YAP signaling pathway and cytoskeleton formation

Journal of Pharmacological Sciences 145 (2021) 88e96

Contents lists available at ScienceDirect

Journal of Pharmacological Sciences journal homepage: www.elsevier.com/locate/jphs

Full Paper

The ginsenoside metabolite compound K stimulates glucagon-like peptide-1 secretion in NCIeH716 cells by regulating the RhoA/ROCKs/ YAP signaling pathway and cytoskeleton formation Fengyuan Tian a, 1, Xi Wang b, 1, Haixiang Ni a, Xiaohong Feng a, Xiao Yuan a, Qi Huang a, * a b

Department of Endocrinology, The First Affiliated Hospital of Zhejiang Chinese Medicine University, Hangzhou, 310006, PR China Central Laboratory, The First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, 310006, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 August 2020 Received in revised form 30 October 2020 Accepted 9 November 2020 Available online 20 November 2020

Ginsenoside Rb1 has been shown to have antidiabetic and anti-inflammatory effects. Its major metabolite, compound K (CK), can stimulate the secretion of glucagon-like peptide-1 (GLP1), a gastrointestinal hormone that plays a vital role in regulating glucose metabolism. However, the mechanism underlying the regulation of GLP1 secretion by compound K has not been fully explored. This study was designed to investigate whether CK ameliorates incretin impairment by regulating the RhoA/ROCKs/YAP signaling pathway and cytoskeleton formation in NCIeH716 cells. Using NCIeH716 cells as a model cell line for GLP1 secretion, we analyzed the effect of CK on the expression of RhoA/ROCK/YAP pathway components. Our results suggest that the effect of CK on GLP1 secretion depends on the anti-inflammatory effect of CK. We also demonstrated that CK can affect the RhoA/ROCK/YAP pathway, which is downstream of transforming growth factor b1 (TGFb1), by maintaining the capacity of intestinal differentiation. In addition, this effect was mediated by regulating F/G-actin dynamics. These results provide not only the mechanistic insight for the effect of CK on intestinal L cells but also the molecular basis for the further development of CK as a potential therapeutic agent to treat type 2 diabetes mellitus (T2D). © 2020 The Authors. Production and hosting by Elsevier B.V. on behalf of Japanese Pharmacological Society. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/).

Keywords: Compound K Glucagon-like peptide-1 (GLP1) NCIeH716 cell line Cytoskeleton Diabetes

1. Introduction Type 2 diabetes mellitus (T2D) is a major cause of death and disability, with an increasing incidence worldwide.1 Along with the increase in the aging population and obesity, the number of patients with T2D is increasing at an astonishing rate. The current prevalence of T2D worldwide is estimated to be 422 million people, and this number is predicted to increase to 592 million by 2035; meanwhile, it is reported that 5 million people die from T2D annually.2 Treatment for T2D faces the obstacle of the impaired incretin effect, which is characterized by insufficient secretion of the intestinal hormone glucagon-like peptide-1 (GLP1).3 In glucose metabolism, GLP1 dominantly controls insulin secretion, intestinal

* Corresponding author. Fax: þ86 574 87068200. E-mail addresses: [email protected] (F. Tian), [email protected] (X. Wang), [email protected] (H. Ni), [email protected] (X. Feng), yuanxiao1218@ 163.com (X. Yuan), [email protected] (Q. Huang). Peer review under responsibility of Japanese Pharmacological Society. 1 These authors contributed equally to this manuscript.

function, and food intake. Therefore, GLP1-based agents, GLP1 receptor agonists, and dipeptidyl peptidase-4 inhibitors have widespread applications in the clinical treatment of diabetes, especially when conventional hypoglycemic methods are ineffective. Because of the insulinotropic and beneficial metabolic properties of GLP1, this hormone has been discovered to have new beneficial effects in various tissues. Thus, GLP1 may be useful to treat systemic metabolic disorders.4,5 The negative impact of hyperglycemia on GLP1 secretion mediated by L-cell functional maintenance has been well documented.6 Although it is well known that the high interdependence of glucotoxicity-related transforming growth factor b1 (TGFb1), cytoskeleton reorganization, and stress fiber accumulation can interfere with GLP1, recent evidence shows that activation of the upstream ras homolog family member A (RhoA)/rho-associated coiled coil-containing protein kinase (ROCK) signaling pathway acts as a common mechanism for these events.7 Of note, the events linking actin dynamics to the cell membrane require the participation of Rho GTPases.8 As a member of the small GTPase family, RhoA along with its downstream effector kinases ROCK1 and

https://doi.org/10.1016/j.jphs.2020.11.005 1347-8613/© 2020 The Authors. Production and hosting by Elsevier B.V. on behalf of Japanese Pharmacological Society. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

ROCK2 are linked to many diabetes-related complications.9e11 In addition to serving as a site for cytoskeleton reconstruction and stress fiber accumulation, ROCK-dependent signaling is a platform for cell fate that mediates the response to the differentiation of epithelial cells in the intestine.12e14 Moreover, the activation of YAP downstream of this pathway induces the cell fate transitions during colon regeneration after severe tissue damage.15 Inhibition of ROCK facilitates GLP1 secretion and is responsible for promoting the differentiation and proliferation of L cells with other intestinal secretory lineages.7 However, the underlying mechanism is still undefined. Meanwhile, the elimination of TGFb1 combined with the inhibition of ROCK is linked to promoting the differentiation from human exocrine pancreatic tissue to an insulin-producing cell.16 Furthermore, inhibition of ROCK2, but not ROCK1, through conditional gene knockout or treatment with the ROCK inhibitor H1152, promotes the maturation of b-like cells and increases glucose-stimulated insulin secretion.17 These data suggest that ROCKs may contribute to the disturbance of the incretin axis in T2D. Ginseng, an herb used to fight diabetes, has been prevalent in Asia for millennia.18,19 Ginsenoside, the principal active component isolated from ginseng, possesses multiple pharmacological properties. Meanwhile, compound K (CK) is the dominant metabolite of ginsenoside Rb1 generated through intestinal microflora metabolism.20 CK exhibits antiobesity and antihyperglycemic effects through improving glucolipid metabolism and insulin sensitivity,21,22 demonstrating its potent antidiabetic effect. Despite many studies showing positive outcomes for the secretion of GLP1 with CK treatment,23 the detailed mechanism for this effect remains unclear. Notably, CK can inhibit TGFb1 and suppress epidermal growth factor receptor expression in glioblastoma.24,25 However, how these properties contribute to the restoration of intestinal endocrine homeostasis remains to be determined. In order to explore the protective roles and mechanisms of CK against the high glucose-induced secretion restriction and differentiation deficiency, we examined the effect of CK on the secretion of GLP1 and the activation of RhoA/ROCK-dependent signaling under high-glucose conditions in NCIeH716 cells, an L-like cell line. The results of this study may be useful for the development of CK as a potential therapeutic agent for the treatment of T2D.

2.2. Cell culture and cytotoxicity test Human NCIeH716 cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and maintained in a suspension of RPMI1640 (ThermoFisherScientific, MA, USA) supplemented with 5% fetal bovine serum (HyClone, UT, USA). The cells were incubated at 37  C in a humidification chamber containing 5% CO2. Briefly, the isolated cells were cultured in Dulbecco's modified Eagle medium (HyClone) containing 25 mM or 50 mM glucose, streptomycin (100 mg/mL), and penicillin (100 U/mL). Before the experiment, the cells were inoculated onto porous plates with Cultrex basement matrix extract (Trevigen, Gaithersburg, MD, USA) at 100 mg/mL and cultured in complete medium for 48 h until adhesion. NCIeH716 cells were treated with CK (0.5 mM, 1.0 mM, or 2.0 mM) under 25 mM or 50 mM glucose for 24 h. The SRI-011381 (3 mM) þ CK (0.5 mM, 1.0 mM, and 2.0 mM) groups were incubated in 50 mM glucose. Meanwhile, the cells were cultured in 50 mM glucose and 2.0 mM CK for 12 h, 24 h, and 48 h, respectively. The cell viability of the aforementioned groups was determined by the Cell Counting Kit-8 (CCK8) assay. 2.3. Detection of GLP1 and TGFb1 release NCIeH716 cells were seeded into 96-well plates at 3  105/well. First, the cells were incubated in secretion buffer (115 mM NaCl, 5 mM KCl, 24 mM NaHCO3, 1 mM MgCl2, 2.5 mM CaCl2, 25 mM HEPES, and 0.02% DMSO) in phosphate-buffered saline (PBS), including positive controls, as described previously. Briefly, after the cells were exposed to glucose and/or CK, the supernatant was collected to test GLP1 release via the GLP1 ELISA kit, according to the manufacturer's protocol. The TGFb1 assay was also conducted by following its protocol. 2.4. Quantitative real-time polymerase chain reaction (qPCR) analysis Following the manufacturer's protocol, total RNA was isolated with the Direct-zol RNA MiniPrep kit (ZymoResearch, CA, USA). Reverse transcription was accomplished by the Superscript III (Thermo Fisher Scientific) synthesis system, and the qPCR was performed by the SYBRGreen (Thermo Fisher Scientific) method with samples in triplicate. The sequences of the PCR primers are listed in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control.

2. Materials and methods 2.1. Materials CK (Fig. 1A, with 99% purity and a molecular weight of 622.87 Da) was purchased from Shanghai Winherb Medical Science Co., Ltd. (Shanghai, China) and dissolved in 0.1% dimethyl sulfoxide (DMSO) at a concentration of 50 mM as the stock solution. SRI011381 was from MedChemExpress (Monmouth, NJ, USA). Enzyme-linked immunosorbent assay (Athyros et al.) kits for GLP1 and TGFb1 were from Shanghai Westtang Biotechnology Co., Ltd. (Shanghai, China). The bicinchoninic acid (BCA) protein assay kit was from Pierce Corporation (Rockford, IL, USA). The Direct-zol RNA MiniPrep kit was from ZymoResearch (Irvine, CA, USA). Primary antibodies against RhoA, ROCK1, and YAP were from Cell Signaling Technology (Beverly, MA, USA), that against ROCK2 was from Abcam (Cambridge, England), and those against globular actin (Gactin) and filamentous actin (F-actin) were from Invitrogen (Carlsbad, CA, USA). The secondary antibodies horseradish peroxidase-conjugated goat anti-mouse and goat anti-rabbit were from Cell Signaling Technology (Beverly, MA, USA). Fluorescent phalloidin and secondary antibodies coupled to Alexa Fluor 488 and 594 were from Invitrogen (Carlsbad, CA, USA).

2.5. Western blot analysis For western blot analysis, NCIeH716 cells were grown until 80% confluency, according to the groupings described above. The cells were homogenized and lysed for protein extraction. The protein concentration was determined with the BCA kit. The proteins were separated by electrophoresis and then were transferred to polyvinylidene fluoride membranes, which were probed with the primary antibodies RhoA (1:1000), ROCK1 (1:1000), ROCK2 (1:1000), and YAP (1:1000) at 4  C, respectively. After washing three times with Tris-buffered saline containing Tween 20, the membranes were incubated with secondary antibody at room temperature for 2 h. Subsequently, the images of the antibodyeantigen complexes were acquired with Enhanced Chemiluminescence reagents (BIO-RAD, CA, USA) and quantitated by densitometry with ImageJ software (National Institutes of Health, Bethesda, MD, USA). 89

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

Fig. 1. Effect of CK on TGFb1 and GLP1 in NCIeH716 cells. (A) Molecular structure of CK. (B) NCIeH716 cells were incubated with or without 50 mM Glu, 3 mM SRI-011381, and CK (0.5 mM, 1.0 mM, and 2.0 mM) for 24 h, and the cell viability was assayed by the CCK8 assay. (C) NCIeH716 cells were treated with various concentrations of CK (0.5 mM, 1.0 mM, and 2.0 mM) and incubated under different conditions (25 mM Glu or 50 mM Glu) for 24 h. The level of TGFb1 in the culture supernatant was assayed by ELISA. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the 50 mM Glu group. (D) NCIeH716 cells were treated with CK (2.0 mM) and incubated for various durations (0 h, 12 h, 24 h, and 48 h) in 50 mM Glu. The level of TGFb1 in the culture supernatant was assayed by ELISA. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 50 mM Glu group. (E) NCIeH716 cells were treated with various concentrations of CK (0.5 mM, 1.0 mM, and 2.0 mM) and incubated under two Glu concentrations (25 mM and 50 mM) for 24 h. The level of GLP1 in the culture supernatant was assayed by ELISA. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the 50 mM Glu group. (F) NCIeH716 cells were treated with CK (2.0 mM) and incubated for various durations (0 h, 12 h, 24 h, and 48 h) in 50 mM Glu. The level of GLP1 in the culture supernatant was assayed by ELISA. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 50 mM Glu group. (G) The plot showing the correlation between GLP1 and TGFb1. TNCI-H716 cells were treated with various concentrations of CK (0.5 mM, 1.0 mM, and 2.0 mM) and incubated under 50 mM Glu for 24 h. The levels of TGFb1 and GLP1 in the culture supernatant were assayed by ELISA. Bars represent the mean ± s.e.m., n ¼ 3. (HeI) NCIeH716 cells were incubated with Glu (25 mM or 50 mM), SRI-011381 (3 mM), and CK (0.5 mM, 1.0 mM, or 2.0 mM) for 24 h. The level of GLP1 was evaluated by ELISA. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the 50 mM Glu group. CK, compound K; Glu, glucose; TGFb1, transforming growth factor b1; GLP1, glucagon-like peptide 1; ns, no significance.

Table 1 Quantitative reverse-transcription polymerase chain reaction primers. Gene

Alias

Forward

Reverse

Preproglucagon Forkhead box A1 Forkhead box A2 Neurogenic differentiation factor 1 Connective tissue growth factor Cysteine-rich angiogenic inducer 61 glyceraldehyde-3-phosphate dehydrogenase

Gcg Foxa1 Foxa2 NeuroD1 Ctgf Cyr61 GAPDH

GATTATCCCAAATATGAAGTGCTCC GCAATACTCGCCTTACGGCT GAGACAAATCTCAGCCTCCCAA ATGACCAAATCGTACAGCGAG CAGCATGGACGTTCGTCTG CTCGCCTTAGTCGTCACCC GGAGCGAGATCCCTCCAAAAT

GATTCACCATGTCAGTAAGCGT TACACACCTTGGTAGTACGCC TCCCAGCATACTTTAACTCGCC GTTCATGGCTTCGAGGTCGT AACCACGGTTTGGTCCTTGG CGCCGAAGTTGCATTCCAG GGCTGTTGTCATACTTCTCATGG

Note: Human primers were generated using Primer 3 software. Relative expression values were derived using the deltaedelta cycle threshold method with GAPDH as an endogenous reference.

90

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

concentrations. However, the impact of this intervention was dependent on the concentration of CK (Fig. 1C). These data suggest that glucotoxicity can stimulate TGFb1 synthesis and secretion. CK treatment reversed the TGFb1 elevation in a time-dependent manner, reaching a peak at 48 h (Fig. 1D). These in vitro experiments suggested that glucotoxicity upregulates the expression of TGFb1, creating a highly inflammatory environment in NCIeH716 cells, but CK treatment could reverse the effect of glucose. Thus, the beneficial effect of CK in protecting enteroendocrine cells from inflammation is through decreasing TGFb1 expression.

2.6. G-actin/F-actin analysis To measure the ratio of G/F-actin, NCIeH716 cells were grown to 80% confluency on 6-well plates and washed with a mixture of PBS and 1% TritonX-100. Then, the cells were lysed with 50 mM piperazine-1,4-bis(2-ethanesulfonic acid) buffer (pH 6.9) containing 50 mM NaCl, 5 mM MgCl2, 5 mM ethylene glycol tetraacetic acid, 5% glycerol, 0.1% Nonidet P40, 0.1% Triton X-100, 0.1% Tween 20, 1 mM ATP, and protease inhibitor cocktail (Sigma, St. Louis, MO, USA). The lysate was centrifuged at 500 g for 10 min and then at 18,000 g for 30 min to isolate G-actin in the supernatant and F-actin in the pellet. After washing with PBS, the pellet was resuspended in sodium dodecyl sulfate loading buffer. The protein expression was evaluated by western blot with actin-specific antibodies in each fraction and quantitated by densitometry with ImageJ software. The ratio of G-actin to F-actin was used to obtain the relative quantity of the two forms.

3.2. CK triggers the increase of intracellular GLP1 in NCIeH716 cells Since metabolic dysfunction is partly aggravated by chronic lowgrade inflammation,26 we speculated that TGFb1 in NCIeH716 cells may play a role in incretin impairment. Because NCIeH716 cells can secrete GLP1, we next determined whether CK could induce the release of GLP1 in the context of inflammation. NCIH176 cells were treated as mentioned above, and GLP1 in the supernatant was detected by ELISA. CK administration increased the level of GLP1 under both glucose concentrations (25 mM and 50 mM), reconfirming that CK is indeed a secretory agent for GLP1 (Fig. 1E). To assess the dynamics of this beneficial effect, we treated NCIeH716 cells for different periods of time (0 h, 12 h, 24 h, and 48 h) and found that the GLP1 release peaked at 48 h (Fig. 1F). Interestingly, we observed a negative correlation between GLP1 and TGFb1 (Fig. 1G). Therefore, we further examined whether the CK-induced GLP1 secretion in NCIeH716 cells could be influenced by TGFb1. As SRI-011381 is a known inducer of TGFb1, it was used as a positive control in our study (Fig. 1H). As shown in Fig. 1I, in the presence of 3 mM SRI-011381, stimulation of GLP1 by CK was suppressed when compared to that by 50 mM glucose (Fig. 1E). Together, CK is likely to exert its secretagogue effect through inhibiting TGFb1.

2.7. Immunocytochemistry For immunofluorescence of G-actin, F-actin, and YAP, the cells were propagated into a 6-well plate containing slides. After overnight exposure, the cells then were fixed with 4% paraformaldehyde. The cells were perforated by 1% TritonX-100 in PBS and then blocked with 5% bovine serum albumin. After that, the cells were incubated with actin antibody (1:50) and YAP antibody (1:100) in each well overnight at 4  C. The slides labeled with Alexa Fluor Plus were mounted with a coverslip and visualized with total internal reflection fluorescence microscopy at excitation wavelengths of 488 nm and 594 nm to evaluate the assembly of G-actin, F-actin, and YAP. The images were captured with an LSM700 confocal microscope (Carl Zeiss, Oberkochen, Germany). 2.8. Statistical analyses Statistical analysis was performed with GraphPad Prism 5 software (GraphPad, La Jolla, CA, USA). Data are presented as the mean and standard error of the mean (s.e.m.) for each independent experiment, which was repeated three times. The differences between/among groups were determined by using the Student's ttest or one-way analysis of variance, followed by the NewmaneKeuls test adjustment for multiple comparisons. Values of p < 0.05 were considered to be statistically significant (*p < 0.05, **p < 0.01).

3.3. CK prevents the impairment of NCIeH716 cells from homeostasis and regeneration activated by high glucose Previous studies have clarified the GLP1-stimulating capability of CK. The gut-derived expression of preproglucagon (Gcg) is essential for maintaining the circulating GLP1 level to control gastric emptying and glucose homeostasis.27 To investigate whether CK would restore the circulating GLP1 level under glucotoxicity via induction of Gcg, we next tested the effect of CK on Gcg mRNA expression in NCIeH716 cells, since an increase of Gcg expression can counteract the hyperglycemia-suppressing effect on the circulating GLP1 level. Our data indicate that CK treatment contributed to the restoration of Gcg expression under highglucose and SRI-011308 stimulation (Fig. 2A). Previous reports have shown that enhanced L-cell differentiation can provide a reliable treatment strategy for patients with T2D.28 Furthermore, it has been reported that glucotoxicity and the accompanying excess TGFb1 suppress the differentiation of L cells. To investigate the underlying mechanism for the observed GLP1 secretion induced by CK, we targeted the differentiation capacity associated with restoration of NCIeH716 cells. Then, we examined the transcription factors NeuroD1, Foxa1, and Foxa2, the proteins that govern secretory differentiation into enteroendocrine cells and L cells, in NCIeH716 cells. All these transcription factors in NCIeH716 cells were elevated after CK treatment (Fig. 2B), promoting the intensified commitment to enteroendocrine cell and L cell fates. These results demonstrate that CK normalizes the incretin impairment in L cells.

3. Results 3.1. CK decreases TGFb1 production in NCIeH716 cells under highglucose conditions To investigate whether the anti-inflammatory activity of CK occurs via its decrease of TGFb1 in L cells under high-glucose conditions, we treated NCIeH176 cells with different concentrations of CK (0 mM, 0.5 mM, 1.0 mM, and 2.0 mM). No difference in the cell viability was observed with any stimulation (50 mM glucose or 50 mM glucose þ 3 mM SRI-011381) in combination with CK (Fig. 1B). To further clarify the impact of CK treatment on the release of TGFb1, we exposed NCIeH716 cells to glucose (25 mM or 50 mM) and CK (0 mM, 0.5 mM, 1.0 mM, or 2.0 mM), and the supernatants were examined for TGFb1 with ELISA. The secretion of TGFb1 in NCIeH716 cells was more increased by 50 mM glucose, compared to that by 25 mM glucose (Fig. 1C). In addition, CK treatment significantly reduced TGFb1 expression under both glucose 91

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

Fig. 2. Gcg, NeuroD1, Foxa1, and Foxa2 gene expression as determined by RT-qPCR in NCIeH716 cells. (AeD) Gene expression of transcription factors associated with L-cell differentiation. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the 25 mM Glu group. CK, compound K; Gcg, preproglucagon; NeuroD1, neurogenic differentiation factor 1; Foxa1, Forkhead box A1; Foxa2, Forkhead box A2; Glu, glucose; ns, no significance.

enhances the differentiation of NCIeH716 cells. Such modulation explicitly suggests that the effect of CK is also mediated by actin, a mechanical transducer downstream of YAP. Actin dynamics and the RhoA/ROCK pathway affect YAP, which is a major determinant of cell fate.30 To address the question of whether YAP would maintain or change the downstream mechanism, we found that YAP protein expression was inhibited along with the decrease of GLP1 expression under high-glucose conditions, with or without the TGFb1 stimulator (Fig. 4A,B). However, the expression levels of YAP and its two target genes Ctgf and Cyr61 were elevated by CK treatment (Fig. 4C). The application of CK turned NCIeH716 cells into the recovery stage, with a high expression of YAP in the nucleus (Fig. 4D,E). Moreover, a highly significant enrichment of YAP/TAZ activity in the intestinal epithelium at the repair stage has been reported.31 Treatment with CK turned NCIeH716 cells into the repair stage, and the number of cells with nuclear accumulation of YAP increased significantly. These data suggest that the effect of CK through YAP has a decisive role in tissue regeneration.

3.4. CK modulates RhoA/ROCK signaling in NCIeH716 cells As the first step to discern the mechanism of CK on digestive tract endocrine cells, we tested the hypothesis that the beneficial effects of CK are mediated by RhoA/ROCK signaling in NCIeH716 cells. To determine whether the elimination of TGFb1 and the increase of GLP1 by CK was mediated by RhoA/ROCK signaling, we observed the effect of CK at different concentrations on the protein expression of RhoA, ROCK1, and ROCK2 under various stimuli in NCIeH716 cells. As shown in Fig. 3A, RhoA and ROCKs did not have a changed expression after treatment with different CK concentrations and 25 mM glucose. In contrast, under 50 mM glucose and 3 mM SRI-011381 stimulation, NCIeH716 cells had alterations of the RhoA/ROCK pathway, compared with the cells exposed to 25 mM glucose (Fig. 3B). Specifically, over time, RhoA and ROCK1 showed a trend of decreased expression after CK treatment (2 mM) under high-glucose conditions, whereas the expression of ROCK2 increased (Fig. 3C,D). The gradual decrease of RhoA expression occurred in parallel with the reduced expression of TGFb1 induced by CK (Fig. 3E and G). Interestingly, the two ROCK subtypes, ROCK1 and ROCK2, have opposite roles in maintaining the function of NCIeH716 cells. This evidence was also consistent with the ELISA results. The changes in the expression of TGFb1 and its downstream effector, ROCK1, were correlated under highglucose conditions. Meanwhile, ROCK2 expression exhibited a small increasing trend in NCIeH716 cells. These pathway responses were correlated well with the pronounced alterations in NCIeH716 cells, as detected by related genes, when CK treatment alleviated the suppression of the differentiation capacity of NCIeH716 cells by glucotoxicity. Furthermore, to test whether TGFb1 is required for RhoA/ROCK signaling, NCIeH716 cells were treated simultaneously with SRI011381 and CK during the recovery phase. We found that CK could regulate both pathway components, as treatment with the TGFb1 agonist delayed the effect of CK following glucotoxicity (Fig. 3F). Together, these results reveal that CK treatment altered the cellular mechanisms by the RhoA/ROCK pathway, which is essential for establishment of the repair stage of differentiating NCIeH716 cells.

3.6. CK is capable of depolymerizing the stress fiber-rich actin cytoskeleton The activity of YAP can be affected by cytoskeletal tension, which is regulated through pathways involving RhoA and F-actin.32 To investigate the underlying mechanism for the increase of YAP expression induced by CK, we examined the alteration of assembly in the actin cytoskeleton, which directly binds to YAP. The stability of the cellular actin fibers rely on the G/F-actin ratio.33 The confocal images showed dynamic changes in the actin cytoskeleton in NCIeH716 cells under high-glucose conditions and SRI-011308 treatment, with the appearance of stress fibers and visible curtailment in the cytoplasmic G-actin content. The G/F-actin ratio exhibited a decrease with a distinct shift toward the distribution of F-actin, mainly due to a decrease in cytoplasmic G-actin after SRI011308 treatment under high-glucose conditions (Fig. 5A). Notably, the NCIeH716 cells maintained a stress fiber-rich actin cytoskeleton upon glucotoxicity and TGFb1 stimulation; whereas treatment with CK resulted in actin depolymerization and recovery of the G/F-actin ratio (Fig. 5B,C). The cellular morphology of the CKtreated cells was comparable to that of the control cells. Based on these experiments, we concluded that the abnormal cytoskeleton formed by glucotoxicity inhibits the depolymerization of filamentous actin and that CK treatment restores the G/F-actin balance, which is related to the release of GLP1 and the differentiation of NCIeH716 cells.

3.5. CK restores high glucose-induced YAP signal impairment in NCIeH716 cells Previous studies in drosophila and mammals have implicated that ROCKs act as an upstream activator of YAP.29 The data provided earlier showed that the CK-induced disruption of RhoA signaling 92

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

Fig. 3. Expression of RhoA, ROCK1, and ROCK2 in NCIeH716 cells. (A) NCIeH716 cells were cultured under various conditions (25 mM Glu, 50 mM Glu, and 50 mM Glu þ 3 mM SRI011381) for 24 h without CK treatment. The expression levels of RhoA, ROCK1, ROCK2, and b-actin were evaluated by western blot analysis. (B) NCIeH716 cells were cultured for various durations (12 h, 24 h, and 48 h) and treated with CK (2.0 mM). The expression levels of RhoA, ROCK1, ROCK2, and b-actin were evaluated by western blot analysis. (C) NCIeH716 cells were cultured with CK (0.5 mM, 1.0 mM, and 2.0 mM) for 24 h under 25 mM Glu. The expression levels of RhoA, ROCK1, ROCK2, and b-actin were evaluated by western blot analysis. (D) Densitometric analysis was used to quantify the expression levels of RhoA, ROCK1, and ROCK2 over time. (EeF) NCIeH716 cells were cultured with CK (0.5 mM, 1.0 mM, and 2.0 mM) under various conditions (50 mM Glu and 50 mM Glu þ 3 mM SRI-011381) for 24 h. The expression levels of RhoA, ROCK1, ROCK2, and b-actin were evaluated by western blot analysis. (GeI) Densitometric analysis was used to quantify the expression levels of RhoA, ROCK1, and ROCK2. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the group without CK (2 mM) group. CK, compound K; Glu, glucose.

creating a barrier for exocytosis. CK treatment markedly downregulated ROCK1. Meanwhile, the differentiation of NCIeH716 cells by CK treatment occurred in parallel with the moderately elevated expression of ROCK2, which is resistant to a negative impact caused by stress fibers. Most importantly, the activation of downstream YAP was also involved in ameliorating the impairment of NCIeH716 cells under glucotoxicity. In addition, CK treatment alleviated the limitations of YAP-mediated mechanical cues by upregulating the expression of Ctgf and Cyr61. Therefore, our study unveiled a novel mechanism of CK, which is a promising compound for restoring impaired incretin. Recent reports suggest that the RhoA/ROCK pathway plays a vital role in the insufficiency of the intestinal hormone GLP1.7 Moreover, excessive release of TGFb1 is associated with inhibition of GLP1 synthesis and secretion under glucotoxicity, implying that its direct downstream pathway components, RhoA/ROCKs, are involved. Our results confirm that TGFb1 and ROCKs are overexpressed in NCIeH716 cells under high-glucose conditions, accompanied with the abnormal distribution of F-actin and G-actin. CK treatment could reverse the above changes along with an increase in GLP1 release. On the other hand, stimulation with TGFb1 could inhibit the stimulatory effect of CK on GLP1 secretion. These results suggest that CK stimulation of GLP1 secretion and blocking of the RhoA/ROCK pathway and its downstream processes occur through inhibition of TGFb1.

4. Discussion Ginsenosides have anti-inflammatory, antidiabetic, antidepressive, neuroprotective, and antitumor functions.22e25,34,35 In addition, one of their active metabolites, CK, has been applied for preventive and therapeutic purposes to treat an array of metabolic disorders, including, most importantly, diabetes. Numerous studies have shown that CK can improve insulin sensitivity by inhibiting the phosphoinositide 3-kinase/Akt signaling pathway and alleviate the oxidative stress and inflammation caused by hyperglycemia with adequate glycemic control.21,36 However, the antidiabetes effect and underlying mechanism of CK from the perspective of incretin remain unclear. To this end, we focused on the mechanism of the effect of CK on GLP1 because the enhanced action of GLP1 is an established effect of CK on NCIeH716 cells under high-glucose conditions. The aim of this study was to clarify the role of CK in the secretion of GLP1 by enteroendocrine L cells via the RhoA/ROCK/YAP pathway. Our initial findings showed that under each glucose concentration, in NCIeH716 cells, CK can stimulate GLP1 secretion and inhibit TGFb1 secretion. Furthermore, after CK treatment, the ROCK1 level was markedly decreased under glucotoxicity, whereas ROCK2 exhibited an increased expression. We further investigated the mechanism for the opposite changes of ROCKs in NCIeH716 cells and found that ROCK1, as the downstream effector of TGFb1,37 can mediate the accumulation of stress fibers, which form an abnormal cytoskeleton, 93

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

Fig. 4. CK mediates YAP signal repair in NCIeH716 cells. (A) The levels of YAP (red) with and without CK (2 mM) treatment under various conditions (50 mM Glu and 50 mM Glu þ 3 mM SRI-011381). NCIeH716 cells were imaged by confocal microscopy. Blue indicates DAPI. Overlay indicates colocalization. Scale bar ¼ 20 mm. (B) The total internal reflection fluorescence intensities of YAP from the indicated groups were quantified using ImageJ software. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; ##p < 0.01 versus the CK (2 mM) group. (C) NCIeH716 cells were cultured with CK (0.5 mM, 1.0 mM, and 2.0 mM) under various conditions (25 mM Glu, 50 mM Glu, and 50 mM Glu þ 3 mM SRI-011381) for various durations (12 h, 24 h, and 48 h). YAP and b-actin expression was evaluated by western blot analysis. (D) Densitometric analysis was used to quantify the levels of YAP. (E) Gene expression of transcription factors associated with YAP. Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the CK (2 mM) group. CK, compound K; YAP, yes-associated protein; Ctgf, connective tissue growth factor; Cyr61, cysteine-rich angiogenic inducer 61; DAPI, diaminophenylindole; Glu, glucose; ns, no significance.

fibrosis.39 Thus, it is possible that the maintenance of L-cell function by CK under glucotoxicity is through the RhoA/ROCK pathway. However, more research is needed to test this hypothesis. ROCK isoforms are differentially expressed in NCIeH716 cells. There is currently no available information regarding the distinct roles of ROCK subtypes in enteroendocrine differentiation. Despite sharing some common targets, the distinction among them has been validated.40 For example, the respective mechanisms of ROCK1/ROCK2, which are affected in colorectal cancer, have been reported to be different. The activation of ROCK1 significantly reverses the antineoplastic tendency of miR-124, thus enhancing the expansion, metastasis, and invasion of colorectal cancer cells.41 On the contrary, the inhibition of ROCK2 expression by siRNA elicits the initial polarization of the colorectal cancer cell cohorts, causing collective invasion.42 Since its isoforms are expressed in different cell types, the functions of ROCKs need to be individually evaluated in a more precise way with different stimulating methods. It has been previously confirmed that inhibition of the RhoA/ROCK

In addition to its effects on GLP1 secretion, CK treatment dramatically reduced TGFb1 expression. Since TGFb1 has a proinflammatory role and chronic low-grade inflammation aggravates metabolic dysfunction,26 it is possible that the anti-inflammatory effects of CK through inhibiting TGFb1 contributed to the observed metabolic benefits. Downstream of the TGFb1 signaling pathway, the phosphorylation of ROCK is a pivotal trigger for the activation of LIMK1, LIMK2, and serine protein kinases. Subsequently, actin-depolymerizing factor and cofilin inactivate the actin-depolymerizing factors, contributing to F-actin accumulation.8,15,38 However, we still could not determine whether the CKmediated suppression of this pathway is a direct causal factor or an indirect effect that reflects the improved enteroendocrine state. We noticed that the elevated expression of TGFb1 and RhoA by high glucose could expand the stress fibers, resulting in prominent thickening of the peritoneum and aggravation of the inflammatory response; whereas inhibition of ROCK could significantly improve the function of the peritoneum and reduce the characteristics of 94

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

Fig. 5. CK induces a shift in the G/F-actin ratio and ameliorates actin dynamics. (A) The levels of F-actin (green) and G-actin (red) with and without CK (2 mM) under various conditions (50 mM Glu and 50 mM Glu þ 3 mM SRI-011381). NCIeH716 cells were imaged by confocal microscopy. Yellow indicates the merge of F-actin and G-actin. Blue indicates DAPI. Overlay indicates colocalization. Scale bar ¼ 20 mm. (BeC) Bar graph, the G/F-actin ratio in the cytosol of NCIeH716 cells (quantified from three western blots as described in the Methods section). Inset shows a representative western blot of F-actin, G-actin, and total actin in the groups with and without CK (2 mM) under various conditions (50 mM Glu and 50 mM Glu þ 3 mM SRI-011381). Bars represent the mean ± s.e.m., n ¼ 3. *p < 0.05, **p < 0.01 versus the 25 mM Glu group; #p < 0.05, ##p < 0.01 versus the CK (2 mM) group. CK, compound K; Glu, glucose. G-actin, globular actin; F-actin, filamentous actin; DAPI, diaminophenylindole; ns, no significance.

signaling pathway by Y27632 promotes cell proliferation along the intestinal lineages.7 Here, we demonstrated that ROCK2 is indispensable for CK-mediated GLP1 secretion and that CK inhibits the activation of RhoA and regulates the expression of ROCK1/2. This complex phenomenon enriches the functional diversity of ROCK subtypes bound to enteroendocrine cells. However, Y27632 has been found to be a relatively inefficient ROCK inhibitor,40 and there is evidence in hyperglycemia-induced atherosclerosis that it can prevent the excessive accumulation of TGFb1 by blocking ROCK1 alone.43 CK treatment also profoundly altered the actin dynamics and mechanical cues, an action that is likely to contribute to the maintenance of enteroendocrine homeostasis with long-term benefits. RhoA/ROCK signaling controls actin dynamics, and mechanical cues are known to mediate YAP signaling for accumulation of F-actin on the cytoskeleton.32 Furthermore, the major incapability of exocytosis is attributed to the assembly and mutilation in the cytoskeleton as well as in the intracellular signaling network. Interestingly, F-actin accumulation in pancreatic b-cells caused by sustained hyperglycemia stimulation impedes the secretion of glucose-induced insulin.44 Therefore, we speculate that a similar mechanism also exists in L cells. The G/F-actin ratio is a critical indicator of the stability of the actin cytoskeleton. Our results demonstrate that in NCIeH716 cells under high-glucose conditions, the cytoskeleton is sheathed through F-actin accumulation and Gactin migration onto it, and this process can be reversed moderately by CK. This finding indicates the essential role of stress fibers and mechanical cues mediated by ROCKs in the repair of L cells by CK treatment. Recent research on mechanotransduction explains that mechanical forces derived from the intercellular microenvironment impinge upon the cytoskeleton and thus alter the cell function.45

Therefore, ROCKs serve as the central controller to coordinate the cytoskeleton and the activation level of the YAP pathway, which might determine the fate of cells. Although the impact of mechanical cues on L cells remains unclear, it has been reported that YAP expression is mandatory for cellular reprogramming during intestinal regeneration.46 In light of the above data, it is important to explore the mechanism of CK in maintaining homeostasis in enteroendocrine cells. Therefore, the protective role of CK on the incretin effect could partially contribute to its effect on T2D. However, at the cellular level, we could not intuitively determine the action of CK on L cells with biomechanics. This remains to be further explored in vivo. In conclusion, we have provided novel insights into the mechanism of action of CK triggering the secretion of GLP1. Our findings project a novel perspective that CK can be potentially beneficial in digestive tract metabolism disorders by coordinating the expression of ROCKs. Declaration of competing interest The authors declare that they have no conflicts of interest. Acknowledgements This work was supported by the National Key Research and Development Plan of China (No. 2018YFC2000200). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.jphs.2020.11.005. 95

F. Tian, X. Wang, H. Ni et al.

Journal of Pharmacological Sciences 145 (2021) 88e96

References

24. Hsu WH, Hua KF, Tuan LH, et al. Compound K inhibits priming and mitochondria-associated activating signals of NLRP3 inflammasome in renal tubulointerstitial lesions. Nephrol Dial Transplant. 2020;35(1):74e85. 25. Lee S, Kwon MC, Jang JP, Sohng JK, Jung HJ. The ginsenoside metabolite compound K inhibits growth, migration and stemness of glioblastoma cells. Int J Oncol. 2017;51(2):414e424. 26. Lackey DE, Olefsky JM. Regulation of metabolism by the innate immune system. Nat Rev Endocrinol. 2016;12(1):15e28. 27. Song Y, Koehler JA, Baggio LL, Powers AC, Sandoval DA, Drucker DJ. Gut-proglucagon-derived peptides are essential for regulating glucose homeostasis in mice. Cell Metabol. 2019;30(5):976e986. e973. 28. Petersen N, Reimann F, van Es JH, et al. Targeting development of incretinproducing cells increases insulin secretion. J Clin Invest. 2015;125(1):379e385. 29. Cai J, Song X, Wang W, et al. A RhoA-YAP-c-Myc signaling axis promotes the development of polycystic kidney disease. Genes Dev. 2018;32(11e12):781e793. 30. Dupont S, Morsut L, Aragona M, et al. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474(7350):179e183. 31. Gregorieff A, Liu Y, Inanlou MR, Khomchuk Y, Wrana JL. Yap-dependent reprogramming of Lgr5(þ) stem cells drives intestinal regeneration and cancer. Nature. 2015;526(7575):715e718. 32. Aragona M, Panciera T, Manfrin A, et al. A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell. 2013;154(5):1047e1059. 33. Turner DP, Moussa O, Sauane M, Fisher PB, Watson DK. Prostate-derived ETS factor is a mediator of metastatic potential through the inhibition of migration and invasion in breast cancer. Cancer Res. 2007;67(4):1618e1625. 34. Zhang H, Zhou Z, Chen Z, Zhong Z, Li Z. Ginsenoside Rg3 exerts anti-depressive effect on an NMDA-treated cell model and a chronic mild stress animal model. J Pharmacol Sci. 2017;134(1):45e54. 35. Zong W, Zeng X, Chen S, et al. Ginsenoside compound K attenuates cognitive deficits in vascular dementia rats by reducing the Abeta deposition. J Pharmacol Sci. 2019;139(3):223e230. 36. Song W, Wei L, Du Y, Wang Y, Jiang S. Protective effect of ginsenoside metabolite compound K against diabetic nephropathy by inhibiting NLRP3 inflammasome activation and NF-kappaB/p38 signaling pathway in high-fat diet/streptozotocininduced diabetic mice. Int Immunopharm. 2018;63:227e238. 37. Peng H, Li Y, Wang C, et al. ROCK1 induces endothelial-to-mesenchymal transition in glomeruli to aggravate albuminuria in diabetic nephropathy. Sci Rep. 2016;6:20304. 38. Aizawa H, Wakatsuki S, Ishii A, et al. Phosphorylation of cofilin by LIM-kinase is necessary for semaphorin 3A-induced growth cone collapse. Nat Neurosci. 2001;4(4):367e373. 39. Xiang S, Li M, Xie X, et al. Rapamycin inhibits epithelial-to-mesenchymal transition of peritoneal mesothelium cells through regulation of Rho GTPases. FEBS J. 2016;283(12):2309e2325. 40. Kumper S, Mardakheh FK, McCarthy A, et al. Rho-associated kinase (ROCK) function is essential for cell cycle progression, senescence and tumorigenesis. Elife. 2016;5, e12994. 41. Chen M, Zhang Y, Li W, Yang J. MicroRNA-145 alleviates high glucose-induced proliferation and migration of vascular smooth muscle cells through targeting ROCK1. Biomed Pharmacother. 2018;99:81e86. 42. Libanje F, Raingeaud J, Luan R, et al. ROCK2 inhibition triggers the collective invasion of colorectal adenocarcinomas. EMBO J. 2019;38(14), e99299. 43. Tang H, Zhu M, Zhao G, et al. Loss of CLOCK under high glucose upregulates ROCK1-mediated endothelial to mesenchymal transition and aggravates plaque vulnerability. Atherosclerosis. 2018;275:58e67. 44. Asahara S, Shibutani Y, Teruyama K, et al. Ras-related C3 botulinum toxin substrate 1 (RAC1) regulates glucose-stimulated insulin secretion via modulation of F-actin. Diabetologia. 2013;56(5):1088e1097. 45. Geiger B, Bershadsky A, Pankov R, Yamada KM. Transmembrane crosstalk between the extracellular matrix–cytoskeleton crosstalk. Nat Rev Mol Cell Biol. 2001;2(11):793e805. 46. Cai J, Zhang N, Zheng Y, de Wilde RF, Maitra A, Pan D. The Hippo signaling pathway restricts the oncogenic potential of an intestinal regeneration program. Genes Dev. 2010;24(21):2383e2388.

1. Disease GBD, Injury I, Prevalence C. Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 19902015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet. 2016;388(10053):1545e1602. 2. Cho NH, Shaw JE, Karuranga S, et al. IDF Diabetes Atlas: global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res Clin Pract. 2018;138:271e281. 3. Drucker DJ, Nauck MA. The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet. 2006;368(9548):1696e1705. 4. Andersen A, Lund A, Knop FK, Vilsboll T. Glucagon-like peptide 1 in health and disease. Nat Rev Endocrinol. 2018;14(7):390e403. 5. Drucker DJ. Mechanisms of action and therapeutic application of glucagon-like peptide-1. Cell Metabol. 2018;27(4):740e756. 6. Xu G, Kaneto H, Laybutt DR, et al. Downregulation of GLP-1 and GIP receptor expression by hyperglycemia: possible contribution to impaired incretin effects in diabetes. Diabetes. 2007;56(6):1551e1558. 7. Petersen N, Frimurer TM, Terndrup Pedersen M, et al. Inhibiting RHOA signaling in mice increases glucose tolerance and numbers of enteroendocrine and other secretory cells in the intestine. Gastroenterology. 2018;155(4): 1164e1176. e1162. 8. Ridley AJ. Rho GTPases and actin dynamics in membrane protrusions and vesicle trafficking. Trends Cell Biol. 2006;16(10):522e529. 9. Arita R, Hata Y, Nakao S, et al. Rho kinase inhibition by fasudil ameliorates diabetes-induced microvascular damage. Diabetes. 2009;58(1):215e226. 10. Kolavennu V, Zeng L, Peng H, Wang Y, Danesh FR. Targeting of RhoA/ROCK signaling ameliorates progression of diabetic nephropathy independent of glucose control. Diabetes. 2008;57(3):714e723. 11. Kizub IV, Pavlova OO, Johnson CD, Soloviev AI, Zholos AV. Rho kinase and protein kinase C involvement in vascular smooth muscle myofilament calcium sensitization in arteries from diabetic rats. Br J Pharmacol. 2010;159(8): 1724e1731. 12. Hall A. Rho GTPases and the actin cytoskeleton. Science. 1998;279(5350): 509e514. 13. Klunder LJ, Faber KN, Dijkstra G, van ISCD. Mechanisms of cell polaritycontrolled epithelial homeostasis and immunity in the intestine. Cold Spring Harb Perspect Biol. 2017;9(7). 14. Carlier MF, Shekhar S. Global treadmilling coordinates actin turnover and controls the size of actin networks. Nat Rev Mol Cell Biol. 2017;18(6):389e401. 15. He L, Ma Y, Li W, Han W, Zhao X, Wang H. Protease-activated receptor 2 signaling modulates susceptibility of colonic epithelium to injury through stabilization of YAP in vivo. Cell Death Dis. 2018;9(10):949. 16. Lima MJ, Muir KR, Docherty HM, et al. Suppression of epithelial-tomesenchymal transitioning enhances ex vivo reprogramming of human exocrine pancreatic tissue toward functional insulin-producing beta-like cells. Diabetes. 2013;62(8):2821e2833. 17. Ghazizadeh Z, Kao DI, Amin S, et al. ROCKII inhibition promotes the maturation of human pancreatic beta-like cells. Nat Commun. 2017;8(1):298. 18. Attele AS, Wu JA, Yuan CS. Ginseng pharmacology: multiple constituents and multiple actions. Biochem Pharmacol. 1999;58(11):1685e1693. 19. Sievenpiper JL, Arnason JT, Vidgen E, Leiter LA, Vuksan V. A systematic quantitative analysis of the literature of the high variability in ginseng (Panax spp.): should ginseng be trusted in diabetes? Diabetes Care. 2004;27(3):839e840. 20. Wakabayashi C, Hasegawa H, Murata J, Saiki I. In vivo antimetastatic action of ginseng protopanaxadiol saponins is based on their intestinal bacterial metabolites after oral administration. Oncol Res. 1997;9(8):411e417. 21. Jiang S, Ren D, Li J, et al. Effects of compound K on hyperglycemia and insulin resistance in rats with type 2 diabetes mellitus. Fitoterapia. 2014;95:58e64. 22. Chen W, Wang J, Luo Y, et al. Ginsenoside Rb1 and compound K improve insulin signaling and inhibit ER stress-associated NLRP3 inflammasome activation in adipose tissue. J Ginseng Res. 2016;40(4):351e358. 23. Bai L, Gao J, Wei F, Zhao J, Wang D, Wei J. Therapeutic potential of ginsenosides as an adjuvant treatment for diabetes. Front Pharmacol. 2018;9:423.

96