- Email: [email protected]
Zn-exposure in brown trout (Salmo trutta)
Chemosphere 67 (2007) 2241–2249 www.elsevier.com/locate/chemosphere
Induction and activity of oxidative stress-related proteins during waterborne Cd/Zn-exposure in brown trout (Salmo trutta) Bjørn Henrik Hansen
a,*
, Svein Rømma a, Øyvind Aaberg Garmo b, Sindre Andre Pedersen a, Pa˚l Asgeir Olsvik c, Rolf Arvid Andersen a
a b
Norwegian University of Science and Technology (NTNU), Department of Biology, Høgskoleringen 5, N-7491 Trondheim, Norway Norwegian University of Science and Technology (NTNU), Department of Chemistry, Høgskoleringen 5, N-7491 Trondheim, Norway c National Institute of Nutrition and Seafood Research (NIFES), Nordnes, N-5817 Bergen, Norway Received 24 May 2006; received in revised form 6 December 2006; accepted 7 December 2006 Available online 5 February 2007
Abstract We studied how transcript levels of metallothionein (MT), Cu/Zn–superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX) and glutathione reductase (GR) as well as functional protein levels of MT, SOD and CAT in brown trout tissues changed during a 15-days waterborne exposure to Cd and Zn. Trout from a river with low levels of metals (the Stribekken River) was transferred to a river with high levels of Cd and Zn (the Naustebekken River) and exposed up to 15 days. The aim of this transfer experiment was to investigate how exposure to Cd and Zn induced transcription and activities of central antioxidant enzymes and proteins in an environmental setting. Significant uptake of both Cd and Zn was observed in gills during the 15 days exposure, and Cd levels was found to correlate significantly with transcript levels of MT-A, SOD, GPx and GR. Gill concentrations of Zn did not correlate significantly with the transcript levels of the stress genes studied, but Zn might have triggered transcription of proteins which dealt with subsequent accumulation of Cd. SOD and CAT activities increased in gills after transfer, but MT protein levels decreased. In liver, SOD activity and MT protein levels increased, while in kidney only MT protein concentrations were elevated after transfer. There was a general lack of consistency between mRNA transcription and enzyme activities, indicating that these proteins and enzymes are not solely under transcriptional control. 2007 Elsevier Ltd. All rights reserved. Keywords: Cadmium; Zinc; Gene expression; Mining; Fish
1. Introduction Cadmium (Cd) and zinc (Zn) are metals often found together in the environment because of similar properties (Hutton, 1983), but biologically they have diverging properties. Cd is regarded as non-essential and toxic, and can disturb the ionoregulatory system in aquatic organisms (Verbost et al., 1987; McGeer et al., 2000a), as well as
* Corresponding author. Address: SINTEF – Materials and Chemistry, Marine Environmental Technology, 7465 Trondheim, Norway. Tel.: +47 98283893. E-mail address: [email protected] (B. Henrik Hansen).
0045-6535/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.chemosphere.2006.12.048
enhance oxidative stress by alteration of the glutathione (GSH) turnover (Tort et al., 1996), inhibition of antioxidant enzymes (Pruell and Engelhardt, 1980) and enhancing the leakage of mitochondrial reactive oxygen species (ROS) (Wang et al., 2004). Zn, on the other hand, is essential as a cofactor for many enzymes (e.g., Cu/Zn–SOD) and also serves an important function in transcription of many genes involved in cellular protection against ROS (Chung et al., 2005). At high levels, Zn can also cause osmoregulatory disturbances in aquatic organisms (McGeer et al., 2000a), and may also cause cytotoxic effects in the presence of hydrogen peroxide (H2O2) (Chung et al., 2005). In the present paper, we will focus on metal-mediated oxidative stress responses.
2242
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
The metal-mediated production of ROS adds to the natural endogenous production by mitochondria. ROS generated from both exogenous and endogenous sources are detoxified by a set of antioxidant enzymes, which subsequently protect proteins, lipids and nucleic acids against damage. Superoxide dismutase (SOD) catalyzes the breakdown of superoxide anion ð O 2 Þ, while catalase (CAT) and glutathione peroxidase (GPx) handle hydrogen peroxide (H2O2). Reduced glutathione (GSH) is also an important antioxidant, which is readily oxidized by ROS to oxidized glutathione (GSSG), but can also bind metals that might induce oxidative stress. The reduction of GSSG to yield GSH is catalyzed by glutathione reductase (GR) (Stohs and Bagchi, 1995). Antioxidant systems have been proposed for the use as biomarkers for exposure to ROS-mediating contaminants, like some metals, but their potential as tools in environmental risk assessment (ERA) have been questioned (van der Oost et al., 2003). Salmonids are among the most metal sensitive teleost families (Olsson and Kille, 1997). Reported LC50-values (96 h) for Zn are below 1 mg/l, while LC50-values (three weeks) for Cd can be as low as 3.7 lg/l (Chapman and Stevens, 1978). Chronic exposures to low levels of Cd and Zn have been studied in relation to metallothionein (MT), which is a low molecular weight protein that serves a protective role by binding and immobilizing potentially toxic metals (Kagi and Schaffer, 1988). MT also contributes in the homeostasis of essential metals like Zn and Cu (Vallee, 1995), as well as functioning as a strong antioxidant (Thornalley and Vasak, 1985). MT, however, increases the biological half-life of Cd because of retention of MT-bound Cd in kidney (Norey et al., 1990). Because of the relatively clear relationships between MT induction and metal exposure, MT have been proposed as a suitable biomarker for exposure to metals like Cd, Zn and Cu (Olsvik et al., 2001; van der Oost et al., 2003). The Stribekken and Naustebekken rivers in the Røros region in central Norway are located in the same area, but have different levels of Cd and Zn. In a previous paper (Hansen et al., 2006a), we described baseline levels of antioxidants in brown trout tissues from these rivers. The Stribekken River was used as a local reference river because of its low levels of metals in general. The Naustebekken River had elevated levels of Cd and Zn, and we showed that the levels of Cd and Zn in brown trout gills corresponded well with the concentrations in the river. The levels of MT in gills, liver and kidney were elevated in trout from the Naustebekken River compared to the Stribekken River. In addition, we found that levels of antioxidants (transcriptional levels and enzyme activities) generally were higher in gills, liver and kidney of trout from the Naustebekken River compared to the Stribekken River (Hansen et al., 2006a). By transferring trout from the Stribekken River to the Naustebekken River, we were able to test if the metal levels in the Naustebekken River could impose oxidative stress in brown trout tissues, and to study transcriptional induction of well-known antioxidants as a
function of time. There is a lack of knowledge on relationships between mRNA transcript levels and the functional activity of proteins involved in metal handling and detoxification. Very few, if any, have studied gene expression (mRNA transcripts and protein levels simultaneously) in response to metal exposure in environmentally relevant situations. Antioxidant enzymes also seem to function in concert (Michiels et al., 1994), and the present paper gives information about both relationships between metals and antioxidant systems as well as possible interplays between different antioxidants. 2. Materials and methods 2.1. Experimental design and sampling Brown trout (22.8 ± 11.4 g, 14.0 ± 2.5 cm, n = 36) from the Stribekken River were caught by electric fishing or by basket traps and kept encaged in their native river for 4–7 days prior to transfer to the Naustebekken River. On the day of transfer, 6 fish were sampled as control group, and the remaining 30 fish were transferred from the Stribekken River to the Naustebekken River. The exposures of the fish were done in cages placed directly in the river. On day 1, 2, 4, 7, and 15 of the exposure 6 fish were sampled for analysis. The fish were killed by a blow to the head, and subsequently weighed and measured. The second right gill arch with filament was excised and placed in an acid-washed tube for metal analysis. Tissue samples (80– 100 mg) from gills, liver and kidney were homogenized in 800 ll of Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) for gene expression analysis. Remaining tissue from each organ was distributed to separate cryo tubes for protein and enzyme analyses. All samples were immediately flash frozen in liquid nitrogen and brought to the lab for storage at 80 C. The fish were immature, and they were therefore not selected or pooled with respect to gender. During the exposure in the Naustebekken River the fish were not actively fed, but some food might have seeped into the cages. There were no significant differences (p < 0.05) in weight, length and condition factors between the groups. The responses seen on biochemical parameters were therefore attributed to increased metal exposure levels after transfer of the fish from their native habitat in the Stribekken River to the contaminated Naustebekken River. Biological parameters are summarized in Table 1. The low number of fish used in this experiment might not be sufficient to reveal subtle distinctions in fish response. Brown trout were hard to catch in the Stribekken River because of the low population density, but it was the only river in the area which could be used as a reference. 2.2. Water chemistry Water samples were taken from the Stribekken River prior to fish transfer and from the Naustebekken River
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
2243
Table 1 Biological parameters and gill metal concentrations of trout from Stribekken exposed in the River Naustebekken
Control 1 day 2 days 4 days 7 days 15 days
N
Weight (g)
Length (cm)
Cond. fact.
Cd (lg/g)
Cu (lg/g)
Zn (lg/g)
6 6 6 6 6 6
22.8 ± 11.4 23.7 ± 4.5 16.3 ± 9.4 26.3 ± 22.5 17.3 ± 10.8 21.3 ± 12.1
14.0 ± 2.5 13.9 ± 0.8 12.5 ± 1.8 13.6 ± 3.5 12.6 ± 2.8 13.3 ± 2.8
0.78 ± 0.06 0.87 ± 0.02 0.75 ± 0.13 0.83 ± 0.09 0.75 ± 0.08 0.82 ± 0.10
0.35 ± 0.14 0.61 ± 0.22 0.54 ± 0.12 0.84 ± 0.21* 0.80 ± 0.17* 1.18 ± 0.53*
1.75 ± 1.48 2.63 ± 0.91 2.21 ± 0.56 2.57 ± 0.78 1.49 ± 0.46 2.72 ± 1.08
292.8 ± 114.9 634.5 ± 139.3* 636.4 ± 85.6* 651.6 ± 122.9* 414.3 ± 108.2 480.2 ± 80.1*
Condition factor was calculated as weight (g)/length3 (cm) · 100. Values are expressed as means ± standard deviation. Significant differences (p < 0.05) between control group and exposed groups are shown as *.
after transfer. They were acidified with nitric acid (HNO3, 14.5 M) to a final concentration of 0.1 M before metal analysis by Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). Repeated analyses of conductivity, temperature, alkalinity and pH were conducted throughout the experimental period. Sampling with the technique of diffusive gradients in thin films (DGT) was performed in the Stribekken River prior to transfer and in the Naustebekken River during the experiment. DGT sampling was included because it provides a time-averaged concentration, in contrast to traditional grab-sampling, and because the DGT-labile fraction of metal is more closely related to bioavailable waterborne metal than the total concentration (Luider et al., 2004; Røyset et al., 2005). The procedure applied for DGT sampling and analysis is described elsewhere (Garmo et al., 2003; Hansen et al., 2006a). 2.3. Metal analysis The gill samples for metal analysis were transferred to preweighed acid washed 15 ml polypropylene tubes ˚ storp, Sweden), in which they were (AB Cerbo-Hertila, A lyophilized, reweighed and subsequently digested in HNO3 (800 ll, 14.5 M) and H2O2 (400 ll, 30%, pro analysis, Merck) for 1 h at 100C. Thereafter, the gill samples were diluted with 13 ml of MilliQ water and analyzed with ICP-MS. Certified reference material (Bovine liver 1577, National Institute of Standards and Technology, Gaithersburg, MD, USA) was used to assess the accuracy of the analysis. For every tenth sample a matrix-modified standard sample was measured to control for drift in the ICP-MS system. The ICP-MS analyses were performed at the core facility at the Department of Chemistry, NTNU.
2.4. Analyses on stress gene transcript levels Samples collected and homogenized in Trizol Reagent were thawed on ice, and total RNA was purified according to the manufacturer’s instructions (Invitrogen). Samples were treated with DNAase I (DNAfree kit, Ambion, Austin, TX, USA) to remove potentially contaminating DNA. High RNA-quality was assured by measurements of the absorbance at 260 and 280 nm, and by checking the integrity of the 18S and 28S rRNA bands by electrophoresis on 1.5% formaldehyde–agarose gels. cDNA was made from purified RNA-samples with a cDNA synthesis kit from Bio-Rad Laboratories (Hercules, CA, USA) according to the manufacturer’s instructions. From one sample from each tissue a serial dilution of total RNA was converted to cDNA in triplicates. These samples were analyzed for all genes, and a dilution curve was plotted to evaluate the PCR-efficiency and to create a standard curve for measurements of gene transcription in samples. From all the samples duplicates of cDNA were produced with an RNA input of 250 ng. Primers used in the real-time PCR system and their accession numbers of origin are given in Table 2. PCRproducts were cloned, sequenced and BLASTed to ensure that the correct target mRNA sequences were quantified. Real-time PCR was performed with a Stratagene Mx3000P Real-Time PCR System (La Jolla, CA, USA). The method has been described previously (Hansen et al., 2006a). The dilution curves of cDNA were used to verify a good PCR-efficiency (1.8–2.2), and to calculate expression of target gene. Normalization of gene expression data was not possible since, according to the Genorm software (Vandesompele et al., 2002), none of the two most common housekeeping genes; b-actin and elongation factor 1AA
Table 2 Accession numbers of specific primer pairs for MT-A, SOD, CAT, GPx, GR, EF1AA and b-actin genes from salmonids used in our studies Gene name
Accession no.
Prod. size (bp)
Forward primer (5 0 –3 0 )
Reverse primer (5 0 –3 0 )
MT-A SOD CAT GPx GR EF1AA b-Actin
X97274 BG936553 BE669040 BG934453 BG934480 AF321836 BG933897
101 140 79 140 61 57 91
CCTTGTGAATGCTCCAAAACTG CCACGTCCATGCCTTTGG GAGGGCAACTGGGACCTTACT GATTCGTTCCAAACTTCCTGCTA CCAGTGATGGCTTTTTTGAACTT CCCCTCCAGGACGTTTACAAA CCAAAGCCAACAGGGAGAAG
CAGTCGCAGCAACTTGCTTTC TCAGCTGCTGCAGTCACGTT GGACGAAGGACGGGAACAG GCTCCCAGAACAGCCTGTTG CCGGCCCCCACTATGAC CACACGGCCCACAGGTACA AGGGACAACACTGCCTGGAT
2244
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
were sufficiently stable. It is extremely important to verify the stability of a house-keeping gene, in order to generate reliable data on stress gene transcript levels (Arukwe, in press). Because of the lack of stability in the two studied house-keeping genes, we therefore used a standard curve method and normalize against total RNA input to calculate gene expression. Using a sample from the material to create a standard curve was considered more reliable than using normalization towards a non-stable housekeeping gene. Gene expression was calculated in terms of fold induction compared to the control group. 2.5. Protein and enzyme analyses Tissue samples were homogenized in ice-cold deoxygenated 1:9 w/v 20 mM Tris–HCl buffer (pH 7.4) and centrifuged at 10 000g for 10 min. Aliquots of 100 ll were used for the MT-quantification and enzyme activity measurements. For MT quantification, the tetrathiomolybdate assay was used (Klein et al., 1990; Olsvik et al., 2000). The peroxidative activity of CAT was measured using a microtiter plate assay (Johansson and Hakan Borg, 1988) as described earlier (Hansen et al., 2006a). Total protein concentrations in samples were measured by the Bradford assay (Bradford, 1976). SOD activity was analyzed by the use of a commercial colorimetric assay kit according to the manufacturer’s instructions (Kamiya Biomedical Company, Seattle, WA, USA). 2.6. Statistical analysis One-way ANOVA was used to check for differences between the control and the exposed groups. To identify significant differences obtained by one-way ANOVA, pairwise comparisons between experimental groups and the control group were performed by Dunnet’s post hoc method, with a family-wise error of 0.05. Associations between parameters were studied by the use of Spearman correlation. Statistical analysis was performed by the use of SPSS 11.0 software (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Water chemistry Metal concentrations and limnochemical parameters in water samples from the Stribekken and Naustebekken Rivers are presented in Table 3. The two rivers were similar in terms of pH and temperature. The Ca concentration, alkalinity and conductivity were slightly higher in the Naustebekken River compared to the Stribekken River. Cd, Cu and Zn concentrations were 20, 11 and 31 times higher, respectively, in the Naustebekken River at the time of transfer. The labile or bioavailable fractions of Cd and Zn were equal to the total concentrations in the rivers, whereas for Cu only about 10% of the total concentration was in the labile fraction in the Naustebekken River.
Table 3 Metal concentrations and limnochemical data from the Stribekken and Naustebekken Rivers measured before transfer from the Stribekken River and during the exposure of Stribekken trout in the Naustebekken River
pH Temperature (C) Conductivity (lS/cm) Alkalinity (lEq/l) Cd total (ng/l) Cd labile (ng/l) Cu total (lg/l) Cu labile (lg/l) Zn total (lg/l) Zn labile (lg/l) Ca total (mg/l)
Stribekken River
Naustebekken River
7.1 ± 0.4 (4) 13.8 ± 3.6 (5) 18.8 ± 0.4 (5) 94.0 ± 12.2 (3) 7.3 ± 5.1 (5) 5.6 (1) 0.66 ± 0.17 (5) 0.1 (1) 2.24 ± 0.83 (5) 1.5 (1) 2.1 ± 0.1 (5)
7.0 ± 0.3 (7) 13.0 ± 1.9 (6) 25.1 ± 1.8 (7) 155.5 ± 25.7 (4) 147.3 ± 30.0 (8) 172.7 (1) 7.43 ± 0.90 (8) 0.75 (1) 70.0 ± 10.4 (8) 95.8 (1) 2.8 ± 0.1 (8)
Labile metals were measured by the use of diffusive gradients in thin films (DGT). One DGT was kept in each river for 5–8 days. N is given in parentheses.
3.2. Gill uptake of Cd, Cu and Zn Gill concentrations of Cd, Cu and Zn are shown in Table 1. Significant uptake was observed for Cd and Zn in the trouts during the exposure in the Naustebekken River (p < 0.05). Cd concentrations in gills increased slowly throughout the exposure period. Zn concentrations peaked at day 1 of the exposure, were stable until day 4, and then dropped. After 15 days the level of Zn appeared to stabilize at a somewhat higher level than in the control. Gill-accumulation of Cu was not observed. 3.3. Stress gene expression and proteins Transcriptional levels of the analyzed stress genes are shown in Fig. 1a (gills), 1b (liver) and 1c (kidney). The data are expressed as fold induction compared to the control group sampled before transfer to the Naustebekken River. Transcription of MT-A was induced in gills, liver and kidney of the exposed group. The highest level of induction was found in liver, but the fastest response occurred in gills, where significant increase compared to the control group was observed already after one day of exposure. For SOD transcript levels, a significant increase was only seen in gills, and this was consistent from day four until the end of the experiment. Significant increases in CAT transcript levels were only observed in the liver after one and two days of exposure. In gills, which was the only organ to be analyzed for metals, significant correlations were found between Cd concentrations and transcript levels of MT-A (RSp = 0.521, p < 0.001, Fig. 2a), SOD (RSp = 0.505, p < 0.05), GPx (RSp = 0.575, p < 0.001) and GR (RSp = 0.699, p < 0.001, Fig. 2b). Zn and Cu concentrations were not found to correlate significantly with the transcript levels of any of the stress genes. We found significant correlations between gene transcripts of different stress genes, and some of them seemed to be expressed in a similar manner. In gills, we
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
2245
Fig. 1. Transcriptional levels of MT-A, SOD, CAT, GPx and GR in gills (a), liver (b), and kidney (c) as a function of time after transfer of Stribekken trout to the Naustebekken River (days). Significant differences (p < 0.05) between control group and exposed groups are shown as *. n = 6 in every group. Values are given as means ± standard deviations.
Fig. 2. Relationships between gill Cd concentrations and transcriptional levels of MT-A (a) and GR (b) for all trout used in the experiment (n = 36).
observed significant correlations between MT-A and GPx (RSp = 0.585, p < 0.001) and GR (RSp = 0.618, p < 0.001). SOD transcript levels also correlated significantly with GPx (RSp = 0.632, p < 0.001) and GR (RSp = 0.789, p < 0.001), and finally a significant correlation was found between GPx and GR (RSp = 0.695, p < 0.001). CAT did not seem to follow the same transcription pattern as the other genes in gills, but we did find significant correlations between CAT and SOD in liver (RSp = 0.765, p < 0.001) and in kidney (RSp = 0.713, p < 0.001). In liver and kidney elevated levels of MT protein were observed at day 7 and 15 of the exposure (Fig. 3). MT-A transcript levels correlated significantly with MT protein
concentrations in liver (RSp = 0.531, p < 0.001) and kidney (RSp = 0.547, p < 0.001), but this was not observed in gills. MT protein levels were actually lower in gills after two days of exposure (Fig. 3). Neither did we find a significant correlation between gene transcription and enzyme activities of SOD and CAT. We did, however, observe an increase in SOD activity in gills and liver at day four (Fig. 4a) and day two (Fig. 4b), respectively, but in both tissues enzyme activity levels returned to basal levels thereafter. For CAT enzyme activity, an increase was found on day 15 in gills, after a non-significant drop on day two (p < 0.05, Fig. 4a). No responses on CAT activity were observed in liver and kidney (data not shown).
2246
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
Fig. 3. Concentrations of MT protein (lg MT/g tissue fresh weight) in gills, liver and kidney during the exposure. Significant differences (p < 0.05) between control group and exposed groups are shown as *. n = 6 in every group. Values are given as means ± standard deviations.
4. Discussion Accumulation of Cd and Zn was observed in the brown trout gills after transfer, but these two metals seemed to follow two different uptake patterns. Cd levels appeared to increase steadily throughout the exposure period without reaching a peak. Studies on rainbow trout exposed to Cd (3 lg/l) indicated that the levels of Cd in gills stabilized at day 16 of a 65 day exposure (McGeer et al., 2000b). Previous studies (Hansen et al., 2006a) have shown that the Cd levels in the gills of the native Naustebekken trout were over 30 times higher than in the Stribekken trout gills, so an increase in Cd levels in gills of the transferred Stribekken trout was expected. Gill Zn concentrations reached a peak already on day two after transfer, and thereafter the concentration was steady until a decrease was observed at the end of the experiment. The drop in Zn levels after four days may have been caused by a redistribution of Zn to the bloodstream possibly by a Zn transporter (Feeney et al., 2005), and/or it can be a result of reduction in Zn uptake. The concentration of Zn in the Stribekken River was low, and active uptake of this essential metal in brown trout in their native river is assumed. Thus, the strong increase in gill Zn-levels seen at day one after trans-
fer probably reflected that these active uptake mechanisms still functioned as normal. A Zn concentration of 600 lg/g tissue (dry weight) appeared to be the critical level for which active uptake was reduced, and the levels decreased to about 450 lg Zn/g tissue. In another study, gill levels of Zn in the Stribekken trout were compared to both native Naustebekken trout and trout from the Cu-contaminated Rugla River (Hansen et al., 2006a). The Cu-exposed Rugla trout was found to have the same levels of Zn as the Stribekken trout, but the Naustebekken trout had concentrations well over 1000 lg Zn/g tissue dry weight. Zn levels in gills did not correlate significantly with the transcript levels of the studied stress genes. Zn has a wellknown protective effect against ROS, but high concentrations of Zn can also enhance oxidative stress (Chung et al., 2005). It has been proposed that the protective mechanism involve Zn-induced transcription of genes encoding proteins with key roles in antioxidant defense, such as MT, SOD, CAT and GPx (Kling and Olsson, 2000; Chung et al., 2005). Zn-mediated gene transcription has a protective effect against H2O2 toxicity as long as Zn is administered prior to H2O2 exposure. The mechanism appears to be complicated, however, since a simultaneous exposure to both Zn and H2O2 was found to be more cytotoxic than exposure to H2O2 administered alone. Metal responsive element (MRE) sequences, which are triggered by the Zn dependent metal transcription factor-1 (MTF-1), have been found upstream for as many as 28 antioxidant genes in pufferfish (Fugu rubripes) (Chung et al., 2005), so Zn may have a vital function in the induction of these genes. The lack of correlations between gill Zn concentrations and stress gene transcript levels in our data does not necessarily imply lack of a cause–effect relationship. Some time lag must be expected between uptake of metals and the subsequent transcription of stress gene mRNA. Gill Cd concentrations; however, correlated strongly with transcript levels of all stress genes except CAT in gills. Induction of MT through the MRE/MTF-1 pathway may occur indirectly by a displacement of Zn with Cd on MT or on other Zn–proteins, hence providing more free Zn ions for binding to MTF-1. The increase in gene transcription of MT and antioxidant enzymes seen in this work may be induced
Fig. 4. SOD (in U SOD/mg protein) and CAT (in lmol/min/g tissue fresh weight) activities in gills (a) and liver (b) during the exposure. Significant differences (p < 0.05) between control group and exposed groups are shown as *. n = 6 in every group. Values are given as means ± standard deviations.
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
by the fast Zn accumulation and offer protection against the toxic effects of the more slowly accumulating Cd. Direct induction of MT through the MRE/MTF-1 pathway has been shown for silver (Ag) exposure (Mayer et al., 2003). It can therefore not be ruled out that the Cd taken up by gills of the trout directly induced stress genes through the MRE/MTF-1 pathway. This hypothesis may be strengthened by the strong correlations found between Cd concentrations and stress gene transcript levels in our data. Correlations between mRNA transcript levels and functional protein levels can often not be demonstrated (Misra et al., 1997; Hansen et al., 2006b), because of post-transcriptional modifications. This is a challenge particularly for the elucidation of mechanisms involved in metal exposures, since some metals are essential cofactors in enzymes dealing with metal-mediated oxidative stress, while others are both enhancing oxidative stress directly and inhibiting antioxidant enzymes by replacement of essential metal ions. Both SOD and CAT enzyme activities have been shown to be altered by exposure to metals (Pruell and Engelhardt, 1980; Shukla et al., 1987), but at the same time these enzymes are essential in dealing with oxidative stress both produced naturally or indirectly through the actions of transition metals, like Cu and Fe (Stohs and Bagchi, 1995). The use of antioxidant enzymes as biomarkers in environmental risk assessment is therefore complicated, and their usefulness as biomarkers has been questioned (van der Oost et al., 2003). We found no induction of CAT mRNA in gills, but the enzyme activity measurements showed that there was an initial non-significant decrease at day two, with a subsequent increase to a level above control levels at day 15 (p < 0.05). The initial decrease can be attributed to an inhibition of the enzyme as a function of Cd-mediated oxidative stress. Cd causes alterations in mitochondria facilitating release of O 2 (Wang et al., 2004), which has been shown to inhibit CAT activity (Kono and Fridovich, 1982). CAT activity has been reported by Romeo et al. (2000) to be reduced by Cd exposure in sea bass (Dicentrarchus labrax). A reactivation of CAT in the trout gills was not a result of increased CAT mRNA transcription, since no increase in CAT transcript levels were observed. Neither for SOD did we observe a clear relationship between gene transcription and enzyme activity. Gill SOD enzyme activity peaked at day four, with the activity reaching control levels thereafter, but the gene transcription analysis revealed higher levels of SOD transcripts than control levels from day four and until the end of the experiment at day 15. The decrease in SOD activity may be caused by metal-mediated inhibition, or it may reflect a decrease in the metal-mediated oxidative stress in gill tissue. MT is mainly regulated at the level of transcription, hence there are no known post-transcriptional modifications (Thiele, 1992). This seems, however, only partly verified in our work. Synthesis of MT mRNA was observed in liver and kidney, as well as in gills, but gills seemed to be
2247
less able to synthesize MT proteins. While there was a significant correlation between MT mRNA and protein levels in liver and kidney, no such relationship was found in gills. The reason for this can be (i) inhibition of MT protein synthesis and/or (ii) oxidation of MT molecules after synthesis. The tetrathiomolybdate assay used to measure MT concentrations in this study, only quantify MT that binds metals (Cd, Cu and Zn), hence this assay does not quantify oxidized MT molecules (Klein et al., 1990). Thus, if MT was synthesized and subsequently oxidized through metal-mediated ROS, the MT concentrations measured would be underestimated. If oxidation of MT molecules occurred, it can be hypothesized that the most important function of MT in gills is to protect against ROS rather than to immobilize metals. We have shown that native trout from the Naustebekken River had significantly higher gill concentrations of MT protein (Hansen et al., 2006a). It is therefore possible that the increase in gill MT protein levels in the Stribekken trout exposed in Naustebekken River is a process to slow to be detected in the present 15 days experiment. The Naustebekken trout may have acquired these high levels as a response to the continuous metal stress in their native river. The increase in MT gene transcripts and protein concentrations observed in liver and kidney after 7 and 15 days, probably reflects the metal redistribution from gills to these tissues (McGeer et al., 2000b). Thus, liver and kidney MT concentrations are good indicators of metal exposure. SOD enzyme activity in liver showed a similar pattern of response as seen in gills; an increased activity during the first few days with a subsequent decrease to control levels. Previous observations (Hansen et al., 2006a) showed significantly higher SOD activity in liver from the Naustebekken trout than in Stribekken trout, but in the present exposure experiment SOD activity returned to basal levels after 15 days. In a study by Cho et al. (2006), an increase in SOD mRNA levels were more apparent in liver than in gills and kidneys from rockbeam (Oplegnathus fasciatus) exposed to Cd, Cu and Zn. This is in contrast to our findings, where we only found an increase in SOD mRNA levels in gills. The use of intraperitoneal injections of metals in the study by Cho et al. might explain the lack of consistency between their results and ours. Cho et al. also demonstrated that Cd was a more potent SOD mRNA inducer than Cu and Zn, which is line with our findings that only Cd concentrations correlated significantly with SOD mRNA levels (p < 0.05). Antioxidant enzymes have been shown to work in a cooperative or synergistic way to protect against oxidative stress, and optimal protection is only achieved at an appropriate balance between them (Michiels et al., 1994; Bagnyukova et al., 2006). Bagnyukova et al. (2005a,b) showed that catalase inhibition during oxidative stress in goldfish (Carassius auratus) resulted in compensatory changes in the activities of glutathione-dependent antioxidant enzymes. Similarly, a reduction in CAT activity in gills was found simultaneously with an increase in SOD activity
2248
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
the first days after transfer. The underlying basis for increased antioxidant enzyme activities is, however, not clear. Our data does not support a direct transcriptional control of antioxidant enzyme activity, but the high degree of correlation between transcriptions of the different stress genes indicates that they are induced through similar mechanisms, e.g., the MRE/MTF-1 pathway (Chung et al., 2005). The present findings indicate that the response in brown trout tissues to uptake and exposure to Cd and Zn is manifested by increased synthesis of MT transcripts and proteins in liver and kidney, but not in gills. Significant elevation in the transcription of antioxidant enzymes in response to metal exposure, indicate that the levels of Cd and/or Zn in the Naustebekken River may be a potential hazard to the native Naustebekken trout. This is in line with previous findings in these trout populations (Hansen et al., 2006a,b), and the metal environment in the Naustebekken River could represent a basis for an acclimation to elevated concentrations for brown trout. Induction of antioxidant stress-related proteins appear to be important in metal acclimation processes, but to better understand the underlying biological mechanisms it is important to study both mRNA transcript levels as well as enzyme activity. Increased understanding of these mechanisms will increase the potential for using antioxidant systems as tools and biomarkers in environmental risk assessment. Acknowledgements The authors thank Liv Søfteland and Anne Mortensen for technical help with the gene expression analysis, Syverin Lierhagen for doing the metal analysis, and finally the Norwegian Research Council for financing this project (Project No. 147474/720). References Arukwe, A., in press. Toxicological housekeeping genes: Do they really keep the house? Environ. Sci. Technol., in press. doi:10.1021/ es0615223. Bagnyukova, T.V., Vasylkiv, O.Y., Storey, K.B., Lushchak, V.I., 2005a. Catalase inhibition by amino triazole induces oxidative stress in goldfish brain. Brain Res. 1052, 180–186. Bagnyukova, T.V., Storey, K.B., Lushchak, V.I., 2005b. Adaptive response of antioxidant enzymes to catalase inhibition by aminotriazole in goldfish liver and kidney. Comp. Biochem. Physiol. 142B, 335–341. Bagnyukova, T.V., Chahrak, O.I., Lushchak, V.I., 2006. Coordinated response of goldfish antioxidant defenses to environmental stressors. Aquat. Toxicol. 78, 325–331. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Chapman, G.A., Stevens, D.G., 1978. Acutely lethal levels of cadmium, copper, and zinc to adult male coho salmon and steelhead. Trans. Am. Fish. Soc. 107, 837–840. Cho, Y.S., Choi, B.N., Kim, K.H., Kim, S.K., Kim, D.S., Bang, I.C., Nam, Y.K., 2006. Differential expression of Cu/Zn superoxide
dismutase mRNA during exposures to heavy metals in rockbream (Oplegnathus fasciatus). Aquaculture 253, 667–679. Chung, M.J., Walker, P.A., Brown, R.W., Hogstrand, C., 2005. ZINCmediated gene expression offers protection against H2O2-induced cytotoxicity. Toxicol. Appl. Pharmacol. 205, 225–236. Feeney, G.P., Zheng, D., Kille, P., Hogstrand, C., 2005. The phylogeny of teleost ZIP and ZnT zinc transporters and their tissue specific expression and response to zinc in zebrafish. Biochim. Biophys. Acta 1732, 88–95. Garmo, O.A., Royset, O., Steinnes, E., Flaten, T.P., 2003. Performance study of diffusive gradients in thin films for 55 elements. Anal. Chem. 75, 3573–3580. Hansen, B.H., Romma, S., Garmo, O.A., Olsvik, P.A., Andersen, R.A., 2006a. Antioxidative stress proteins and their gene expression in brown trout (Salmo trutta) from three rivers with different heavy metal levels. Comp. Biochem. Physiol C 143, 263–274. Hansen, B.H., Romma, S., Søfteland, L.I.R., Olsvik, P.A., Andersen, R.A., 2006b. Induction and activity of oxidative stress-related proteins during waterborne Cu-exposure in brown trout (Salmo trutta). Chemosphere. 65, 1707–1714. Hutton, M., 1983. Sources of cadmium in the environment. Ecotoxicol. Environ. Saf. 7, 9–24. Johansson, L.H., Hakan Borg, L.A., 1988. A spectrophotometric method for determination of catalase activity in small tissue samples. Anal. Biochem. 174, 331–336. Kagi, J.H.R., Schaffer, A., 1988. Biochemistry of metallothionein. Biochemistry 27, 8509–8515. Klein, D., Bartsch, R., Summer, K.H., 1990. Quantitation of Cucontaining metallothionein by a Cd-saturation method. Anal. Biochem. 189, 35–39. Kling, P.G., Olsson, P.-E., 2000. Involvement of differential metallothionein expression in free radical sensitivity of RTG-2 and CHSE-214 cells. Free Radical. Biol. Med. 28, 1628–1637. Kono, Y., Fridovich, I., 1982. Superoxide radical inhibits catalase. J. Biol. Chem. 257, 5751–5754. Luider, A.R., Crusius, J., Playle, R.C., Curtis, P.J., 2004. Influence of natural organic matter source on copper speciation as demonstrated by Cu binding in fish gills, by ion selective electrode and by DGT gel sampler. Environ. Sci. Technol. 38, 2865–2872. Mayer, G.D., Leach, A., Kling, P., Olsson, P.-E., Hogstrand, C., 2003. Activation of the rainbow trout metallothionein-A promoter by silver and zinc. Comp. Biochem. Physiol. B 134, 181–188. McGeer, J.C., Szebedinszky, C., McDonald, D.G., Wood, C.M., 2000a. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout. 1: iono-regulatory disturbance and metabolic costs. Aquat. Toxicol. 50, 231–243. McGeer, J.C., Szebedinszky, C., Gordon McDonald, D., Wood, C.M., 2000b. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout 2: tissue specific metal accumulation. Aquat. Toxicol. 50, 245–256. Michiels, C., Raes, M., Toussaint, O., Remacle, J., 1994. Importance of SE-glutathione peroxidase, catalase, and CU/ZN–SOD for cell survival against oxidative stress. Free Radical Biol. Med. 17, 235–248. Misra, R., Crance, K.A., Bare, R.M., Waalkes, M.P., 1997. Lack of correlation between the inducibility of metallothionein mRNA and metallothionein protein in cadmium-exposed rodents. Toxicology 117, 99–109. Norey, C.G., Cryer, A., Kay, J., 1990. Induction of metallothionein gene expression by cadmium and the retention of the toxic metal in the tissues of rainbow trout (Salmo gairdneri). Comp. Biochem. Physiol. C 97, 215–220. Olsson, P.-E., Kille, P., 1997. Functional comparison of the metalregulated transcriptional control regions of metallothionein genes from cadmium-sensitive and tolerant fish species. Biochim. Biophys. Acta 1350, 325–334. Olsvik, P.A., Gundersen, P., Andersen, R.A., Zachariassen, K.E., 2000. Metal accumulation and metallothionein in two populations of brown
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249 trout, Salmo trutta, exposed to different natural water environments during a run-off episode. Aquat. Toxicol. 50, 301–316. Olsvik, P.A., Hindar, K., Zachariassen, K.E., Andersen, R.A., 2001. Brown trout (Salmo trutta) metallothioneins as biomarkers for metal exposure in two Norwegian rivers. Biomarkers 6, 274–288. Pruell, R.J., Engelhardt, F.R., 1980. Liver cadmium uptake, catalase inhibition and cadmium thionein production in the killifish (Fundulus heteroclitus) induced by experimental cadmium exposure. Marine Environ. Res. 3, 101–111. Romeo, M., Bennani, N., Gnassia-Barelli, M., Lafaurie, M., Girard, J.P., 2000. Cadmium and copper display different responses towards oxidative stress in the kidney of the sea bass Dicentrarchus labrax. Aquat. Toxicol. 48, 185–194. Røyset, O., Rosseland, B.O., Kristensen, T., Kroglund, F., Garmo, Ø.A., Steinnes, E., 2005. Diffusive gradients in thin films sampler predicts stress in brown trout (Salmo trutta) L. exposed to aluminium in acid fresh waters. Environ. Sci. Technol. 39, 1167–1174. Shukla, G.S., Hussain, T., Chandra, S.V., 1987. Possible role of regional superoxide dismutase activity and lipid peroxide levels in cadmium neurotoxicity: in vivo and in vitro studies in growing rats. Life Sci. 41, 2215–2221. Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radical Biol. Med. 18, 321–336. Thiele, D.J., 1992. Metal-regulated transcription in eukaryotes. Nucleic Acids Res. 20, 1183–1191.
2249
Thornalley, P.J., Vasak, M., 1985. Possible role for metallothionein in protection against radiation-induced oxidative stress. Kinetics and mechanism of its reaction with superoxide and hydroxyl radicals. Biochim. Biophys. Acta 827, 36–44. Tort, L., Kargacin, B., Torres, P., Giralt, M., Hidalgo, J., 1996. The effect of cadmium exposure and stress on plasma cortisol, metallothionein levels and oxidative status in rainbow trout (Oncorhynchus mykiss) liver. Comp. Biochem. Physiol. C 114, 29–34. Vallee, B.L., 1995. The function of metallothionein. Neurochem. Int. 27, 23–33. van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57–149. Vandesompele, J., Preter, K.D., Pattyn, F., Poppe, B., Roy, N.V., Paepe,, A.D., S., F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, (Research0034.0031–0034.0011). Verbost, P.M., Flik, G., Lock, R.A., Wendelaar Bonga, S.E., 1987. Cadmium inhibition of Ca2+ uptake in rainbow trout gills. Am. J. Physiol. 253, R216–R221. Wang, Y., Fang, J., Leonard, S.S., Krishna Rao, K.M., 2004. Cadmium inhibits the electron transfer chain and induces reactive oxygen species. Free Radical Biol. Med. 36, 1434–1443.
Induction and activity of oxidative stress-related proteins during waterborne Cd/Zn-exposure in brown trout (Salmo trutta) Bjørn Henrik Hansen
a,*
, Svein Rømma a, Øyvind Aaberg Garmo b, Sindre Andre Pedersen a, Pa˚l Asgeir Olsvik c, Rolf Arvid Andersen a
a b
Norwegian University of Science and Technology (NTNU), Department of Biology, Høgskoleringen 5, N-7491 Trondheim, Norway Norwegian University of Science and Technology (NTNU), Department of Chemistry, Høgskoleringen 5, N-7491 Trondheim, Norway c National Institute of Nutrition and Seafood Research (NIFES), Nordnes, N-5817 Bergen, Norway Received 24 May 2006; received in revised form 6 December 2006; accepted 7 December 2006 Available online 5 February 2007
Abstract We studied how transcript levels of metallothionein (MT), Cu/Zn–superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX) and glutathione reductase (GR) as well as functional protein levels of MT, SOD and CAT in brown trout tissues changed during a 15-days waterborne exposure to Cd and Zn. Trout from a river with low levels of metals (the Stribekken River) was transferred to a river with high levels of Cd and Zn (the Naustebekken River) and exposed up to 15 days. The aim of this transfer experiment was to investigate how exposure to Cd and Zn induced transcription and activities of central antioxidant enzymes and proteins in an environmental setting. Significant uptake of both Cd and Zn was observed in gills during the 15 days exposure, and Cd levels was found to correlate significantly with transcript levels of MT-A, SOD, GPx and GR. Gill concentrations of Zn did not correlate significantly with the transcript levels of the stress genes studied, but Zn might have triggered transcription of proteins which dealt with subsequent accumulation of Cd. SOD and CAT activities increased in gills after transfer, but MT protein levels decreased. In liver, SOD activity and MT protein levels increased, while in kidney only MT protein concentrations were elevated after transfer. There was a general lack of consistency between mRNA transcription and enzyme activities, indicating that these proteins and enzymes are not solely under transcriptional control. 2007 Elsevier Ltd. All rights reserved. Keywords: Cadmium; Zinc; Gene expression; Mining; Fish
1. Introduction Cadmium (Cd) and zinc (Zn) are metals often found together in the environment because of similar properties (Hutton, 1983), but biologically they have diverging properties. Cd is regarded as non-essential and toxic, and can disturb the ionoregulatory system in aquatic organisms (Verbost et al., 1987; McGeer et al., 2000a), as well as
* Corresponding author. Address: SINTEF – Materials and Chemistry, Marine Environmental Technology, 7465 Trondheim, Norway. Tel.: +47 98283893. E-mail address: [email protected] (B. Henrik Hansen).
0045-6535/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.chemosphere.2006.12.048
enhance oxidative stress by alteration of the glutathione (GSH) turnover (Tort et al., 1996), inhibition of antioxidant enzymes (Pruell and Engelhardt, 1980) and enhancing the leakage of mitochondrial reactive oxygen species (ROS) (Wang et al., 2004). Zn, on the other hand, is essential as a cofactor for many enzymes (e.g., Cu/Zn–SOD) and also serves an important function in transcription of many genes involved in cellular protection against ROS (Chung et al., 2005). At high levels, Zn can also cause osmoregulatory disturbances in aquatic organisms (McGeer et al., 2000a), and may also cause cytotoxic effects in the presence of hydrogen peroxide (H2O2) (Chung et al., 2005). In the present paper, we will focus on metal-mediated oxidative stress responses.
2242
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
The metal-mediated production of ROS adds to the natural endogenous production by mitochondria. ROS generated from both exogenous and endogenous sources are detoxified by a set of antioxidant enzymes, which subsequently protect proteins, lipids and nucleic acids against damage. Superoxide dismutase (SOD) catalyzes the breakdown of superoxide anion ð O 2 Þ, while catalase (CAT) and glutathione peroxidase (GPx) handle hydrogen peroxide (H2O2). Reduced glutathione (GSH) is also an important antioxidant, which is readily oxidized by ROS to oxidized glutathione (GSSG), but can also bind metals that might induce oxidative stress. The reduction of GSSG to yield GSH is catalyzed by glutathione reductase (GR) (Stohs and Bagchi, 1995). Antioxidant systems have been proposed for the use as biomarkers for exposure to ROS-mediating contaminants, like some metals, but their potential as tools in environmental risk assessment (ERA) have been questioned (van der Oost et al., 2003). Salmonids are among the most metal sensitive teleost families (Olsson and Kille, 1997). Reported LC50-values (96 h) for Zn are below 1 mg/l, while LC50-values (three weeks) for Cd can be as low as 3.7 lg/l (Chapman and Stevens, 1978). Chronic exposures to low levels of Cd and Zn have been studied in relation to metallothionein (MT), which is a low molecular weight protein that serves a protective role by binding and immobilizing potentially toxic metals (Kagi and Schaffer, 1988). MT also contributes in the homeostasis of essential metals like Zn and Cu (Vallee, 1995), as well as functioning as a strong antioxidant (Thornalley and Vasak, 1985). MT, however, increases the biological half-life of Cd because of retention of MT-bound Cd in kidney (Norey et al., 1990). Because of the relatively clear relationships between MT induction and metal exposure, MT have been proposed as a suitable biomarker for exposure to metals like Cd, Zn and Cu (Olsvik et al., 2001; van der Oost et al., 2003). The Stribekken and Naustebekken rivers in the Røros region in central Norway are located in the same area, but have different levels of Cd and Zn. In a previous paper (Hansen et al., 2006a), we described baseline levels of antioxidants in brown trout tissues from these rivers. The Stribekken River was used as a local reference river because of its low levels of metals in general. The Naustebekken River had elevated levels of Cd and Zn, and we showed that the levels of Cd and Zn in brown trout gills corresponded well with the concentrations in the river. The levels of MT in gills, liver and kidney were elevated in trout from the Naustebekken River compared to the Stribekken River. In addition, we found that levels of antioxidants (transcriptional levels and enzyme activities) generally were higher in gills, liver and kidney of trout from the Naustebekken River compared to the Stribekken River (Hansen et al., 2006a). By transferring trout from the Stribekken River to the Naustebekken River, we were able to test if the metal levels in the Naustebekken River could impose oxidative stress in brown trout tissues, and to study transcriptional induction of well-known antioxidants as a
function of time. There is a lack of knowledge on relationships between mRNA transcript levels and the functional activity of proteins involved in metal handling and detoxification. Very few, if any, have studied gene expression (mRNA transcripts and protein levels simultaneously) in response to metal exposure in environmentally relevant situations. Antioxidant enzymes also seem to function in concert (Michiels et al., 1994), and the present paper gives information about both relationships between metals and antioxidant systems as well as possible interplays between different antioxidants. 2. Materials and methods 2.1. Experimental design and sampling Brown trout (22.8 ± 11.4 g, 14.0 ± 2.5 cm, n = 36) from the Stribekken River were caught by electric fishing or by basket traps and kept encaged in their native river for 4–7 days prior to transfer to the Naustebekken River. On the day of transfer, 6 fish were sampled as control group, and the remaining 30 fish were transferred from the Stribekken River to the Naustebekken River. The exposures of the fish were done in cages placed directly in the river. On day 1, 2, 4, 7, and 15 of the exposure 6 fish were sampled for analysis. The fish were killed by a blow to the head, and subsequently weighed and measured. The second right gill arch with filament was excised and placed in an acid-washed tube for metal analysis. Tissue samples (80– 100 mg) from gills, liver and kidney were homogenized in 800 ll of Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) for gene expression analysis. Remaining tissue from each organ was distributed to separate cryo tubes for protein and enzyme analyses. All samples were immediately flash frozen in liquid nitrogen and brought to the lab for storage at 80 C. The fish were immature, and they were therefore not selected or pooled with respect to gender. During the exposure in the Naustebekken River the fish were not actively fed, but some food might have seeped into the cages. There were no significant differences (p < 0.05) in weight, length and condition factors between the groups. The responses seen on biochemical parameters were therefore attributed to increased metal exposure levels after transfer of the fish from their native habitat in the Stribekken River to the contaminated Naustebekken River. Biological parameters are summarized in Table 1. The low number of fish used in this experiment might not be sufficient to reveal subtle distinctions in fish response. Brown trout were hard to catch in the Stribekken River because of the low population density, but it was the only river in the area which could be used as a reference. 2.2. Water chemistry Water samples were taken from the Stribekken River prior to fish transfer and from the Naustebekken River
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
2243
Table 1 Biological parameters and gill metal concentrations of trout from Stribekken exposed in the River Naustebekken
Control 1 day 2 days 4 days 7 days 15 days
N
Weight (g)
Length (cm)
Cond. fact.
Cd (lg/g)
Cu (lg/g)
Zn (lg/g)
6 6 6 6 6 6
22.8 ± 11.4 23.7 ± 4.5 16.3 ± 9.4 26.3 ± 22.5 17.3 ± 10.8 21.3 ± 12.1
14.0 ± 2.5 13.9 ± 0.8 12.5 ± 1.8 13.6 ± 3.5 12.6 ± 2.8 13.3 ± 2.8
0.78 ± 0.06 0.87 ± 0.02 0.75 ± 0.13 0.83 ± 0.09 0.75 ± 0.08 0.82 ± 0.10
0.35 ± 0.14 0.61 ± 0.22 0.54 ± 0.12 0.84 ± 0.21* 0.80 ± 0.17* 1.18 ± 0.53*
1.75 ± 1.48 2.63 ± 0.91 2.21 ± 0.56 2.57 ± 0.78 1.49 ± 0.46 2.72 ± 1.08
292.8 ± 114.9 634.5 ± 139.3* 636.4 ± 85.6* 651.6 ± 122.9* 414.3 ± 108.2 480.2 ± 80.1*
Condition factor was calculated as weight (g)/length3 (cm) · 100. Values are expressed as means ± standard deviation. Significant differences (p < 0.05) between control group and exposed groups are shown as *.
after transfer. They were acidified with nitric acid (HNO3, 14.5 M) to a final concentration of 0.1 M before metal analysis by Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). Repeated analyses of conductivity, temperature, alkalinity and pH were conducted throughout the experimental period. Sampling with the technique of diffusive gradients in thin films (DGT) was performed in the Stribekken River prior to transfer and in the Naustebekken River during the experiment. DGT sampling was included because it provides a time-averaged concentration, in contrast to traditional grab-sampling, and because the DGT-labile fraction of metal is more closely related to bioavailable waterborne metal than the total concentration (Luider et al., 2004; Røyset et al., 2005). The procedure applied for DGT sampling and analysis is described elsewhere (Garmo et al., 2003; Hansen et al., 2006a). 2.3. Metal analysis The gill samples for metal analysis were transferred to preweighed acid washed 15 ml polypropylene tubes ˚ storp, Sweden), in which they were (AB Cerbo-Hertila, A lyophilized, reweighed and subsequently digested in HNO3 (800 ll, 14.5 M) and H2O2 (400 ll, 30%, pro analysis, Merck) for 1 h at 100C. Thereafter, the gill samples were diluted with 13 ml of MilliQ water and analyzed with ICP-MS. Certified reference material (Bovine liver 1577, National Institute of Standards and Technology, Gaithersburg, MD, USA) was used to assess the accuracy of the analysis. For every tenth sample a matrix-modified standard sample was measured to control for drift in the ICP-MS system. The ICP-MS analyses were performed at the core facility at the Department of Chemistry, NTNU.
2.4. Analyses on stress gene transcript levels Samples collected and homogenized in Trizol Reagent were thawed on ice, and total RNA was purified according to the manufacturer’s instructions (Invitrogen). Samples were treated with DNAase I (DNAfree kit, Ambion, Austin, TX, USA) to remove potentially contaminating DNA. High RNA-quality was assured by measurements of the absorbance at 260 and 280 nm, and by checking the integrity of the 18S and 28S rRNA bands by electrophoresis on 1.5% formaldehyde–agarose gels. cDNA was made from purified RNA-samples with a cDNA synthesis kit from Bio-Rad Laboratories (Hercules, CA, USA) according to the manufacturer’s instructions. From one sample from each tissue a serial dilution of total RNA was converted to cDNA in triplicates. These samples were analyzed for all genes, and a dilution curve was plotted to evaluate the PCR-efficiency and to create a standard curve for measurements of gene transcription in samples. From all the samples duplicates of cDNA were produced with an RNA input of 250 ng. Primers used in the real-time PCR system and their accession numbers of origin are given in Table 2. PCRproducts were cloned, sequenced and BLASTed to ensure that the correct target mRNA sequences were quantified. Real-time PCR was performed with a Stratagene Mx3000P Real-Time PCR System (La Jolla, CA, USA). The method has been described previously (Hansen et al., 2006a). The dilution curves of cDNA were used to verify a good PCR-efficiency (1.8–2.2), and to calculate expression of target gene. Normalization of gene expression data was not possible since, according to the Genorm software (Vandesompele et al., 2002), none of the two most common housekeeping genes; b-actin and elongation factor 1AA
Table 2 Accession numbers of specific primer pairs for MT-A, SOD, CAT, GPx, GR, EF1AA and b-actin genes from salmonids used in our studies Gene name
Accession no.
Prod. size (bp)
Forward primer (5 0 –3 0 )
Reverse primer (5 0 –3 0 )
MT-A SOD CAT GPx GR EF1AA b-Actin
X97274 BG936553 BE669040 BG934453 BG934480 AF321836 BG933897
101 140 79 140 61 57 91
CCTTGTGAATGCTCCAAAACTG CCACGTCCATGCCTTTGG GAGGGCAACTGGGACCTTACT GATTCGTTCCAAACTTCCTGCTA CCAGTGATGGCTTTTTTGAACTT CCCCTCCAGGACGTTTACAAA CCAAAGCCAACAGGGAGAAG
CAGTCGCAGCAACTTGCTTTC TCAGCTGCTGCAGTCACGTT GGACGAAGGACGGGAACAG GCTCCCAGAACAGCCTGTTG CCGGCCCCCACTATGAC CACACGGCCCACAGGTACA AGGGACAACACTGCCTGGAT
2244
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
were sufficiently stable. It is extremely important to verify the stability of a house-keeping gene, in order to generate reliable data on stress gene transcript levels (Arukwe, in press). Because of the lack of stability in the two studied house-keeping genes, we therefore used a standard curve method and normalize against total RNA input to calculate gene expression. Using a sample from the material to create a standard curve was considered more reliable than using normalization towards a non-stable housekeeping gene. Gene expression was calculated in terms of fold induction compared to the control group. 2.5. Protein and enzyme analyses Tissue samples were homogenized in ice-cold deoxygenated 1:9 w/v 20 mM Tris–HCl buffer (pH 7.4) and centrifuged at 10 000g for 10 min. Aliquots of 100 ll were used for the MT-quantification and enzyme activity measurements. For MT quantification, the tetrathiomolybdate assay was used (Klein et al., 1990; Olsvik et al., 2000). The peroxidative activity of CAT was measured using a microtiter plate assay (Johansson and Hakan Borg, 1988) as described earlier (Hansen et al., 2006a). Total protein concentrations in samples were measured by the Bradford assay (Bradford, 1976). SOD activity was analyzed by the use of a commercial colorimetric assay kit according to the manufacturer’s instructions (Kamiya Biomedical Company, Seattle, WA, USA). 2.6. Statistical analysis One-way ANOVA was used to check for differences between the control and the exposed groups. To identify significant differences obtained by one-way ANOVA, pairwise comparisons between experimental groups and the control group were performed by Dunnet’s post hoc method, with a family-wise error of 0.05. Associations between parameters were studied by the use of Spearman correlation. Statistical analysis was performed by the use of SPSS 11.0 software (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Water chemistry Metal concentrations and limnochemical parameters in water samples from the Stribekken and Naustebekken Rivers are presented in Table 3. The two rivers were similar in terms of pH and temperature. The Ca concentration, alkalinity and conductivity were slightly higher in the Naustebekken River compared to the Stribekken River. Cd, Cu and Zn concentrations were 20, 11 and 31 times higher, respectively, in the Naustebekken River at the time of transfer. The labile or bioavailable fractions of Cd and Zn were equal to the total concentrations in the rivers, whereas for Cu only about 10% of the total concentration was in the labile fraction in the Naustebekken River.
Table 3 Metal concentrations and limnochemical data from the Stribekken and Naustebekken Rivers measured before transfer from the Stribekken River and during the exposure of Stribekken trout in the Naustebekken River
pH Temperature (C) Conductivity (lS/cm) Alkalinity (lEq/l) Cd total (ng/l) Cd labile (ng/l) Cu total (lg/l) Cu labile (lg/l) Zn total (lg/l) Zn labile (lg/l) Ca total (mg/l)
Stribekken River
Naustebekken River
7.1 ± 0.4 (4) 13.8 ± 3.6 (5) 18.8 ± 0.4 (5) 94.0 ± 12.2 (3) 7.3 ± 5.1 (5) 5.6 (1) 0.66 ± 0.17 (5) 0.1 (1) 2.24 ± 0.83 (5) 1.5 (1) 2.1 ± 0.1 (5)
7.0 ± 0.3 (7) 13.0 ± 1.9 (6) 25.1 ± 1.8 (7) 155.5 ± 25.7 (4) 147.3 ± 30.0 (8) 172.7 (1) 7.43 ± 0.90 (8) 0.75 (1) 70.0 ± 10.4 (8) 95.8 (1) 2.8 ± 0.1 (8)
Labile metals were measured by the use of diffusive gradients in thin films (DGT). One DGT was kept in each river for 5–8 days. N is given in parentheses.
3.2. Gill uptake of Cd, Cu and Zn Gill concentrations of Cd, Cu and Zn are shown in Table 1. Significant uptake was observed for Cd and Zn in the trouts during the exposure in the Naustebekken River (p < 0.05). Cd concentrations in gills increased slowly throughout the exposure period. Zn concentrations peaked at day 1 of the exposure, were stable until day 4, and then dropped. After 15 days the level of Zn appeared to stabilize at a somewhat higher level than in the control. Gill-accumulation of Cu was not observed. 3.3. Stress gene expression and proteins Transcriptional levels of the analyzed stress genes are shown in Fig. 1a (gills), 1b (liver) and 1c (kidney). The data are expressed as fold induction compared to the control group sampled before transfer to the Naustebekken River. Transcription of MT-A was induced in gills, liver and kidney of the exposed group. The highest level of induction was found in liver, but the fastest response occurred in gills, where significant increase compared to the control group was observed already after one day of exposure. For SOD transcript levels, a significant increase was only seen in gills, and this was consistent from day four until the end of the experiment. Significant increases in CAT transcript levels were only observed in the liver after one and two days of exposure. In gills, which was the only organ to be analyzed for metals, significant correlations were found between Cd concentrations and transcript levels of MT-A (RSp = 0.521, p < 0.001, Fig. 2a), SOD (RSp = 0.505, p < 0.05), GPx (RSp = 0.575, p < 0.001) and GR (RSp = 0.699, p < 0.001, Fig. 2b). Zn and Cu concentrations were not found to correlate significantly with the transcript levels of any of the stress genes. We found significant correlations between gene transcripts of different stress genes, and some of them seemed to be expressed in a similar manner. In gills, we
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
2245
Fig. 1. Transcriptional levels of MT-A, SOD, CAT, GPx and GR in gills (a), liver (b), and kidney (c) as a function of time after transfer of Stribekken trout to the Naustebekken River (days). Significant differences (p < 0.05) between control group and exposed groups are shown as *. n = 6 in every group. Values are given as means ± standard deviations.
Fig. 2. Relationships between gill Cd concentrations and transcriptional levels of MT-A (a) and GR (b) for all trout used in the experiment (n = 36).
observed significant correlations between MT-A and GPx (RSp = 0.585, p < 0.001) and GR (RSp = 0.618, p < 0.001). SOD transcript levels also correlated significantly with GPx (RSp = 0.632, p < 0.001) and GR (RSp = 0.789, p < 0.001), and finally a significant correlation was found between GPx and GR (RSp = 0.695, p < 0.001). CAT did not seem to follow the same transcription pattern as the other genes in gills, but we did find significant correlations between CAT and SOD in liver (RSp = 0.765, p < 0.001) and in kidney (RSp = 0.713, p < 0.001). In liver and kidney elevated levels of MT protein were observed at day 7 and 15 of the exposure (Fig. 3). MT-A transcript levels correlated significantly with MT protein
concentrations in liver (RSp = 0.531, p < 0.001) and kidney (RSp = 0.547, p < 0.001), but this was not observed in gills. MT protein levels were actually lower in gills after two days of exposure (Fig. 3). Neither did we find a significant correlation between gene transcription and enzyme activities of SOD and CAT. We did, however, observe an increase in SOD activity in gills and liver at day four (Fig. 4a) and day two (Fig. 4b), respectively, but in both tissues enzyme activity levels returned to basal levels thereafter. For CAT enzyme activity, an increase was found on day 15 in gills, after a non-significant drop on day two (p < 0.05, Fig. 4a). No responses on CAT activity were observed in liver and kidney (data not shown).
2246
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
Fig. 3. Concentrations of MT protein (lg MT/g tissue fresh weight) in gills, liver and kidney during the exposure. Significant differences (p < 0.05) between control group and exposed groups are shown as *. n = 6 in every group. Values are given as means ± standard deviations.
4. Discussion Accumulation of Cd and Zn was observed in the brown trout gills after transfer, but these two metals seemed to follow two different uptake patterns. Cd levels appeared to increase steadily throughout the exposure period without reaching a peak. Studies on rainbow trout exposed to Cd (3 lg/l) indicated that the levels of Cd in gills stabilized at day 16 of a 65 day exposure (McGeer et al., 2000b). Previous studies (Hansen et al., 2006a) have shown that the Cd levels in the gills of the native Naustebekken trout were over 30 times higher than in the Stribekken trout gills, so an increase in Cd levels in gills of the transferred Stribekken trout was expected. Gill Zn concentrations reached a peak already on day two after transfer, and thereafter the concentration was steady until a decrease was observed at the end of the experiment. The drop in Zn levels after four days may have been caused by a redistribution of Zn to the bloodstream possibly by a Zn transporter (Feeney et al., 2005), and/or it can be a result of reduction in Zn uptake. The concentration of Zn in the Stribekken River was low, and active uptake of this essential metal in brown trout in their native river is assumed. Thus, the strong increase in gill Zn-levels seen at day one after trans-
fer probably reflected that these active uptake mechanisms still functioned as normal. A Zn concentration of 600 lg/g tissue (dry weight) appeared to be the critical level for which active uptake was reduced, and the levels decreased to about 450 lg Zn/g tissue. In another study, gill levels of Zn in the Stribekken trout were compared to both native Naustebekken trout and trout from the Cu-contaminated Rugla River (Hansen et al., 2006a). The Cu-exposed Rugla trout was found to have the same levels of Zn as the Stribekken trout, but the Naustebekken trout had concentrations well over 1000 lg Zn/g tissue dry weight. Zn levels in gills did not correlate significantly with the transcript levels of the studied stress genes. Zn has a wellknown protective effect against ROS, but high concentrations of Zn can also enhance oxidative stress (Chung et al., 2005). It has been proposed that the protective mechanism involve Zn-induced transcription of genes encoding proteins with key roles in antioxidant defense, such as MT, SOD, CAT and GPx (Kling and Olsson, 2000; Chung et al., 2005). Zn-mediated gene transcription has a protective effect against H2O2 toxicity as long as Zn is administered prior to H2O2 exposure. The mechanism appears to be complicated, however, since a simultaneous exposure to both Zn and H2O2 was found to be more cytotoxic than exposure to H2O2 administered alone. Metal responsive element (MRE) sequences, which are triggered by the Zn dependent metal transcription factor-1 (MTF-1), have been found upstream for as many as 28 antioxidant genes in pufferfish (Fugu rubripes) (Chung et al., 2005), so Zn may have a vital function in the induction of these genes. The lack of correlations between gill Zn concentrations and stress gene transcript levels in our data does not necessarily imply lack of a cause–effect relationship. Some time lag must be expected between uptake of metals and the subsequent transcription of stress gene mRNA. Gill Cd concentrations; however, correlated strongly with transcript levels of all stress genes except CAT in gills. Induction of MT through the MRE/MTF-1 pathway may occur indirectly by a displacement of Zn with Cd on MT or on other Zn–proteins, hence providing more free Zn ions for binding to MTF-1. The increase in gene transcription of MT and antioxidant enzymes seen in this work may be induced
Fig. 4. SOD (in U SOD/mg protein) and CAT (in lmol/min/g tissue fresh weight) activities in gills (a) and liver (b) during the exposure. Significant differences (p < 0.05) between control group and exposed groups are shown as *. n = 6 in every group. Values are given as means ± standard deviations.
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
by the fast Zn accumulation and offer protection against the toxic effects of the more slowly accumulating Cd. Direct induction of MT through the MRE/MTF-1 pathway has been shown for silver (Ag) exposure (Mayer et al., 2003). It can therefore not be ruled out that the Cd taken up by gills of the trout directly induced stress genes through the MRE/MTF-1 pathway. This hypothesis may be strengthened by the strong correlations found between Cd concentrations and stress gene transcript levels in our data. Correlations between mRNA transcript levels and functional protein levels can often not be demonstrated (Misra et al., 1997; Hansen et al., 2006b), because of post-transcriptional modifications. This is a challenge particularly for the elucidation of mechanisms involved in metal exposures, since some metals are essential cofactors in enzymes dealing with metal-mediated oxidative stress, while others are both enhancing oxidative stress directly and inhibiting antioxidant enzymes by replacement of essential metal ions. Both SOD and CAT enzyme activities have been shown to be altered by exposure to metals (Pruell and Engelhardt, 1980; Shukla et al., 1987), but at the same time these enzymes are essential in dealing with oxidative stress both produced naturally or indirectly through the actions of transition metals, like Cu and Fe (Stohs and Bagchi, 1995). The use of antioxidant enzymes as biomarkers in environmental risk assessment is therefore complicated, and their usefulness as biomarkers has been questioned (van der Oost et al., 2003). We found no induction of CAT mRNA in gills, but the enzyme activity measurements showed that there was an initial non-significant decrease at day two, with a subsequent increase to a level above control levels at day 15 (p < 0.05). The initial decrease can be attributed to an inhibition of the enzyme as a function of Cd-mediated oxidative stress. Cd causes alterations in mitochondria facilitating release of O 2 (Wang et al., 2004), which has been shown to inhibit CAT activity (Kono and Fridovich, 1982). CAT activity has been reported by Romeo et al. (2000) to be reduced by Cd exposure in sea bass (Dicentrarchus labrax). A reactivation of CAT in the trout gills was not a result of increased CAT mRNA transcription, since no increase in CAT transcript levels were observed. Neither for SOD did we observe a clear relationship between gene transcription and enzyme activity. Gill SOD enzyme activity peaked at day four, with the activity reaching control levels thereafter, but the gene transcription analysis revealed higher levels of SOD transcripts than control levels from day four and until the end of the experiment at day 15. The decrease in SOD activity may be caused by metal-mediated inhibition, or it may reflect a decrease in the metal-mediated oxidative stress in gill tissue. MT is mainly regulated at the level of transcription, hence there are no known post-transcriptional modifications (Thiele, 1992). This seems, however, only partly verified in our work. Synthesis of MT mRNA was observed in liver and kidney, as well as in gills, but gills seemed to be
2247
less able to synthesize MT proteins. While there was a significant correlation between MT mRNA and protein levels in liver and kidney, no such relationship was found in gills. The reason for this can be (i) inhibition of MT protein synthesis and/or (ii) oxidation of MT molecules after synthesis. The tetrathiomolybdate assay used to measure MT concentrations in this study, only quantify MT that binds metals (Cd, Cu and Zn), hence this assay does not quantify oxidized MT molecules (Klein et al., 1990). Thus, if MT was synthesized and subsequently oxidized through metal-mediated ROS, the MT concentrations measured would be underestimated. If oxidation of MT molecules occurred, it can be hypothesized that the most important function of MT in gills is to protect against ROS rather than to immobilize metals. We have shown that native trout from the Naustebekken River had significantly higher gill concentrations of MT protein (Hansen et al., 2006a). It is therefore possible that the increase in gill MT protein levels in the Stribekken trout exposed in Naustebekken River is a process to slow to be detected in the present 15 days experiment. The Naustebekken trout may have acquired these high levels as a response to the continuous metal stress in their native river. The increase in MT gene transcripts and protein concentrations observed in liver and kidney after 7 and 15 days, probably reflects the metal redistribution from gills to these tissues (McGeer et al., 2000b). Thus, liver and kidney MT concentrations are good indicators of metal exposure. SOD enzyme activity in liver showed a similar pattern of response as seen in gills; an increased activity during the first few days with a subsequent decrease to control levels. Previous observations (Hansen et al., 2006a) showed significantly higher SOD activity in liver from the Naustebekken trout than in Stribekken trout, but in the present exposure experiment SOD activity returned to basal levels after 15 days. In a study by Cho et al. (2006), an increase in SOD mRNA levels were more apparent in liver than in gills and kidneys from rockbeam (Oplegnathus fasciatus) exposed to Cd, Cu and Zn. This is in contrast to our findings, where we only found an increase in SOD mRNA levels in gills. The use of intraperitoneal injections of metals in the study by Cho et al. might explain the lack of consistency between their results and ours. Cho et al. also demonstrated that Cd was a more potent SOD mRNA inducer than Cu and Zn, which is line with our findings that only Cd concentrations correlated significantly with SOD mRNA levels (p < 0.05). Antioxidant enzymes have been shown to work in a cooperative or synergistic way to protect against oxidative stress, and optimal protection is only achieved at an appropriate balance between them (Michiels et al., 1994; Bagnyukova et al., 2006). Bagnyukova et al. (2005a,b) showed that catalase inhibition during oxidative stress in goldfish (Carassius auratus) resulted in compensatory changes in the activities of glutathione-dependent antioxidant enzymes. Similarly, a reduction in CAT activity in gills was found simultaneously with an increase in SOD activity
2248
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249
the first days after transfer. The underlying basis for increased antioxidant enzyme activities is, however, not clear. Our data does not support a direct transcriptional control of antioxidant enzyme activity, but the high degree of correlation between transcriptions of the different stress genes indicates that they are induced through similar mechanisms, e.g., the MRE/MTF-1 pathway (Chung et al., 2005). The present findings indicate that the response in brown trout tissues to uptake and exposure to Cd and Zn is manifested by increased synthesis of MT transcripts and proteins in liver and kidney, but not in gills. Significant elevation in the transcription of antioxidant enzymes in response to metal exposure, indicate that the levels of Cd and/or Zn in the Naustebekken River may be a potential hazard to the native Naustebekken trout. This is in line with previous findings in these trout populations (Hansen et al., 2006a,b), and the metal environment in the Naustebekken River could represent a basis for an acclimation to elevated concentrations for brown trout. Induction of antioxidant stress-related proteins appear to be important in metal acclimation processes, but to better understand the underlying biological mechanisms it is important to study both mRNA transcript levels as well as enzyme activity. Increased understanding of these mechanisms will increase the potential for using antioxidant systems as tools and biomarkers in environmental risk assessment. Acknowledgements The authors thank Liv Søfteland and Anne Mortensen for technical help with the gene expression analysis, Syverin Lierhagen for doing the metal analysis, and finally the Norwegian Research Council for financing this project (Project No. 147474/720). References Arukwe, A., in press. Toxicological housekeeping genes: Do they really keep the house? Environ. Sci. Technol., in press. doi:10.1021/ es0615223. Bagnyukova, T.V., Vasylkiv, O.Y., Storey, K.B., Lushchak, V.I., 2005a. Catalase inhibition by amino triazole induces oxidative stress in goldfish brain. Brain Res. 1052, 180–186. Bagnyukova, T.V., Storey, K.B., Lushchak, V.I., 2005b. Adaptive response of antioxidant enzymes to catalase inhibition by aminotriazole in goldfish liver and kidney. Comp. Biochem. Physiol. 142B, 335–341. Bagnyukova, T.V., Chahrak, O.I., Lushchak, V.I., 2006. Coordinated response of goldfish antioxidant defenses to environmental stressors. Aquat. Toxicol. 78, 325–331. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Chapman, G.A., Stevens, D.G., 1978. Acutely lethal levels of cadmium, copper, and zinc to adult male coho salmon and steelhead. Trans. Am. Fish. Soc. 107, 837–840. Cho, Y.S., Choi, B.N., Kim, K.H., Kim, S.K., Kim, D.S., Bang, I.C., Nam, Y.K., 2006. Differential expression of Cu/Zn superoxide
dismutase mRNA during exposures to heavy metals in rockbream (Oplegnathus fasciatus). Aquaculture 253, 667–679. Chung, M.J., Walker, P.A., Brown, R.W., Hogstrand, C., 2005. ZINCmediated gene expression offers protection against H2O2-induced cytotoxicity. Toxicol. Appl. Pharmacol. 205, 225–236. Feeney, G.P., Zheng, D., Kille, P., Hogstrand, C., 2005. The phylogeny of teleost ZIP and ZnT zinc transporters and their tissue specific expression and response to zinc in zebrafish. Biochim. Biophys. Acta 1732, 88–95. Garmo, O.A., Royset, O., Steinnes, E., Flaten, T.P., 2003. Performance study of diffusive gradients in thin films for 55 elements. Anal. Chem. 75, 3573–3580. Hansen, B.H., Romma, S., Garmo, O.A., Olsvik, P.A., Andersen, R.A., 2006a. Antioxidative stress proteins and their gene expression in brown trout (Salmo trutta) from three rivers with different heavy metal levels. Comp. Biochem. Physiol C 143, 263–274. Hansen, B.H., Romma, S., Søfteland, L.I.R., Olsvik, P.A., Andersen, R.A., 2006b. Induction and activity of oxidative stress-related proteins during waterborne Cu-exposure in brown trout (Salmo trutta). Chemosphere. 65, 1707–1714. Hutton, M., 1983. Sources of cadmium in the environment. Ecotoxicol. Environ. Saf. 7, 9–24. Johansson, L.H., Hakan Borg, L.A., 1988. A spectrophotometric method for determination of catalase activity in small tissue samples. Anal. Biochem. 174, 331–336. Kagi, J.H.R., Schaffer, A., 1988. Biochemistry of metallothionein. Biochemistry 27, 8509–8515. Klein, D., Bartsch, R., Summer, K.H., 1990. Quantitation of Cucontaining metallothionein by a Cd-saturation method. Anal. Biochem. 189, 35–39. Kling, P.G., Olsson, P.-E., 2000. Involvement of differential metallothionein expression in free radical sensitivity of RTG-2 and CHSE-214 cells. Free Radical. Biol. Med. 28, 1628–1637. Kono, Y., Fridovich, I., 1982. Superoxide radical inhibits catalase. J. Biol. Chem. 257, 5751–5754. Luider, A.R., Crusius, J., Playle, R.C., Curtis, P.J., 2004. Influence of natural organic matter source on copper speciation as demonstrated by Cu binding in fish gills, by ion selective electrode and by DGT gel sampler. Environ. Sci. Technol. 38, 2865–2872. Mayer, G.D., Leach, A., Kling, P., Olsson, P.-E., Hogstrand, C., 2003. Activation of the rainbow trout metallothionein-A promoter by silver and zinc. Comp. Biochem. Physiol. B 134, 181–188. McGeer, J.C., Szebedinszky, C., McDonald, D.G., Wood, C.M., 2000a. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout. 1: iono-regulatory disturbance and metabolic costs. Aquat. Toxicol. 50, 231–243. McGeer, J.C., Szebedinszky, C., Gordon McDonald, D., Wood, C.M., 2000b. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout 2: tissue specific metal accumulation. Aquat. Toxicol. 50, 245–256. Michiels, C., Raes, M., Toussaint, O., Remacle, J., 1994. Importance of SE-glutathione peroxidase, catalase, and CU/ZN–SOD for cell survival against oxidative stress. Free Radical Biol. Med. 17, 235–248. Misra, R., Crance, K.A., Bare, R.M., Waalkes, M.P., 1997. Lack of correlation between the inducibility of metallothionein mRNA and metallothionein protein in cadmium-exposed rodents. Toxicology 117, 99–109. Norey, C.G., Cryer, A., Kay, J., 1990. Induction of metallothionein gene expression by cadmium and the retention of the toxic metal in the tissues of rainbow trout (Salmo gairdneri). Comp. Biochem. Physiol. C 97, 215–220. Olsson, P.-E., Kille, P., 1997. Functional comparison of the metalregulated transcriptional control regions of metallothionein genes from cadmium-sensitive and tolerant fish species. Biochim. Biophys. Acta 1350, 325–334. Olsvik, P.A., Gundersen, P., Andersen, R.A., Zachariassen, K.E., 2000. Metal accumulation and metallothionein in two populations of brown
B. Henrik Hansen et al. / Chemosphere 67 (2007) 2241–2249 trout, Salmo trutta, exposed to different natural water environments during a run-off episode. Aquat. Toxicol. 50, 301–316. Olsvik, P.A., Hindar, K., Zachariassen, K.E., Andersen, R.A., 2001. Brown trout (Salmo trutta) metallothioneins as biomarkers for metal exposure in two Norwegian rivers. Biomarkers 6, 274–288. Pruell, R.J., Engelhardt, F.R., 1980. Liver cadmium uptake, catalase inhibition and cadmium thionein production in the killifish (Fundulus heteroclitus) induced by experimental cadmium exposure. Marine Environ. Res. 3, 101–111. Romeo, M., Bennani, N., Gnassia-Barelli, M., Lafaurie, M., Girard, J.P., 2000. Cadmium and copper display different responses towards oxidative stress in the kidney of the sea bass Dicentrarchus labrax. Aquat. Toxicol. 48, 185–194. Røyset, O., Rosseland, B.O., Kristensen, T., Kroglund, F., Garmo, Ø.A., Steinnes, E., 2005. Diffusive gradients in thin films sampler predicts stress in brown trout (Salmo trutta) L. exposed to aluminium in acid fresh waters. Environ. Sci. Technol. 39, 1167–1174. Shukla, G.S., Hussain, T., Chandra, S.V., 1987. Possible role of regional superoxide dismutase activity and lipid peroxide levels in cadmium neurotoxicity: in vivo and in vitro studies in growing rats. Life Sci. 41, 2215–2221. Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radical Biol. Med. 18, 321–336. Thiele, D.J., 1992. Metal-regulated transcription in eukaryotes. Nucleic Acids Res. 20, 1183–1191.
2249
Thornalley, P.J., Vasak, M., 1985. Possible role for metallothionein in protection against radiation-induced oxidative stress. Kinetics and mechanism of its reaction with superoxide and hydroxyl radicals. Biochim. Biophys. Acta 827, 36–44. Tort, L., Kargacin, B., Torres, P., Giralt, M., Hidalgo, J., 1996. The effect of cadmium exposure and stress on plasma cortisol, metallothionein levels and oxidative status in rainbow trout (Oncorhynchus mykiss) liver. Comp. Biochem. Physiol. C 114, 29–34. Vallee, B.L., 1995. The function of metallothionein. Neurochem. Int. 27, 23–33. van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57–149. Vandesompele, J., Preter, K.D., Pattyn, F., Poppe, B., Roy, N.V., Paepe,, A.D., S., F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, (Research0034.0031–0034.0011). Verbost, P.M., Flik, G., Lock, R.A., Wendelaar Bonga, S.E., 1987. Cadmium inhibition of Ca2+ uptake in rainbow trout gills. Am. J. Physiol. 253, R216–R221. Wang, Y., Fang, J., Leonard, S.S., Krishna Rao, K.M., 2004. Cadmium inhibits the electron transfer chain and induces reactive oxygen species. Free Radical Biol. Med. 36, 1434–1443.