collected at 14% NaCl, was analyzed by SDS-PAGE and western blotting and identified as purified Xt allurin (Fig. 3A, inset). This FPLC-separated Xt allurin was used to assess the biological activity of the protein. Xt allurin was additionally purified by reverse phase HPLC for mass spectroscopic analysis (Fig. 3B). The molecular weight of Xt allurin was determined to be 20,497 Da (isotopically averaged) by MALDI-MS (Fig. 3C). This mass corresponds well with the mass of a protein predicted to be 20,493 Da based on cDNA data from the Sanger Institute EST database and the UCSC genome browser; these data also suggest that no posttranslational modifications including glycosylation are made to Xt allurin. Interestingly, two accompanying molecular ion peaks of 20,426 and 20,111 kDa corresponded precisely to the same protein truncated at the C-terminal by one and four amino acids respectively. Egg water and purified allurins elicit heterospecies chemotaxis We assessed the ability of egg water, purified Xl allurin and purified Xt allurin to elicit sperm chemotaxis in each of the two species. There was no significant difference found between the ability of egg water from X. laevis and egg water from X. tropicalis to elicit chemotaxis in X. laevis sperm (Fig. 4A). The
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
411
number of sperm crossing into the bottom chamber in the presence of X. tropicalis egg water was 95% of that seen with X. laevis egg water. In addition, purified Xl allurin and Xt allurin exhibited nearly identical chemoattractant activity toward Xl sperm (Fig. 4A). Cross-species chemotaxis was also elicited when X. tropicalis sperm were presented with either egg water or purified allurin from X. laevis (Fig. 4B). Egg water from X. laevis actually stimulated greater sperm movement than X. tropicalis egg water at the concentrations used. Upon purification, however, Xt allurin stimulated approximately 20% more Xt sperm movement than purified Xl allurin. Nevertheless, Xl allurin still elicited a strong chemotactic response with more than a 2.5-fold increase in sperm movement compared to controls (Fig. 4B). Cloning, expression and activity of recombinant Xt allurin
Fig. 2. Comparison of X. laevis egg water and X. tropicalis egg water in protein composition. Lanes 1–3: Coomassie blue-stained SDS-PAGE gel showing that Xl and Xt egg waters are of similar complexity (lanes 2 and 3 respectively). Xl egg water contains one band in the 18–25 kDa range (asterisk) while Xt egg water contains two bands in this range (arrows). Lanes 4 and 5: Western blotting of equivalent samples using a polyclonal anti-allurin antibody identifies Xl allurin (asterisk, lane 4) and Xt allurin (arrow, lane 5). The arrows in lanes 3 and 5 correspond to the same protein with a relative mobility of 22 kDa. The asterisks in lanes 2 and 4 correspond to the same protein with a relative mobility of 23 kDa. These results are representative of three different preparations of egg water in each species.
To identify putative transcripts for an allurin-like protein in X. tropicalis, an in silico tblastn was performed using the Xl allurin amino acid sequence to query the Sanger Institute X. tropicalis EST database. Five high scoring results were found corresponding to a single transcript in the X. tropicalis oviduct that predicted a secreted protein of 20,493 Da with 62% similarity to allurin in X. laevis (see below). Blatting of this sequence against the X. tropicalis genome was used to predict the sequence of the full-length cDNA and to design primers for amplifying and cloning this cDNA using mRNA isolated from Xt oviduct. To confirm that this transcript produced Xt allurin we performed a tryptic digest of native Xt allurin purified from egg water and compared these fragments to those for the
Fig. 3. Purification of X. tropicalis allurin. (A) Elution profile of the third pass of Xt egg water through a Hyper QD anion exchange column. Inset: Coomassie-stained gel and western blot with anti-allurin antibodies identifies peak one as Xt allurin. (B) Xt allurin was additionally purified by RP-HPLC and eluted at 62.9% acetonitrile as indicated. (C) The MALDI-MS spectrum of this peak indicates that Xt allurin has a molecular weight of 22,497 Da. Peaks at 20,426 and 20,111 Da correspond to two truncated forms of Xt allurin missing one and four amino acids from the C terminus, respectively. These results were similar in two different preparations of Xt allurin.
412
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
Identification of the Crisp A Gene
Fig. 4. Cross-species sperm chemoattractant activities of X. laevis and X. tropicalis allurin. (A) X. laevis sperm respond to egg water and purified allurins from both species with a 3- to 5-fold increase in sperm crossing a barrier into the chemoattractant-containing chamber. (B) X. tropicalis sperm respond to egg water and purified allurins from both species. The total protein present in each assay well for Xt allurin, Xt egg water, Xl allurin, and Xl egg water were 2 μg, 40 μg, 0.5 μg and 30 μg respectively. The data are means and standard errors for three experiments.
predicted protein. MALDI mass spectrometry documented fragments covering approximately 83% of the predicted sequence; one fragment representing 9% of the predicted sequence (residues 37–53) was sequenced by electrospray TOF/ TOF mass spectrometry and found identical to the predicted fragment sequence (data not shown). We then cloned this transcript and expressed it in transiently transfected mouse 3T3 cells in culture; since this protein is predicted to be secreted, the medium from transfected cells was removed and characterized by electrophoresis and western blot. Contained in the medium from Xt allurintransfected cells is a strong anti-allurin cross-reacting protein (asterisk, lane 2, Fig. 5A) having the same relative mobility (22 kDa) as Xt allurin purified from Xt egg water; in contrast, medium from cells transfected with an empty vector does not contain this protein (lane 3, Fig. 5A). These medium samples were then assayed for chemotactic activity using a twochamber assay. Medium from Xt allurin-transfected cells demonstrated a 4-fold increase in sperm movement compared to buffer controls and compared to medium from cells transfected with empty vector (Fig. 5B).
The EST sequence hypothesized previously to encode Xt allurin was blatted against the X. tropicalis genome to determine the location and exon structure for this gene. The genome location scoring highest (736, 17 times higher than the score for second place) is the negative strand of Scaffold 63: 1285105– 1297632, a region that has not yet been annotated as a gene. The new gene, denoted Crisp A, consists of eight exons, seven of which code for the protein and one of which codes for the 3′ untranslated portion of the mRNA. Fig. 6A shows the amino acid sequence of Xt allurin, the protein product of this gene, as obtained by three different methods: 1) back translation of five overlapping ESTs from the Sanger Institute database, 2) sequencing of the cDNA prepared by RT-PCR of Xt oviduct RNA using gene-specific primers and 3) blatting of the EST sequence against the X. tropicalis genome to determine the genomic nucleotide sequence. The back translated amino acid sequence from these three methods were in complete agreement. Alignment of this sequence with those of mouse Crisp 1 and 2 demonstrates the overall homology between Xt allurin and mammalian Crisps, the 10 cysteines whose positions are conserved in all three proteins (asterisks) and the stretch of 36 amino acids found in full length Crisp 1 and 2 but not in Xt allurin. Preliminary data indicate these conserved cysteines present in Xt allurin are involved in disulfide linkages (Burnett, unpublished results). The exon and coding structure of the Crisp A gene shows a striking parallel to the Crisp 1 gene of mouse (Fig. 6B). Both genes have 7 exons that code for the amino acid sequence as indicated by the thin continuous line above the exon structure for each gene. In Fig. 6A, the sequences contributed by each
Fig. 5. Expression and sperm chemoattractant activity of recombinant Xt allurin. (A) Western blot of allurin purified from Xl egg water (lane 1), medium from 3T3 cells expressing recombinant Xt allurin (lane 2), and medium from 3T3 cells transfected with an empty vector (lane 3). (B) Sperm chemoattractant activity of the medium from Xt allurin-transfected 3T3 cells compared to that of Xt egg water using a two-chamber assay. Data are means and standard errors for three experiments. Note that in (A) purified Xl allurin forms a ladder of multimers that are used as molecular weight standards. The molecular weight values given are actual size, not relative mobility. Both Xt and Xl allurin have a relative mobility that is 2 kDa higher than their actual size.
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
413
Fig. 6. Characterization of the Crisp A gene. (A) Pair-wise sequence alignment of Xt allurin with Xl allurin, mouse Crisp 1 and Crisp 2; the sequences contributed by sequential exons are demarcated with alternating bold and normal fonts (the exon structure for Xl allurin is unknown). Dots indicate identical residues in the proteins shown and asterisks indicate cysteines conserved between Xt allurin and mouse Crisp 1 and Crisp 2. (B) The exon structure of the Crisp A gene compared to the exon structure for the mouse Crisp 1 gene. These genes both have seven coding exons. The coding regions are indicated by the lines above the exon structure. (C) The genomic region surrounding Crisp A contains four additional putative Crisp genes. This clustering of Crisp genes is also seen in human, mouse and rat as shown in regional genomic maps.
exon are denoted by alternating bold and regular face type and close inspection shows that the exon boundaries within these amino acid sequences of Xt allurin, mouse Crisp 1 and mouse Crisp 2 are remarkably consistent. A further parallel is that the X. tropicalis Crisp A gene is found to be adjacent to 4 other Crisp genes—Crisp2, Crisp 3, Crisp 1/4 (putative and possibly a Crisp 4), and MGC108118 which encodes a predicted protein in the Crisp family (Fig. 6C). These paralogous genes likely arose from gene duplications in an earlier era. This clustering of Crisp family genes is seen in a number of species including rat, mouse and human (Fig. 6C). Although the exact order and positions of these genes varies between species they are confined to regions delineated by the
presence of the Rhag gene and the Tcap gene cluster in each species. Crisp gene and protein expression in the reproductive system of X. tropicalis We used RT-PCR to assess expression of Crisp family genes in the reproductive tissues of X. tropicalis. A number of Crisp family members are found in both male and female reproductive tissues in X. tropicalis (Fig. 7, “+” columns). Crisp A expression was found only in the female reproductive tract and was restricted to the oviduct. This agrees with our previous findings in X. laevis that indicate allurin expression is principally in the
414
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
Fig. 7. Determination of Crisp protein expression in X. tropicalis reproductive tissues by RT-PCR and western blotting. The Crisp A gene is expressed exclusively in the oviduct whereas a combination of Crisp genes are expressed in other reproductive tissues such as the testes and ovary; however, the egg appears to express no Crisp proteins. PCR amplification reactions were carried out using cDNA prepared either in the presence of reverse transcriptase (+) to detect mRNA templates or in the absence of reverse transcriptase (−) to detect contaminating genomic DNA templates.
oviduct (Xiang et al., 2004). On the other hand, multiple Crisps are expressed in the ovary and testes; in the ovary Crisp LD1 and Crisp LD2 are expressed as well as a low level of Crisp 2. In the testes, Crisp 2, Crisp 3, Crisp LD1, and Crisp LD2 are all expressed. In contrast, Fig. 7 shows that mature eggs do not express any of these Crisp genes implying that any Crisp family proteins found with them are likely produced by other cells associated with the egg at different developmental stages. This is true of Xt allurin; Xt allurin is clearly associated with the egg and diffuses out of the jelly layers of the mature egg whereas the gene is exclusively expressed in the oviduct. Discussion Here we document a new vertebrate gene in the X. tropicalis genome—Crisp A. The Crisp A gene has not yet been documented in other genomes but it is closely related to the Crisp gene family of mammals that includes Crisps 1 through 4, Crisp LD1 and Crisp LD2. In fact, the exon structure of the amphibian gene is strikingly similar to mammalian Crisp genes (e.g. Crisp 1) with the exon boundaries in the amino acid sequence being highly conserved (see Fig. 6). In addition, this amphibian gene lies within a Crisp gene cluster that most likely arose from gene duplication events. The cluster of Crisp genes found in the X. tropicalis genome is again remarkably similar to the clusters found in mammalian genomes, for example, those of mice, rats and humans. Thus, we would speculate that this gene cluster arose earlier in vertebrate evolution than has been previously assumed. The Crisp family of genes associated with reproductive function, previously speculated to be mammalian in origin, appear to be vertebrate in origin, being found in both lower and higher vertebrates. The protein product of the Crisp A gene – Xt allurin – is also distinctly of the Crisp family. A full typical length Crisp protein
(e.g. Crisp 1) contains three domains—a pathogenesis-related (PR) domain first characterized in plant pathogenesis-related proteins, a smaller hinge domain, and an ion channel regulatory (ICR) domain, the last having structural features and physiological properties akin to peptide toxins that block K+ channels and ryanodine channels (Kratzschmar et al., 1996; Gibbs and O'Bryan, 2007; Gibbs et al., 2006; Castaneda et al., 1995). Although Xt allurin is a truncated Crisp (it is missing the ICR domain) its first two domains, the PR domain and hinge domain, have 39% identity and 60% conserved similarity respectively to these domains in mammalian Crisp proteins (these values are for Crisp 1). In addition, Xt allurin has 10 cysteines positioned identically to those in the same domains of the mammalian proteins (asterisks, Fig. 6A). The apparent function of Xt allurin – sperm chemoattraction – is also consistent with the fact that Crisp proteins in mammals are thought to shepherd sperm through a number of transitions in their life history. Crisp 2, found in the testis, is thought to act as a spermatocyte–Seritoli cell adhesion molecule and is also packaged into the sperm acrosomal granule (Hardy et al., 1988; Foster and Gerton, 1996; Maeda et al., 1998). Crisp 1, secreted in the epididymis, binds to sperm and accompanies sperm into the female tract during ejaculation. Here, Crisp 1 is thought to modulate capacitation, possibly acting as a decapacitation factor, and, in addition, appears to be capable of modulating sperm–zona pellucida binding and of participating in sperm– egg fusion (Busso et al., 2007; Cohen et al., 2007; Roberts et al., 2003, 2007). Interestingly, although Xt allurin is derived from a Crisp gene, and is clearly a Crisp protein with a conserved biological role in sperm function, it differs from other well-characterized Crisps in a unique way—it originates from the female reproductive tract. To date, Crisp family members have been reported only in the male reproductive tract of mammals; in contrast, Xl allurin and Xt allurin are both expressed in the female reproductive tract, specifically in an accessory tissue—the oviduct. However, ongoing studies make it apparent that Crisp family members are expressed in the female reproductive tract of mammals as well. For example, PCR amplification using appropriate primers shows the presence of Crisp 1, Crisp LD1 and Crisp LD2 mRNA in mouse ovary (Burnett, unpublished results). In addition, this study documents a potential conservation of Crisp family function in the male reproductive tract. Crisp protein expression in X. tropicalis is found in both the male and the female tracts with testis, ovary and oviduct all showing presence of mRNA products from one or more Crisp genes. Indeed, the X. tropicalis testis expresses 4 different Crisp proteins—as many different Crisp proteins as are found in the mammalian male reproductive tract (potentially accounting for the absence of an epididymis or prostate gland in Xenopus). This suggests that these proteins may be significant for frog spermatogenesis and sperm maturation as has already been established in mammals (Roberts et al., 2007). The biological activity of Xt allurin sheds further light on species conservation of sperm chemoattraction mechanisms. Despite the fact that Xl and Xt allurins share only 62% identity
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
(reflecting the fact that these species are separated by millions of years of evolution) allurins from both species demonstrate cross-species activity, each attracting the sperm of the other species with ability almost equal to that for sperm of the same species. This cross-species activity is divergent from the paradigm found in most aquatic organisms, most notably marine invertebrates, where very different molecules such as peptides, lipids and sulfated steroids have all been implicated in sperm chemotaxis (Ward et al., 1985; Shiba et al., 2005; Miller, 1985; Neill and Vacquier, 2004; Nishigaki et al., 1996; Yoshida et al., 2002; Riffell et al., 2002, 2004; Morita et al., 2006). Marine invertebrates have devised not only different mechanisms to elicit chemotaxis, but also typically maintain speciesspecificity of these mechanisms. In contrast, mammalian sperm, like Xenopus sperm, seem to be attracted to similar molecules independent of species. The sperm chemoattractants found in follicular fluid (progesterone and others that are as yet uncharacterized) universally attract rabbit, bovine and human sperm (Sun et al., 2003). This similarity foreshadows a broad spectrum of species whose sperm might be attracted by Crisp proteins. Are mammalian sperm attracted by Crisp family proteins and are Crisp proteins found in mammalian follicular fluid or in oviductal secretions? One intriguing possibility is that both the male and female reproductive tracts of mammals produce truncated Crisps that are not unlike Xt allurin. The rat epididymis not only secretes Crisp 1 but also proteolytically processes the protein by truncating its C-terminal end, thereby removing the ICR domain that Xt allurin is missing (Roberts et al., 2002, 2007). This shortened form contains the same two domains as Xt allurin and has been shown to bind tightly to rat sperm and possibly remains bound even to the point of sperm–egg fusion. Likewise, humans are known to produce, by alternative splicing, a short isoform of Crisp 1 that contains the same domain structure as allurin. In this case, however, the range of tissues in which this isoform is expressed has not been determined. In summary, this report demonstrates the presence of a Crisp gene cluster in X. tropicalis, a lower vertebrate, that recapitulates those of mammals and further demonstrates that this cluster is expressed in reproductive tissues. This leads us to believe that the elucidation of Crisp protein reproductive functions in amphibians could have broader implications for higher vertebrates including mammals. The conservation of Crisp family member expression in the male reproductive tract of frogs suggests that the roles of these proteins in spermatogenesis might be evolutionarily conserved from frogs to mammals. Likewise, the broad distribution of Crisp family gene expression in the female reproductive tract suggests additional roles for Crisp family members in egg maturation and egg-directed sperm–egg interactions. Acknowledgments We thank the Protein Analysis Laboratory at ASU for use of their FPLC-HPLC unit for protein purification and the Nucleic Acid Analysis Laboratory at ASU for performing nucleic acid
415
sequencing. Likewise, we are indebted to the W.M. Keck Bioimaging Laboratory at ASU for use of their Leica NTS and SP2 laser scanning confocal microscopy units and to Dr. Randall Nelson for performing the TOF-TOF mass spectroscopy analysis of Xt allurin. We have benefited from many helpful discussions with Dr. Alan Rawls and Doug Anderson who provided advice on genome browsers and expression of proteins in mammalian cell culture. This study was supported by National Science Foundation grant IBN-0615435. References Al-Anzi, B., Chandler, D.E., 1998. A sperm chemoattractant is released from Xenopus egg jelly during spawning. Dev. Biol. 198, 366–375. Burnett, L., Xiang, X., Bieber, A., Chandler, D., in press. Crisp proteins and sperm chemotaxis: discovery in amphibians and explorations in mammals. Int J of Dev Biol. Busso, D., Cohen, D.J., Maldera, J.A., Dematteis, A., Cuasnicu, P.S., 2007. A novel function for CRISP1 in rodent fertilization: involvement in sperm– zona pellucida interaction. Biol. Reprod. 77, 848–854. Castaneda, O., Sotolongo, V., Amor, A.M., Stocklin, R., Anderson, A.J., Harvey, A.L., Engstrom, A., Wernstedt, C., Karlsson, E., 1995. Characterization of a potassium channel toxin from the Caribbean Sea anemone Stichodactyla helianthus. Toxicon 33, 603–613. Cohen, D.J., Da Ros, V.G., Busso, D., Ellerman, D.A., Maldera, J.A., Goldweic, N., Cuasnicu, P.S., 2007. Participation of epididymal cysteine-rich secretory proteins in sperm–egg fusion and their potential use for male fertility regulation. Asian J. Androl. 9, 528–532. Cohen-Dayag, A., Tur-Kaspa, I., Dor, J., Mashiach, S., Eisenbach, M., 1995. Sperm capacitation in humans is transient and correlates with chemotactic responsiveness to follicular factors. Proc. Natl. Acad. Sci. U. S. A. 92, 11039–11043. Eisenbach, M., Giojalas, L.C., 2006. Sperm guidance in mammals — an unpaved road to the egg. Nat. Rev., Mol. Cell Biol. 7, 276–285. Ellerman, D.A., Cohen, D.J., Da Ros, V.G., Morgenfeld, M.M., Busso, D., Cuasnicu, P.S., 2006. Sperm protein “DE” mediates gamete fusion through an evolutionarily conserved site of the CRISP family. Dev. Biol. 297, 228–237. Evans, J.P., Florman, H.M., 2002. The state of the union: the cell biology of fertilization. Nat. Cell Biol. 4 Suppl., s57–s63. Foster, J.A., Gerton, G.L., 1996. Autoantigen 1 of the guinea pig sperm acrosome is the homologue of mouse Tpx-1 and human TPX1 and is a member of the cysteine-rich secretory protein (CRISP) family. Mol. Reprod. Dev. 44, 221–229. Gibbs, G.M., O'Bryan, M.K., 2007. Cysteine rich secretory proteins in reproduction and venom. Soc. Reprod. Fertil. Suppl. 65, 261–267. Gibbs, G.M., Scanlon, M.J., Swarbrick, J., Curtis, S., Gallant, E., Dulhunty, A.F., O'Bryan, M.K., 2006. The cysteine-rich secretory protein domain of Tpx-1 is related to ion channel toxins and regulates ryanodine receptor Ca2+ signaling. J. Biol. Chem. 281, 4156–4163. Hardy, D.M., Huang Jr., T.T., Driscoll, W.J., Tung, K.K., Wild, G.C., 1988. Purification and characterization of the primary acrosomal autoantigen of guinea pig epididymal spermatozoa. Biol. Reprod. 38, 423–437. Hoodbhoy, T., Dean, J., 2004. Insights into the molecular basis of sperm–egg recognition in mammals. Reproduction 127, 417–422. Kaupp, U.B., Hildebrand, E., Weyand, I., 2006. Sperm chemotaxis in marine invertebrates — molecules and mechanisms. J. Cell. Physiol. 208, 487–494. Kratzschmar, J., Haendler, B., Eberspaecher, U., Roosterman, D., Donner, P., Schleuning, W.D., 1996. The human cysteine-rich secretory protein (CRISP) family. Primary structure and tissue distribution of CRISP-1, CRISP-2 and CRISP-3. Eur. J. Biochem. 236, 827–836. Maeda, T., Sakashita, M., Ohba, Y., Nakanishi, Y., 1998. Molecular cloning of the rat Tpx-1 responsible for the interaction between spermatogenic and Sertoli cells. Biochem. Biophys. Res. Commun. 248, 140–146. Miller, R., 1985. Sperm chemo-orientation in the metazoa. In: Metz, C., Monroy, A. (Eds.), Biology of Fertilization, Vol. 2. Academic Press, New York, pp. 275–337.
416
L.A. Burnett et al. / Developmental Biology 316 (2008) 408–416
Morita, M., Nishikawa, A., Nakajima, A., Iguchi, A., Sakai, K., Takemura, A., Okuno, M., 2006. Eggs regulate sperm flagellar motility initiation, chemotaxis and inhibition in the coral Acropora digitifera, A. gemmifera and A. tenuis. J. Exp. Biol. 209, 4574–4579. Neill, A.T., Vacquier, V.D., 2004. Ligands and receptors mediating signal transduction in sea urchin spermatozoa. Reproduction 127, 141–149. Nishigaki, T., Chiba, K., Miki, W., Hoshi, M., 1996. Structure and function of asterosaps, sperm-activating peptides from the jelly coat of starfish eggs. Zygote 4, 237–245. Oliveira, R.G., Tomasi, L., Rovasio, R.A., Giojalas, L.C., 1999. Increased velocity and induction of chemotactic response in mouse spermatozoa by follicular and oviductal fluids. J. Reprod. Fertil. 115, 23–27. Olson, J.H., Xiang, X., Ziegert, T., Kittelson, A., Rawls, A., Bieber, A.L., Chandler, D.E., 2001. Allurin, a 21-kDa sperm chemoattractant from Xenopus egg jelly, is related to mammalian sperm-binding proteins. Proc. Natl. Acad. Sci. U. S. A. 98, 11205–11210. Ralt, D., Goldenberg, M., Fetterolf, P., Thompson, D., Dor, J., Mashiach, S., Garbers, D.L., Eisenbach, M., 1991. Sperm attraction to a follicular factor(s) correlates with human egg fertilizability. Proc. Natl. Acad. Sci. U. S. A. 88, 2840–2844. Riffell, J.A., Krug, P.J., Zimmer, R.K., 2002. Fertilization in the sea: the chemical identity of an abalone sperm attractant. J. Exp. Biol. 205, 1439–1450. Riffell, J.A., Krug, P.J., Zimmer, R.K., 2004. The ecological and evolutionary consequences of sperm chemoattraction. Proc. Natl. Acad. Sci. U. S. A. 101, 4501–4506. Roberts, K.P., Ensrud, K.M., Hamilton, D.W., 2002. A comparative analysis of expression and processing of the rat epididymal fluid and sperm-bound forms of proteins D and E. Biol. Reprod. 67, 525–533. Roberts, K.P., Wamstad, J.A., Ensrud, K.M., Hamilton, D.W., 2003. Inhibition of capacitation-associated tyrosine phosphorylation signaling in rat sperm by epididymal protein Crisp-1. Biol. Reprod. 69, 572–581. Roberts, K.P., Johnston, D.S., Nolan, M.A., Wooters, J.L., Waxmonsky, N.C., Piehl, L.B., Ensrud-Bowlin, K.M., Hamilton, D.W., 2007. Structure and function of epididymal protein cysteine-rich secretory protein-1. Asian J. Androl. 9, 508–514. Rochwerger, L., Cohen, D.J., Cuasnicu, P.S., 1992. Mammalian sperm–egg fusion: the rat egg has complementary sites for a sperm protein that mediates gamete fusion. Dev. Biol. 153, 83–90.
Shiba, K., Ohmuro, J., Mogami, Y., Nishigaki, T., Wood, C.D., Darszon, A., Tatsu, Y., Yumoto, N., Baba, S.A., 2005. Sperm-activating peptide induces asymmetric flagellar bending in sea urchin sperm. Zool. Sci. 22, 293–299. Spehr, M., Gisselmann, G., Poplawski, A., Riffell, J.A., Wetzel, C.H., Zimmer, R.K., Hatt, H., 2003. Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science 299, 2054–2058. Spehr, M., Schwane, K., Riffell, J.A., Zimmer, R.K., Hatt, H., 2006. Odorant receptors and olfactory-like signaling mechanisms in mammalian sperm. Mol. Cell. Endocrinol. 250, 128–136. Sugiyama, H., Al-Anzi, B., McGaughey, R.W., Chandler, D.E., 2004. Assays for vertebrate sperm chemotaxis. Methods Mol. Biol. 253, 27–48. Sun, F., Giojalas, L.C., Rovasio, R.A., Tur-Kaspa, I., Sanchez, R., Eisenbach, M., 2003. Lack of species-specificity in mammalian sperm chemotaxis. Dev. Biol. 255, 423–427. Sun, F., Bahat, A., Gakamsky, A., Girsh, E., Katz, N., Giojalas, L.C., Tur-Kaspa, I., Eisenbach, M., 2005. Human sperm chemotaxis: both the oocyte and its surrounding cumulus cells secrete sperm chemoattractants. Hum. Reprod. 20, 761–767. Teves, M.E., Barbano, F., Guidobaldi, H.A., Sanchez, R., Miska, W., Giojalas, L.C., 2006. Progesterone at the picomolar range is a chemoattractant for mammalian spermatozoa. Fertil. Steril. 86, 745–749. Villanueva-Diaz, C., Arias-Martinez, J., Bermejo-Martinez, L., Vadillo-Ortega, F., 1995. Progesterone induces human sperm chemotaxis. Fertil. Steril. 64, 1183–1188. Ward, G.E., Brokaw, C.J., Garbers, D.L., Vacquier, V.D., 1985. Chemotaxis of Arbacia punctulata spermatozoa to resact, a peptide from the egg jelly layer. J. Cell Biol. 101, 2324–2329. Wassarman, P.M., Jovine, L., Litscher, E.S., 2001. A profile of fertilization in mammals. Nat. Cell Biol. 3, E59–E64. Xiang, X., Burnett, L., Rawls, A., Bieber, A., Chandler, D., 2004. The sperm chemoattractant “allurin” is expressed and secreted from the Xenopus oviduct in a hormone-regulated manner. Dev. Biol. 275, 343–355. Xiang, X., Kittelson, A., Olson, J., Bieber, A., Chandler, D., 2005. Allurin, a 21 kD sperm chemoattractant, is rapidly released from the outermost jelly layer of the Xenopus egg by diffusion and medium convection. Mol. Reprod. Dev. 70, 344–360. Yoshida, M., Murata, M., Inaba, K., Morisawa, M., 2002. A chemoattractant for ascidian spermatozoa is a sulfated steroid. Proc. Natl. Acad. Sci. U. S. A. 99, 14831–14836.