- Email: [email protected]
β-Caryophyllene alleviates d -galactosamine and lipopolysaccharide-induced hepatic injury through suppression of the TLR4 and RAGE signaling pathways
European Journal of Pharmacology 764 (2015) 613–621
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Pulmonary, gastrointestinal and urogenital pharmacology
β-Caryophyllene alleviates D-galactosamine and lipopolysaccharide-induced hepatic injury through suppression of the TLR4 and RAGE signaling pathways Hong-Ik Cho a, Jeong-Min Hong a, Joo-Wan Choi a, Hyo-Sun Choi a, Jong Hwan Kwak a, Dong-Ung Lee b, Sang Kook Lee c, Sun-Mee Lee a,n a b c
School of Pharmacy, Sungkyunkwan University, 300 Cheoncheon-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Republic of Korea Division of Bioscience, Dongguk University, Gyeongju 780-714, Republic of Korea College of Pharmacy, Seoul National University, Seoul 151-742, Republic of Korea
art ic l e i nf o
a b s t r a c t
Article history: Received 26 December 2014 Received in revised form 15 July 2015 Accepted 4 August 2015 Available online 5 August 2015
Agastache rugosa (A. rugosa, Labiatae), a perennial herb spread throughout Korean fields, is widely consumed as a wild edible vegetable and is used in folk medicine. This study examined the hepatoprotective mechanisms of β-caryophyllene (BCP), a major bicyclic sesquiterpene of A. rugosa, against Dgalactosamine (GalN) and lipopolysaccharide (LPS)-induced hepatic failure. Mice were given an intraperitoneal injection of BCP (50, 100 and 200 mg/kg) 1 h before GalN (800 mg/kg)/LPS (40 μg/kg) injection and were killed 1 h or 6 h after GalN/LPS injection. GalN/LPS markedly increased mortality and serum aminotransferase activity, both of which were attenuated by BCP. BCP also attenuated increases in serum tumor necrosis factor-α, interleukin 6, and high-mobility group protein B1 levels by GalN/LPS. GalN/LPS significantly increased toll-like receptor (TLR) 4 and receptor for advanced glycation end products (RAGE) protein expression, extracellular signal-related kinase, p38 and c-Jun N-terminal kinase phosphorylation, nuclear factor κB (NF-κB), early growth response protein-1, and macrophage inflammatory protein-2 protein expression. These increases were attenuated by BCP. Furthermore, BCP suppressed increased TLR4 and RAGE protein expression and proinflammatory cytokines production in LPS-treated isolated Kupffer cells. Our findings suggest that BCP protects against GalN/LPS-induced liver injury through down-regulation of the TLR4 and RAGE signaling. & 2015 Elsevier B.V. All rights reserved.
Keywords: β-Caryophyllene Fulminant hepatic failure High-mobility group box 1 Receptor for advanced glycation end products Toll-like receptor 4
1. Introduction Fulminant hepatic failure (FHF) is an inflammatory condition characterized by the development of severe liver injury with hepatic encephalopathy, severe coagulopathy, renal failure, and Abbreviations: ALT, alanine aminotransferase; BCP, β-caryophyllene; DAMP, damage-associated molecular patterns; Egr-1, early growth response protein 1; ERK, extracellular signal-related kinase; FHF, fulminant hepatic failure; GalN, D-galactosamine; HBSS, Hank’s balanced salt solution; H&E, hematoxylin and eosin; HMGB1, high-mobility group box 1; ICAM, intercellular adhesion molecule; IL, interleukin; JNK, c-Jun N-terminal kinases; KCs, Kupffer cells; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinases; MCP, monocyte chemotactic protein; MIP, macrophage inflammatory protein; NF-κB, nuclear factor κB; PAMP, pathogen-associated molecular patterns; PBS, phosphate-buffered saline; PRR, pattern recognition receptor; RAGE, receptor for advanced glycation end products; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SDS/PAGE, sodium dodecyl sulfate/polyacrylamide gel electrophoresis; S.E.M, standard error of the mean; siRNA, small interfering ribonucleic acid; TBS/T, 0.1% Tween 20 in 1 Tris-buffered saline; TLR, toll-like receptor; TNF-α, tumor necrosis factor-α n Corresponding author. Fax: þ 82 31 292 8800. E-mail address: [email protected] (S.-M. Lee). http://dx.doi.org/10.1016/j.ejphar.2015.08.001 0014-2999/& 2015 Elsevier B.V. All rights reserved.
hydroperitoneum. It is associated with high patient mortality, and except for liver transplantation, there is no available therapy. Fundamental questions regarding the cellular and molecular pathogenesis of experimental and clinical FHF remain unsolved. Lipopolysaccharide (LPS) in combination with D-galactosamine (GalN)-induced liver injury is a promising experimental animal model that is clinically similar to FHF (Nakama et al., 2001). Upon activation by GalN/LPS, macrophages produce proinflammatory cytokines, including tumor necrosis factor (TNF)-α, and IL-6 that stimulate numerous inflammatory responses (He et al., 2001). Activation of pattern recognition receptors (PRRs) signaling plays a key role in the innate immune response to infectious and inflammatory diseases. PRRs interact with microbial pathogens, called pathogen-associated molecular patterns (PAMPs), as well as with endogenous molecules released during cell damage, termed damage-associated molecular patterns (DAMPs) (Janeway and Medzhitov, 2002; Srikrishna and Freeze, 2009). In GalN/LPS-induced liver injury, LPS and high-mobility group box 1 (HMGB1) are typical examples of PAMP and DAMP, respectively (Wang et al., 2013). Toll-like receptor (TLR) 4 and the receptor for advanced
614
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
glycation end products (RAGE), a family of PRRs, are known as typical primary receptors for LPS and HMGB1 (Ibrahim et al., 2013). These receptor–ligand interactions result in the rapid activation of pro-inflammatory intracellular signaling cascades, including activation of nuclear factor (NF)-κB and phosphorylation of mitogen-activated protein kinases (MAPK) (Botos et al., 2011). Ben Ari et al. (2012) reported that administration of GalN/LPS upregulates hepatic TLR4 mRNA expression, and gene silencing of TLR4 attenuates the inflammatory response and liver injury. Recombinant soluble RAGE, which is the carboxyl-terminal truncated isoform of RAGE, showed potent anti-inflammatory effects against endotoxin-induced lung injury (Zhang et al., 2008). Furthermore, Kuhla et al. (2013) demonstrated that blocking RAGE has potent anti-inflammatory properties, as indicated by attenuation of GalN/ LPS-induced liver injury. Agastache rugosa (Fisch. et Meyer) O. Kuntze (A. rugosa, Labiatae), commonly known as Korean mint, is a perennial aromatic herb belonging to the Labiatae family. It is widely used as a food spice and is consumed as a traditional medicine for colds, vomiting, and furuncles. We screened 70% ethanol extracts of A. rugosa and its active components for hepatoprotective agents. Among them, β-caryophyllene (4,11,11-trimethyl-8-methylene-bicyclo [7.2.0]undec-4-ene, BCP), a major active bicyclic sesquiterpene of A. rugosa, showed a hepatoprotective effect in primary hepatocytes (data not shown). Many studies have shown various biological effects of BCP including anti-inflammatory, antibacterial and anticancer properties (Legault and Pichette, 2007; Sain et al., 2014). In addition, BCP demonstrated potent neuroprotective activity by decreasing ischemia/reperfusion-induced cortical cell death and production of inflammatory mediators in vitro and attenuating cortical infarction and neurological deficits in vivo (Chang et al., 2013). BCP also protected rat livers from carbon tetrachloride-induced fibrosis by inhibiting hepatic stellate cell activation (Calleja et al., 2013). In this study, we investigated the effect of BCP on GalN/LPSinduced liver injury and the specific molecular mechanisms of protection, particularly focusing on TLR4 and RAGE signaling.
2. Materials and methods 2.1. General experimental procedures Optical rotation, the ability of a chiral molecule to rotate the plane of linearly polarized light, was measured using a JASCO P-1020 polarimeter (JASCO Corporation, Tokyo, Japan). 1H (700 MHz) and 13C NMR (176 MHz) spectra were recorded using a Bruker AVANCE III 700 spectrometer. GC/EIMS data was obtained on an Agilent Technologies 7890A GC system coupled with an Agilent Technologies 5975C inert MSD (Agilent Technologies, Santa Clara, CA, USA) operating in EI mode (70 eV). Column chromatography was carried out on Sephadex LH-20 (25100 μm; Sigma-Aldrich, St. Louis, MO, USA), silica gel 60 (230 400 mesh; Merck, Darmstadt, Germany), and LiChroprep RP-18 (40 63 μm; Merck). TLC was performed on pre-coated silica gel 60 F254 plates (20 20 cm2, 0.25 mm; Merck) and RP-18 F254s plates (20 20 cm2, 0.25 mm; Merck). 2.2. Plant material The aerial parts of A. rugosa (Fisch. et Meyer) O. Kuntze were collected in September 2012 at Gyeongju, Gyeongsangbuk-do, Korea and identified by Prof. Jae-Hyun Lee, College of Oriental Medicine, Dongguk University, Gyeongju, Korea. A voucher specimen (SKKU-Ph-12-01) was deposited in the Herbarium of the School of Pharmacy, Sungkyunkwan University, Suwon, Korea.
2.3. Extraction and isolation The dried aerial parts of A. rugosa (3.25 kg) were cut into small pieces and extracted with MeOH (30 l) three times at room temperature. After maceration, the total filtrate was evaporated to dryness under reduced pressure, and the MeOH extract (228.3 g) was suspended in distilled water (2.0 l). The resulting solution was partitioned consecutively to give hexane (34.1 g), CH2Cl2 (20.0 g), EtOAc (17.9 g), n-BuOH (25.8 g), and H2O (127.2 g) fractions. The hexane fraction was subjected to silica gel column chromatography (stepwise elution with hexane, hexane–CH2Cl2, 10:1, 3:1, 1:1, CH2Cl2, hexane–CH2Cl2–MeOH, 10:10:0.2, 10:10:1, 10:10:2, and CH2Cl2–MeOH, 1:1) resulting in 15 subfractions (H-1 to H-15). Subfraction H-1 was re-chromatographed over an RP-C18 column with 93% MeOH–H2O and MeOH as eluents to afford five further subfractions (H-1-1 to H-1-5). Among these subfractions, H-1-3 was applied to a Sephadex LH-20 column (CH2Cl2–MeOH, 1:1) to obtain compound 1 (512 mg). Compound 1 was obtained as a colorless oil and identified as BCP by comparing its spectroscopic data (1H NMR, 13C NMR and GC/EIMS) and optical rotation ([α ]23 D – 14.8° (c 0.85, CHCl3)) with values in the literature (Barrero et al., 1995). BCP was determined to be 96.8% pure by GC analysis. 2.4. Animals and drug treatment Male ICR mice weighing 24 26 g (Orient Bio Inc., Seongnam, Korea) were kept in a temperature- and humidity-controlled room (257 1 °C and 55 75%, respectively) under a 12 h light–dark cycle. All experiments were approved by the Animal Care Committee of the Sungkyunkwan University School of Pharmacy (SUSP14-36) and performed in accordance with the guidelines of the National Institutes of Health (NIH publication No. 86-23, revised 1985). Mice were fasted for 18 h before each experiment but given tap water ad libitum. Mice were injected intraperitoneally with GalN (800 mg/kg; Sigma-Aldrich) and LPS (40 μg/kg Escherichia coli O111:B4; Sigma-Aldrich) dissolved in phosphate-buffered saline (PBS). BCP (50, 100 and 200 mg/kg) was dissolved in 10% Tween 80-saline and intraperitoneally administered 1 h before GalN/LPS treatment; non-BCP groups received an equivalent volume of 10% Tween 80-saline as the vehicle. The timing of BCP treatments was selected based on a previous report (Paula-Freire et al., 2014). Animals were randomly divided into six groups (each group, n¼ 8 10): (1) vehicle-treated control (control), (2) BCP at 200 mg/ kg-treated control (BCP), (3) vehicle-treated GalN/LPS (GalN/LPS), (4) BCP at 50 mg/kg-treated GalN/LPS (BCP 50 mg/kg þGalN/LPS), (5) BCP at 100 mg/kg-treated GalN/LPS (BCP 100 mg/kg þGalN/ LPS), and (6) BCP at 200 mg/kg-treated GalN/LPS (BCP 200 mg/ kg þGalN/LPS). Mice were killed 1 h or 6 h after GalN/LPS injection, and blood and liver samples were collected. 2.5. Kupffer cells (KCs) isolation and drug treatment Mice liver was perfused through the inferior vena cava with Ca2 þ - and Mg2 þ -free Hank’s balanced salt solution (HBSS) at 37 °C for 5 min at a flow rate of 5 ml/min, and subsequently perfused with HBSS containing 0.04% collagenase IV at 37 °C for 10 min. After the liver was digested, it was excised and cut into small pieces in collagenase buffer. The suspension was filtered through cell strainer and the filtrate was centrifuged two times at 50 g for 4 min at 4 °C to both parenchymal cells (pellets) and nonparenchymal cells (supernatant). The nonparenchymal cell fraction (mostly KCs) in the supernatant was washed and centrifuged at 320 g for 5 min at 4 °C. Cell pellets were suspended in RPMI 1640 and centrifuged on a density cushion of Percoll (25% and 50%) at 800 g for 15 min at 4 °C. The KCs fraction was collected,
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
centrifuged at 320 g for 5 min and suspended again in RPMI 1640. The purity of KCs preparation exceeds 90% by light microscopy and viability was typically more that 95% by trypan blue exclusion assay. KCs were cultured in 24-well culture plate at density of 2 105 cells/well in RPMI 1640 supplemented with 10% FBS and antibiotics (100 U/ml of penicillin G and 100 mg/ml of streptomycin) at 37 °C in the presence of 5% CO2. Experiments were carried out 24 h after the cells were seeded. Cells were treated with various concentrations of BCP (25 200 μmol/l) 1 h before LPS (1 μg/ml) stimulation. After 24 h incubation, the culture media and cells were harvested for further analysis. 2.6. Nitrite assay
615
Table 1 Real-time qRT-PCR primers used in this study. Gene (accession number)
Primer (5’-3’)
Product length
TLR4 (NM_021297. 2) RAGE (NM_ 001271422.1) β-Actin (NM_ 007393.4)
Forward: Reverse: Forward: Reverse: Forward: Reverse:
129
ATGGCATGGCTTACACCACC GAGGCCAATTTTGTCTCCACA ACTACCGAGTCCGAGTCTAC CCCACCTTATTAGGGACACTGG GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
91 154
qRT-PCR, quantitative reverse transcription polymerase chain reaction; RAGE, receptor for advanced glycation end products; TLR4, toll-like receptor 4.
Fifty microliters of culture medium was transferred to new 96well plate and equal volume of Griess reagent (1% sulfanilamide in 5% phosphoric acid and 0.1% naphthylethylenediamine dihydrochloride in distilled water) was mixed, and the absorvance of the mixture at 540 nm was determined with a microplate reader (Emax; Molecular Devices, Sunnyvale, CA, USA). 2.7. Small interfering RNA (siRNA) gene silencing of TLR4 and RAGE The siRNAs for TLR4, RAGE and non-specific control were purchased from Bioneer (AccuTarget™ predesigned siRNA; Daejeon, Korea). siRNA (90 μg) was diluted in 50 μl of 10% glucose solution, and the volume was adjusted to 100 μl using RNase/ s DNase-free water. In a separate tube, 14.4 μl of in vivo-jetPEI (Polyplus Transfection, Illkirch, France) was diluted in 50 μl of 10% glucose solution, and the volume was adjusted to 100 μl. The solutions were mixed and incubated for 15 min to allow the complexes to form. TLR4, RAGE or non-specific control siRNAs were injected via the tail once a day for 2 days. KCs were isolated 2 days after the last siRNA injection. The siRNAs significantly decreased the levels of TLR4 and RAGE protein expression to 16.5% and 21.4%, respectively, compared to those of control siRNA-treated group (supplementary Fig. 1). 2.8. Lethality and serum alanine aminotransferase (ALT) activity The survival rate of animals was monitored during the 24 h after GalN/LPS treatment. Serum ALT activity was measured 6 h after GalN/LPS injection by a standard spectrophotometric procedure using a ChemiLab ALT assay kit (IVDLab Co., Ltd., Uiwang, Korea). 2.9. Histological analysis Liver sections were stained as described previously (Kim et al., 2012). Liver specimens for histopathological analysis were obtained 6 h after GalN/LPS injection. Samples were fixed in 10% neutral-buffered formalin, embedded in paraffin, sliced into 5 μm sections, and stained with hematoxylin and eosin (H&E) for blinded histological assessment. Histological changes were evaluated in randomly chosen histological fields at 200 magnification. 2.10. Serum TNF-α and IL-6 levels Circulating levels of TNF-α and IL-6 were quantified 1 h after GalN/LPS injection using commercial mouse enzyme-linked immunosorbent assay kits (eBioscience, San Diego, CA, USA), according to the manufacturer’s instructions. 2.11. Isolation of cytosolic and nuclear proteins Fresh liver tissue was isolated and homogenized in PRO-PREP (iNtRON Biotechnology Inc., Seongnam, Korea) for whole protein
Fig. 1. Effect of BCP on lethality induced by GalN/LPS. All groups consisted of 10 mice. Mice were intraperitoneally administered vehicle (10% Tween 80-saline) or BCP (50, 100 or 200 mg/kg) 1 h before GalN (800 mg/kg)/LPS (40 μg/kg) treatment. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide.
Table 2 Effect of BCP on serum ALT activity in mice after GalN/LPS injection. Group Control BCP GalN/LPS BCP þ GalN/LPS
Dose (mg/kg)
200 50 100 200
ALT (U/l) 63.1 77.4 72.5 7 5.8 666.7 782.5b 377.4 723.8b,c 352.47 23.9a,c 253.5 7 29.3c
Liver damage was assessed 6h after GalN/LPS injection by measurement of circulating serum ALT activity. Mice were intraperitoneally administered BCP (50, 100 and 200 mg/kg) 1 h before GalN/LPS injection (n¼8–10). The values are represented as mean 7 S.E.M. ALT, alanine aminotransferase; BCP, β-caryophyllene; GalN/LPS, d-galactosamine/lipopolysaccharide. a b c
Denotes significant difference (Po 0.05) versus control group. Denotes significant difference (P o 0.01) versus control group. Denotes significant difference (P o0.01) versus GalN/LPS group.
samples and in NE-PER (Pierce Biotechnology Inc., Rockford, IL, USA) for nuclear and cytosolic protein samples, according to the manufacturer’s instructions. Protein concentrations were determined using a BCA Protein Assay kit (Pierce Biotechnology Inc.). 2.12. Serum preparation for HMGB1 analysis Serum samples were filtered and concentrated using Centricon YM-100 and YM-10 devices (Millipore, Billerica, MA, USA) with fixed-angle (35°), 7500 g for 15 min, 4 °C. Concentrated samples were subjected to 10% sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE).
616
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
Fig. 2. Effect of BCP on the histological changes in the liver 6 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/ LPS injection (n¼ 8 10). Typical images were chosen from each experimental group (original magnification 200 ): (A) control; (B) BCP, normal hepatic architecture; (C) GalN/LPS, extensive areas of inflammation, necrosis, and lymphocyte infiltration around the overall area; and (D) BCP þ GalN/LPS, mild hepatocellular damages and inflammatory infiltration. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide.
Table 3 Effect of BCP on serum TNF-α and IL-6 levels in mice after GalN/LPS injection. Group
TNF-α (pg/ml)
IL-6 (pg/ml)
Control BCP GalN/LPS BCP þ GalN/LPS
13.6 7 0.9 13.1 þ0.8 69.0 7 13.1a 18.17 2.2b
45.8 7 8.1 36.0 7 1.2 1149.5 7 150.0a 672.0 7 93.7a,b
The levels of serum TNF-α and IL-6 were determined at 1h after GalN/LPS injection. Mice were intraperitoneally administered 200 mg/kg BCP 1 h before GalN/LPS injection (n¼8–10). The values are represented as mean7 S.E.M. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide; IL, interleukin; TNF, tumor necrosis factor. a b
Denotes significant difference (P o0.01) versus control group. Denotes significant difference (Po 0.01) versus GalN/LPS group.
content of TLR4, RAGE, NF-κB, phosphorylated (phospho)-p38, p38, phospho-extracellular signal-related kinases (ERK), ERK, phospho-c-Jun N-terminal kinases (JNK), JNK, early growth response protein (Egr)-1 and macrophage inflammatory protein (MIP)-2 protein expression. Protein samples were separated by 10 17% SDS/PAGE and transferred to polyvinylidene fluoride membranes using the Semi-Dry Trans-Blot Cell (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were washed with 0.1% Tween 20 in 1 Tris-buffered saline (TBS/T) and blocked for 1 h at room temperature with 5% (w/v) skim milk powder or 5% (w/v) bovine serum albumin powder in TBS/T. Blocked blots were incubated overnight at 4 °C with primary antibodies, washed 5 times for 8 min each in TBS/T, and incubated with the appropriate secondary antibodies for 1 h at room temperature, followed by detection using an ECL detection system (iNtRON Biotechnology Inc.), according to the manufacturer’s instructions. The intensity of the immunoreactive bands was determined using TotalLab TL 120 software (Nonlinear Dynamics Ltd., Newcastle, UK). The following primary antibodies were used: phospho-p38, p38, phospho-ERK, ERK, phospho-JNK, JNK (all from Cell Signaling Technology, Beverly, MA, USA); NF-κB and lamin B (both from Abcam, Cambridge, MA, USA); TLR4, RAGE, Egr-1 and MIP-2 (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA); and β-actin (Sigma-Aldrich). Protein densities were standardized to β-actin and lamin B for total lysates and nuclear fractions, respectively. 2.14. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Fig. 3. Effect of BCP on serum HMGB1 release in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). The values are represented as mean 7 S.E.M. **Denotes significant difference (Po 0.01) versus control group; þ þ Denotes significant difference (Po 0.01) versus GalN/LPS group. BCP, β-caryophyllene; GalN/ LPS, D-galactosamine/lipopolysaccharide; HMGB1, high-mobility group box 1.
2.13. Western blot immunoassay Soluble protein sample 16 μg was used to determine the
s
Total RNA was extracted from KCs using RNeasy Mini Kit (Qiagen, Limburg, Netherlands), and the first strand of cDNA was synthesized by reverse transcription (EcoDryTM cDNA Synthesis Premix, Takara Bio Inc.). The cDNA was amplified using real-time s qRT-PCR with a thermocycler (Lightcycler Nano, Roche Applied Science, Mannheim, Germany) and SYBR Green detection system (Roche Applied Science). Real-time qRT-PCR was performed with specific amplification cycling conditions as follows: 45 cycles of
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
617
Fig. 4. Effect of BCP on TLR4 and RAGE protein expression in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). TLR4 and RAGE levels in the liver were measured by western blot analysis 1 h after GalN/LPS injection. The values are represented as mean 7 S.E.M. *,**Denote significant differences (Po 0.05, Po 0.01) versus control group; þ þ Denotes significant difference (Po 0.01) versus GalN/LPS group. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide; RAGE, receptor for advanced glycation end products; TLR, toll-like receptor.
Fig. 5. Effect of BCP on MAPK phosphorylation (A) and nuclear NF-κB protein expression (B) in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). Total and phospho-p38, ERK and JNK levels in the liver were measured by western blot analysis 1 h after GalN/LPS injection. NF-κB was measured on the nuclear extracts from liver by western blot analysis 1 h after GalN/LPS injection. The values are represented as mean 7S.E.M. *,**Denote significant differences (P o 0.05, Po 0.01) versus control group; þ , þ þ Denote significant differences (Po 0.05, P o0.01) versus GalN/LPS group. BCP, β-caryophyllene; ERK, extracellular signal-related kinase; GalN/LPS, D-galactosamine/lipopolysaccharide; JNK, c-Jun N-terminal kinases; MAPK, mitogen-activated protein kinases; NF-κB, nuclear factor κB.
95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s for TLR4; 45 cycles of 95 °C for 30 s, 50.5 °C for 30 s, 72 °C for 30 s for RAGE; 45 cycles of 94 °C for 30 s, 62 °C for 30 s, 72 °C for 30 s for β-actin. All reactions included an initial denaturation step at 94 °C for 5 min and a final extension step at 72 °C for 7 min. The gene-specific primers are listed in Table 1. The levels of mRNA expression were normalized to the level of the β-actin mRNA expression and expressed relative to the average of all ΔCt-values in each sample using the cycle threshold (Ct) method.
2.15. Statistical analysis Results are presented as mean 7 standard error of the mean (S. E.M.). Survival data were analyzed by Kaplan–Meier curves and the log-rank test. The overall significance of results was analyzed by one-way analysis of variance. Differences between compared groups were considered statistically significant at P o0.05 with the appropriate Bonferroni correction for multiple comparisons.
3. Results 3.1. BCP ameliorates GalN/LPS-induced fulminant hepatic failure To investigate the role of BCP on GalN/LPS-induced lethality and hepatic injury, we initially observed the survival rate within 24 h after GalN/LPS administration. As shown in Fig. 1, the mice began to die 6 h after GalN/LPS administration. The survival rate was 90% at 6 h and stabilized at 20% 23 h after GalN/LPS administration. However, pretreatment with BCP (50, 100 and 200 mg/ kg) before GalN/LPS injection reduced the mortality in a dosedependent manner. The serum ALT activity, which is a serum marker of hepatocyte necrosis, was 63.1 77.4 U/l in the control group. In the GalN/LPS group, the level of serum ALT significantly increased to 666.7 782.5 U/l 6 h after GalN/LPS injection. This increase was attenuated by pretreatment with BCP at 50, 100 and 200 mg/kg (Table 2). BCP alone at 200 mg/kg did not affect the lethality or serum ALT levels. Based on these results, BCP at 200 mg/kg was selected as the optimal effective dose for
618
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
evaluating the molecular mechanisms of BCP against GalN/LPSinduced hepatic injury. The histological features of the control group indicated a normal liver lobular architecture and cell structure (Fig. 2A). BCP alone did not affect the histological features (Fig. 2B). However, 6 h after exposure to GalN/LPS, the livers showed multiple areas of portal inflammation and hemorrhagic necrosis, as well as a severe increase in inflammatory cell infiltration (Fig. 2C). These pathological alterations were ameliorated by BCP treatment (Fig. 2D). 3.2. BCP modulates TNF-α and IL-6 production in GalN/LPS-induced fulminant hepatic failure In the control group, serum levels of both TNF-α and IL-6 were low (Table 3). The serum levels of TNF-α and IL-6 increased 1 h after GalN/LPS injection to 4.5-fold and 25.4-fold, respectively, compared with those in the control group. However, pretreatment with BCP attenuated these increases. 3.3. BCP suppresses serum HMGB1 release in GalN/LPS-induced fulminant hepatic failure Extracellular HMGB1 secreted by activated immune cells during cellular stress plays as a cytokine mediator of inflammation through binding to PRRs (Yasuda et al., 2007). As shown in Fig. 3, at 1 h after GalN/LPS injection, the serum level of HMGB1 increased to 5.1-fold compared with that of the control group. This increase was attenuated by BCP pretreatment. 3.4. BCP suppresses hepatic TLR4 and RAGE activation in GalN/LPSinduced fulminant hepatic failure TLR4 and RAGE recognize and bind to LPS and HMGB1, which subsequently trigger NF-κB and MAPK activation (Visintin et al., 2003; Botos et al., 2011). As shown in Fig. 4, the hepatic levels of TLR4 and RAGE protein content in control animals were very low, but 1 h after GalN/LPS injection, the levels of TLR4 and RAGE protein expression increased to 2.6- and 2.1-fold, respectively, compared with those in the control group. These increases were attenuated by pretreatment with BCP. 3.5. BCP suppresses NF-κB and MAPK activation in GalN/LPS-induced fulminant hepatic failure Nuclear levels of NF-κB protein expression showed a marked increase to 17.0 times that of the control group. This increase was also attenuated by BCP pretreatment (Fig. 5A). Phosphorylation of p38, ERK, and JNK showed a significant increase 1 h after GalN/LPS injection to 1.7, 2.1, and 3.0 times, respectively, those of the control group. These increases were attenuated by BCP pretreatment (Fig. 5B). 3.6. BCP suppresses Egr-1 and MIP-2 protein expression in GalN/LPSinduced fulminant hepatic failure Transcription factor Egr-1 immediately responds to MAPK activation, and mediates various chemokines production including MIP-2 (Yan et al., 2000). The nuclear Egr-1 and total MIP-2 protein levels increased to 2.2 and 1.6 times those of the control group, respectively, 1 h after GalN/LPS injection. These increases were attenuated by BCP pretreatment (Fig. 6). 3.7. BCP inhibits TLR4 and RAGE signaling in LPS-treated KCs To ensure the hepatoprotective effect of BCP against GalN/LPSinduced liver injury through suppressing TLR4 and RAGE
Fig. 6. Effect of BCP on nuclear Egr-1 protein expression and MIP-2 protein expression in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). Egr-1 was measured on the nuclear extracts from liver by western blot analysis 1 h after GalN/ LPS injection. MIP-2 in the liver was measured by western blot analysis 1 h after GalN/LPS injection. The values are represented as mean 7 S.E.M. *,**Denote significant differences (Po 0.05, P o0.01) versus control group; þ þ Denotes significant difference (Po 0.01) versus GalN/LPS group. BCP, β-caryophyllene; Egr-1, early growth response protein 1; GalN/LPS, D-galactosamine/lipopolysaccharide; MIP, macrophage inflammatory protein.
activation, we pretreated BCP on LPS-activated KCs. BCP (200 μmol/l) did not display any cellular toxicity in KCs (Fig. 7A). LPS increased the production of nitrites, TNF-α and IL-6 by approximately 5.6-fold, 6.1-fold and 4.4-fold in KCs, compared with those of control group, respectively, all of which were suppressed by BCP treatment (Fig. 7B–D). LPS also increased the levels of TLR4 and RAGE mRNA expression by approximately 9.2 and 5.3-fold compared with those of control group, respectively. These increases were suppressed by BCP pretreatment (Fig. 7E). To further verify the involvement of TLR4 and RAGE signaling in the protective effects of BCP, TLR4 and RAGE siRNA was performed in KCs. Non-specific control siRNA transfection did not affect any parameters with regard to the effect of BCP on LPS-activated KCs. As shown in Fig. 8, TLR4 and RAGE siRNA significantly blunted LPSinduced production of TNF-α and IL-6 compared with those of non-specific control siRNA, respectively, and, treatment of BCP further suppressed the TNF-α and IL-6 levels.
4. Discussion BCP, a bioactive herbal ingredient isolated from A. rugosa, is a natural bicyclic sesquiterpene that is a constituent of many essential oils. In a previous study conducted by Gertsch et al. (2008), BCP was shown to be a selective agonist of cannabinoid receptor type-2 and to exert significant cannabimimetic anti-inflammatory effects in mice. Antinociceptive, neuroprotective, and antibacterial
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
619
Fig. 7. Effect of BCP on cell viability (A), production of nitrites (B), TNF-α level (C), IL-6 level (D) and, TLR4 and RAGE mRNA expression (E) in LPS-treated isolated KCs from mice liver. KCs were pretreated with various concentrations of BCP (25–200 μmol/l), followed by stimulation with LPS (1 μg/ml) for 24 h. The values are represented as mean 7 S.E.M. *,**Denote significant differences (Po 0.05, P o0.01) versus control group; þ , þ þ Denote significant differences (Po 0.05, Po 0.01) versus LPS group. BCP, βcaryophyllene; IL, interleukin; KCs, Kupffer cells; LPS, lipopolysaccharide; RAGE, receptor for advanced glycation end products; TLR, toll-like receptor; TNF, tumor necrosis factor.
activities have also been uncovered (Chang et al., 2013; PaulaFreire et al., 2014). Recently, Calleja et al. (2013) demonstrated the antioxidant effects of BCP from carbon tetrachloride-induced liver fibrosis by inhibiting hepatic stellate cell activation. However, the precise mechanism of BCP against acute liver injury has not been documented. In this study, we demonstrated the hepatoprotective effects of BCP against GalN/LPS-induced FHF in mice. Administration of GalN with LPS in mice causes acute liver injury that closely resembles clinical hepatitis caused by endotoxemia or sepsis in both functional and morphological features (Nakama et al., 2001). For this reason, this model has been widely used to investigate the molecular mechanisms underlying the pathophysiology of FHF and evaluate the biological activities of hepatoprotective agents. In this study, mice treated with GalN/LPS began to die 6 h after GalN/LPS injection, and the mortality reached 80% 24 h after GalN/LPS injection. Furthermore, severe necrosis was observed as a result of GalN/LPS injection, which was indicated by GalN/LPS-induced elevation of serum ALT levels. These increases were attenuated by pretreatment with BCP. The histological observations of the liver samples strongly support these results; GalN/LPS caused various histological changes to the liver, including multiple areas of portal inflammation, necrosis, and severe increase in inflammatory cell infiltration. These alterations were attenuated by BCP pretreatment with the affected livers showing only mild necrosis and mild portal inflammation.
Our results suggest that BCP may have potential clinical applications for treating liver diseases. HMGB1 is a DNA-binding protein, which is present in most eukaryotic cells to stabilize nucleosome formation and facilitate gene transcription. However, when released into the extracellular milieu, HMGB1 functions as a prototype DAMP, which is associated with many inflammatory diseases such as ischemia-reperfusion injury, acute pancreatitis, and endotoxemia by PRRs stimulation (Tsung et al., 2005; Yang et al., 2004; Yasuda et al., 2007). A previous study identified HMGB1 as a late mediator of inflammation in LPS-induced endotoxemia (Hasunuma et al., 2002). Meanwhile, Wang et al. (2013) showed that plasma HMGB1 levels increased in the very early stages of GalN/LPS-induced acute liver failure, and neutralizing antibodies as well as siRNA targeting HMGB1 significantly improve the survival rate of GalN/LPS-treated mice. In this study, we showed that serum HMGB1 levels markedly increased 1 h after GalN/LPS treatment and that pretreatment with BCP attenuated the serum HMGB1 levels. TLRs and RAGE, a family of PRRs, play critical roles in the innate immune system by interacting with microbial pathogens as well as endogenous molecules released during cell damage. Both of these receptors share several common ligands, including LPS and HMGB1 (Visintin et al., 2003; Yang et al., 2012). Activation of TLRs and RAGE by ligand binding leads to pro-inflammatory intracellular signaling cascades that, in turn, result in the
620
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
Fig. 8. Effect of BCP on production of proinflammatory cytokines production in respective TLR4 and RAGE siRNA-transfected KCs with LPS treatment. TLR4 and RAGE siRNA-transfected KCs were pretreated with BCP (200 μmol/l), followed by stimulation with LPS (1 μg/ml) for 24 h. The values are represented as mean7 S.E. M. **Denotes significant difference (Po 0.05) versus control siRNA-treated control group; þ , þ þ Denote significant differences (P o0.05, Po 0.01) versus control siRNA-treated LPS group. #,##Denote significant differences (Po 0.05, P o0.01) versus siRNA-treated control group. $Denotes significant difference (Po 0.05) versus siRNA-treated LPS group. BCP, β-caryophyllene; IL, interleukin; KCs, Kupffer cells; LPS, lipopolysaccharide; RAGE, receptor for advanced glycation end products; TLR, tolllike receptor; TNF, tumor necrosis factor.
overexpression of genes for cytokines, growth factors, and adhesion molecules (Botos et al., 2011). Recently, it was suggested that RAGE and some members of the TLRs, especially TLR4, functionally interact to coordinate and regulate immune and inflammatory responses (Ibrahim et al., 2013). RAGE also appears to interact with the toll-interleukin 1 receptor domain containing an adaptor protein and myeloid differentiation primary response gene 88, both of which are intracellular adaptor molecules associated with TLRs to activate downstream signaling (Sakaguchi et al., 2011). The TLR4 antagonist E5564 exhibits hepatoprotective effects by inhibiting endotoxin-induced TNF-α overproduction of macrophages in GalN/LPS-induced liver injury (Kitazawa et al., 2010). In our previous study, scoparone, a major component of Artemisia capillaris (Compositae), showed a hepatoprotective effect against GalN/LPS-induced liver injury via inhibition of the TLR4 signaling pathway (Kang et al., 2013). Recently, Kuhla et al. (2013) demonstrated that activation of RAGE by GalN/LPS injection causes a rapid induction of pro-inflammatory intracellular signaling cascades. In our present study, TLR and RAGE levels markedly increased in both mice challenged by GalN/LPS and LPS-treated KCs. These alterations were attenuated by BCP pretreatment, which suggests that BCP simultaneously down-regulates TLR and RAGE expression. Activation of the TLR4 and RAGE signaling pathways results in the activation of NF-κB to induce expression of proinflammatory cytokine genes (Arancibia et al., 2007; Bierhaus et al., 2005). Previous studies demonstrated a significant decrease in hepatic NF-κB
activation in gene deletions of TLR4 as well as blockade of RAGE by soluble RAGE in mice compared with wild-type mice following induction of hepatic injury by GalN/LPS (Ben Ari et al., 2012; Kuhla et al., 2013). Simultaneously, the activated TLR4 and RAGE also stimulates MAPK pathway, one of the most widespread mechanisms of cell regulation, leading to upregulation of proinflammatory mediators and cell death (Pearson et al., 2001). ERKs, p38 MAPK, and JNKs are three major groups of the MAPK family. In GalN/LPSinduced liver injury, activated MAPKs contribute to the inflammatory response following GalN/LPS intoxication (Kang et al., 2013). In our current study, GalN/LPS significantly increased activation of NF-κB as well as ERK, p38 MAPK, and JNK. In addition, serum TNF-α and IL-6 levels also markedly increased after GalN/ LPS injection. These changes were attenuated by pretreatment with BCP. Our results suggest that the anti-inflammatory response following BCP pretreatment is associated with suppression of NFκB and MAPK activation. Egr-1 is a zinc-finger transcriptional regulator that regulates diverse cellular processes including cell growth, proliferation, differentiation, and death in response to extracellular stimuli. Activation of Egr-1 induced by MAPKs induces expression of various proinflammatory cytokines (TNF-α and IL-1β) as well as chemokines (MIP-2, monocyte chemotactic protein (MCP)-1, and intercellular adhesion molecule (ICAM)-1) (Yan et al., 2000). Pritchard et al. (2007) demonstrated an important role for Egr-1 in the development and progression of GalN/LPS-induced acute liver injury by enhancing expression of TNF-α, MIP-2, MCP-1, and ICAM-1. In our study, the levels of Egr-1 and MIP-2 expression increased after GalN/LPS injection and were attenuated by BCP. Our results imply that BCP inhibits the RAGE-mediated Egr-1 pathway.
5. Conclusions
β-Caryophyllene ameliorates GalN/LPS-induced liver damage through suppression of TLR4 and RAGE-mediated inflammatory signaling pathways. Thus, β-caryophyllene might be useful as a potential therapeutic medication for preventing fulminant hepatic failure. Acknowledgments This research was supported by a Grant (12172MFDS989) from the Ministry of Food and Drug Safety, South Korea in 2013 (“Studies on the Identification of Efficacy of Biologically Active Components from Oriental Herbal Medicines”) and the National Research Foundation of Korea (NRF) grant funded by the Korean government (MEST), South Korea (2012R1A5A2A28671860). Hong-Ik Cho (NRF-2012H1A2A1016419) received ‘Global Ph.D. Fellowship Program’ support from the NRF, South Korea funded by the Ministry of Education, Science, and Technology (MEST) in Korea.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ejphar.2015.08.001.
References Arancibia, S.A., Beltran, C.J., Aguirre, I.M., Silva, P., Peralta, A.L., Malinarich, F., Hermoso, M.A., 2007. Toll-like receptors are key participants in innate immune responses. Biol. Res. 40, 97–112.
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
Barrero, A.F., Molina, J., Oltra, J.E., Altarejos, J., Barragan, A., Lara, A., Segura, M., 1995. Stereochemistry of 14-hydroxy-beta-caryophyllene and related-compounds. Tetrahedron 51, 3813–3822. Ben Ari, Z., Avlas, O., Pappo, O., Zilbermints, V., Cheporko, Y., Bachmetov, L., Zemel, R., Shainberg, A., Sharon, E., Grief, F., Hochhauser, E., 2012. Reduced hepatic injury in Toll-like receptor 4-deficient mice following D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure. Cell. Physiol. Biochem. 29, 41–50. Bierhaus, A., Humpert, P.M., Morcos, M., Wendt, T., Chavakis, T., Arnold, B., Stern, D. M., Nawroth, P.P., 2005. Understanding RAGE, the receptor for advanced glycation end products. J. Mol. Med. (Berl.) 83, 876–886. Botos, I., Segal, D.M., Davies, D.R., 2011. The structural biology of Toll-like receptors. Structure 19, 447–459. Calleja, M.A., Vieites, J.M., Montero-Melendez, T., Torres, M.I., Faus, M.J., Gil, A., Suarez, A., 2013. The antioxidant effect of beta-caryophyllene protects rat liver from carbon tetrachloride-induced fibrosis by inhibiting hepatic stellate cell activation. Br. J. Nutr 109, 394–401. Chang, H.J., Kim, J.M., Lee, J.C., Kim, W.K., Chun, H.S., 2013. Protective effect of betacaryophyllene, a natural bicyclic sesquiterpene, against cerebral ischemic injury. J. Med. Food 16, 471–480. Gertsch, J., Leonti, M., Raduner, S., Racz, I., Chen, J.Z., Xie, X.Q., Altmann, K.H., Karsak, M., Zimmer, A., 2008. Beta-caryophyllene is a dietary cannabinoid. Proc. Natl. Acad. Sci. USA 105, 9099–9104. Hasunuma, R., Maruyama, H., Takimoto, H., Ryll, R., Tanaka, S., Kumazawa, Y., 2002. Does high mobility group 1 protein function as a late mediator for LPS- or TNFinduced shock in galactosamine-sensitized mice? J. Endotoxin Res. 8, 391–398. He, P., Noda, Y., Sugiyama, K., 2001. Green tea suppresses lipopolysaccharide-induced liver injury in D-galactosamine-sensitized rats. J. Nutr. 131, 1560–1567. Ibrahim, Z.A., Armour, C.L., Phipps, S., Sukkar, M.B., 2013. RAGE and TLRs: relatives, friends or neighbours? Mol. Immunol. 56, 739–744. Janeway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Kang, J.W., Kim, D.W., Choi, J.S., Kim, Y.S., Lee, S.M., 2013. Scoparone attenuates Dgalactosamine/lipopolysaccharide-induced fulminant hepatic failure through inhibition of toll-like receptor 4 signaling in mice. Food Chem. Toxicol. 57, 132–139. Kim, D.W., Cho, H.I., Kim, K.M., Kim, S.J., Choi, J.S., Kim, Y.S., Lee, S.M., 2012. Isorhamnetin-3-O-galactoside protects against CCl4-induced hepatic injury in mice. Biomol. Ther. 20, 406–412. Kitazawa, T., Tsujimoto, T., Kawaratani, H., Fukui, H., 2010. Salvage effect of E5564, Toll-like receptor 4 antagonist on D-galactosamine and lipopolysaccharide-induced acute liver failure in rats. J. Gastroenterol. Hepatol. 25, 1009–1012. Kuhla, A., Norden, J., Abshagen, K., Menger, M.D., Vollmar, B., 2013. RAGE blockade and hepatic microcirculation in experimental endotoxaemic liver failure. Br. J. Surg. 100, 1229–1239. Legault, J., Pichette, A., 2007. Potentiating effect of beta-caryophyllene on anticancer activity of alpha-humulene, isocaryophyllene and paclitaxel. J. Pharm. Pharmacol. 59, 1643–1647. Nakama, T., Hirono, S., Moriuchi, A., Hasuike, S., Nagata, K., Hori, T., Ido, A., Hayashi, K., Tsubouchi, H., 2001. Etoposide prevents apoptosis in mouse liver with Dgalactosamine/lipopolysaccharide-induced fulminant hepatic failure resulting in reduction of lethality. Hepatology 33, 1441–1450. Paula-Freire, L.I., Andersen, M.L., Gama, V.S., Molska, G.R., Carlini, E.L., 2014. The oral
621
administration of trans-caryophyllene attenuates acute and chronic pain in mice. Phytomedicine 21, 356–362. Pearson, G., Robinson, F., Beers Gibson, T., Xu, B.E., Karandikar, M., Berman, K., Cobb, M.H., 2001. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22, 153–183. Pritchard, M.T., Roychowdhury, S., McMullen, M.R., Guo, L., Arteel, G.E., Nagy, L.E., 2007. Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G1124–G1133. Sain, S., Naoghare, P.K., Devi, S.S., Daiwile, A., Krishnamurthi, K., Arrigo, P., Chakrabarti, T., 2014. Beta caryophyllene and caryophyllene oxide, isolated from Aegle marmelos, as the potent anti-inflammatory agents against lymphoma and neuroblastoma cells. Antiinflamm. Antiallergy Agents Med. Chem. 13, 45–55. Sakaguchi, M., Murata, H., Yamamoto, K., Ono, T., Sakaguchi, Y., Motoyama, A., Hibino, T., Kataoka, K., Huh, N.H., 2011. TIRAP, an adaptor protein for TLR2/4, transduces a signal from RAGE phosphorylated upon ligand binding. PLoS One 6, e23132. Srikrishna, G., Freeze, H.H., 2009. Endogenous damage-associated molecular pattern molecules at the crossroads of inflammation and cancer. Neoplasia 11, 615–628. Tsung, A., Sahai, R., Tanaka, H., Nakao, A., Fink, M.P., Lotze, M.T., Yang, H., Li, J., Tracey, K.J., Geller, D.A., Billiar, T.R., 2005. The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion. J. Exp. Med. 201, 1135–1143. Visintin, A., Latz, E., Monks, B.G., Espevik, T., Golenbock, D.T., 2003. Lysines 128 and 132 enable lipopolysaccharide binding to MD-2, leading to Toll-like receptor-4 aggregation and signal transduction. J. Biol. Chem. 278, 48313–48320. Wang, W., Sun, L., Deng, Y., Tang, J., 2013. Synergistic effects of antibodies against high-mobility group box 1 and tumor necrosis factor-alpha antibodies on D(þ )-galactosamine hydrochloride/lipopolysaccharide-induced acute liver failure. FEBS J. 280, 1409–1419. Yan, S.F., Fujita, T., Lu, J., Okada, K., Shan Zou, Y., Mackman, N., Pinsky, D.J., Stern, D. M., 2000. Egr-1, a master switch coordinating upregulation of divergent gene families underlying ischemic stress. Nat. Med. 6, 1355–1361. Yang, H., Lundback, P., Ottosson, L., Erlandsson-Harris, H., Venereau, E., Bianchi, M. E., Al-Abed, Y., Andersson, U., Tracey, K.J., Antoine, D.J., 2012. Redox modification of cysteine residues regulates the cytokine activity of high mobility group box-1 (HMGB1). Mol. Med. 18, 250–259. Yang, H., Ochani, M., Li, J., Qiang, X., Tanovic, M., Harris, H.E., Susarla, S.M., Ulloa, L., Wang, H., DiRaimo, R., Czura, C.J., Wang, H., Roth, J., Warren, H.S., Fink, M.P., Fenton, M.J., Andersson, U., Tracey, K.J., 2004. Reversing established sepsis with antagonists of endogenous high-mobility group box 1. Proc. Natl. Acad. Sci. USA 101, 296–301. Yasuda, T., Ueda, T., Shinzeki, M., Sawa, H., Nakajima, T., Takeyama, Y., Kuroda, Y., 2007. Increase of high-mobility group box chromosomal protein 1 in blood and injured organs in experimental severe acute pancreatitis. Pancreas 34, 487–488. Zhang, H., Tasaka, S., Shiraishi, Y., Fukunaga, K., Yamada, W., Seki, H., Ogawa, Y., Miyamoto, K., Nakano, Y., Hasegawa, N., Miyasho, T., Maruyama, I., Ishizaka, A., 2008. Role of soluble receptor for advanced glycation end products on endotoxin-induced lung injury. Am. J. Respir. Crit. Care Med. 178, 356–362.
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Pulmonary, gastrointestinal and urogenital pharmacology
β-Caryophyllene alleviates D-galactosamine and lipopolysaccharide-induced hepatic injury through suppression of the TLR4 and RAGE signaling pathways Hong-Ik Cho a, Jeong-Min Hong a, Joo-Wan Choi a, Hyo-Sun Choi a, Jong Hwan Kwak a, Dong-Ung Lee b, Sang Kook Lee c, Sun-Mee Lee a,n a b c
School of Pharmacy, Sungkyunkwan University, 300 Cheoncheon-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Republic of Korea Division of Bioscience, Dongguk University, Gyeongju 780-714, Republic of Korea College of Pharmacy, Seoul National University, Seoul 151-742, Republic of Korea
art ic l e i nf o
a b s t r a c t
Article history: Received 26 December 2014 Received in revised form 15 July 2015 Accepted 4 August 2015 Available online 5 August 2015
Agastache rugosa (A. rugosa, Labiatae), a perennial herb spread throughout Korean fields, is widely consumed as a wild edible vegetable and is used in folk medicine. This study examined the hepatoprotective mechanisms of β-caryophyllene (BCP), a major bicyclic sesquiterpene of A. rugosa, against Dgalactosamine (GalN) and lipopolysaccharide (LPS)-induced hepatic failure. Mice were given an intraperitoneal injection of BCP (50, 100 and 200 mg/kg) 1 h before GalN (800 mg/kg)/LPS (40 μg/kg) injection and were killed 1 h or 6 h after GalN/LPS injection. GalN/LPS markedly increased mortality and serum aminotransferase activity, both of which were attenuated by BCP. BCP also attenuated increases in serum tumor necrosis factor-α, interleukin 6, and high-mobility group protein B1 levels by GalN/LPS. GalN/LPS significantly increased toll-like receptor (TLR) 4 and receptor for advanced glycation end products (RAGE) protein expression, extracellular signal-related kinase, p38 and c-Jun N-terminal kinase phosphorylation, nuclear factor κB (NF-κB), early growth response protein-1, and macrophage inflammatory protein-2 protein expression. These increases were attenuated by BCP. Furthermore, BCP suppressed increased TLR4 and RAGE protein expression and proinflammatory cytokines production in LPS-treated isolated Kupffer cells. Our findings suggest that BCP protects against GalN/LPS-induced liver injury through down-regulation of the TLR4 and RAGE signaling. & 2015 Elsevier B.V. All rights reserved.
Keywords: β-Caryophyllene Fulminant hepatic failure High-mobility group box 1 Receptor for advanced glycation end products Toll-like receptor 4
1. Introduction Fulminant hepatic failure (FHF) is an inflammatory condition characterized by the development of severe liver injury with hepatic encephalopathy, severe coagulopathy, renal failure, and Abbreviations: ALT, alanine aminotransferase; BCP, β-caryophyllene; DAMP, damage-associated molecular patterns; Egr-1, early growth response protein 1; ERK, extracellular signal-related kinase; FHF, fulminant hepatic failure; GalN, D-galactosamine; HBSS, Hank’s balanced salt solution; H&E, hematoxylin and eosin; HMGB1, high-mobility group box 1; ICAM, intercellular adhesion molecule; IL, interleukin; JNK, c-Jun N-terminal kinases; KCs, Kupffer cells; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinases; MCP, monocyte chemotactic protein; MIP, macrophage inflammatory protein; NF-κB, nuclear factor κB; PAMP, pathogen-associated molecular patterns; PBS, phosphate-buffered saline; PRR, pattern recognition receptor; RAGE, receptor for advanced glycation end products; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SDS/PAGE, sodium dodecyl sulfate/polyacrylamide gel electrophoresis; S.E.M, standard error of the mean; siRNA, small interfering ribonucleic acid; TBS/T, 0.1% Tween 20 in 1 Tris-buffered saline; TLR, toll-like receptor; TNF-α, tumor necrosis factor-α n Corresponding author. Fax: þ 82 31 292 8800. E-mail address: [email protected] (S.-M. Lee). http://dx.doi.org/10.1016/j.ejphar.2015.08.001 0014-2999/& 2015 Elsevier B.V. All rights reserved.
hydroperitoneum. It is associated with high patient mortality, and except for liver transplantation, there is no available therapy. Fundamental questions regarding the cellular and molecular pathogenesis of experimental and clinical FHF remain unsolved. Lipopolysaccharide (LPS) in combination with D-galactosamine (GalN)-induced liver injury is a promising experimental animal model that is clinically similar to FHF (Nakama et al., 2001). Upon activation by GalN/LPS, macrophages produce proinflammatory cytokines, including tumor necrosis factor (TNF)-α, and IL-6 that stimulate numerous inflammatory responses (He et al., 2001). Activation of pattern recognition receptors (PRRs) signaling plays a key role in the innate immune response to infectious and inflammatory diseases. PRRs interact with microbial pathogens, called pathogen-associated molecular patterns (PAMPs), as well as with endogenous molecules released during cell damage, termed damage-associated molecular patterns (DAMPs) (Janeway and Medzhitov, 2002; Srikrishna and Freeze, 2009). In GalN/LPS-induced liver injury, LPS and high-mobility group box 1 (HMGB1) are typical examples of PAMP and DAMP, respectively (Wang et al., 2013). Toll-like receptor (TLR) 4 and the receptor for advanced
614
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
glycation end products (RAGE), a family of PRRs, are known as typical primary receptors for LPS and HMGB1 (Ibrahim et al., 2013). These receptor–ligand interactions result in the rapid activation of pro-inflammatory intracellular signaling cascades, including activation of nuclear factor (NF)-κB and phosphorylation of mitogen-activated protein kinases (MAPK) (Botos et al., 2011). Ben Ari et al. (2012) reported that administration of GalN/LPS upregulates hepatic TLR4 mRNA expression, and gene silencing of TLR4 attenuates the inflammatory response and liver injury. Recombinant soluble RAGE, which is the carboxyl-terminal truncated isoform of RAGE, showed potent anti-inflammatory effects against endotoxin-induced lung injury (Zhang et al., 2008). Furthermore, Kuhla et al. (2013) demonstrated that blocking RAGE has potent anti-inflammatory properties, as indicated by attenuation of GalN/ LPS-induced liver injury. Agastache rugosa (Fisch. et Meyer) O. Kuntze (A. rugosa, Labiatae), commonly known as Korean mint, is a perennial aromatic herb belonging to the Labiatae family. It is widely used as a food spice and is consumed as a traditional medicine for colds, vomiting, and furuncles. We screened 70% ethanol extracts of A. rugosa and its active components for hepatoprotective agents. Among them, β-caryophyllene (4,11,11-trimethyl-8-methylene-bicyclo [7.2.0]undec-4-ene, BCP), a major active bicyclic sesquiterpene of A. rugosa, showed a hepatoprotective effect in primary hepatocytes (data not shown). Many studies have shown various biological effects of BCP including anti-inflammatory, antibacterial and anticancer properties (Legault and Pichette, 2007; Sain et al., 2014). In addition, BCP demonstrated potent neuroprotective activity by decreasing ischemia/reperfusion-induced cortical cell death and production of inflammatory mediators in vitro and attenuating cortical infarction and neurological deficits in vivo (Chang et al., 2013). BCP also protected rat livers from carbon tetrachloride-induced fibrosis by inhibiting hepatic stellate cell activation (Calleja et al., 2013). In this study, we investigated the effect of BCP on GalN/LPSinduced liver injury and the specific molecular mechanisms of protection, particularly focusing on TLR4 and RAGE signaling.
2. Materials and methods 2.1. General experimental procedures Optical rotation, the ability of a chiral molecule to rotate the plane of linearly polarized light, was measured using a JASCO P-1020 polarimeter (JASCO Corporation, Tokyo, Japan). 1H (700 MHz) and 13C NMR (176 MHz) spectra were recorded using a Bruker AVANCE III 700 spectrometer. GC/EIMS data was obtained on an Agilent Technologies 7890A GC system coupled with an Agilent Technologies 5975C inert MSD (Agilent Technologies, Santa Clara, CA, USA) operating in EI mode (70 eV). Column chromatography was carried out on Sephadex LH-20 (25100 μm; Sigma-Aldrich, St. Louis, MO, USA), silica gel 60 (230 400 mesh; Merck, Darmstadt, Germany), and LiChroprep RP-18 (40 63 μm; Merck). TLC was performed on pre-coated silica gel 60 F254 plates (20 20 cm2, 0.25 mm; Merck) and RP-18 F254s plates (20 20 cm2, 0.25 mm; Merck). 2.2. Plant material The aerial parts of A. rugosa (Fisch. et Meyer) O. Kuntze were collected in September 2012 at Gyeongju, Gyeongsangbuk-do, Korea and identified by Prof. Jae-Hyun Lee, College of Oriental Medicine, Dongguk University, Gyeongju, Korea. A voucher specimen (SKKU-Ph-12-01) was deposited in the Herbarium of the School of Pharmacy, Sungkyunkwan University, Suwon, Korea.
2.3. Extraction and isolation The dried aerial parts of A. rugosa (3.25 kg) were cut into small pieces and extracted with MeOH (30 l) three times at room temperature. After maceration, the total filtrate was evaporated to dryness under reduced pressure, and the MeOH extract (228.3 g) was suspended in distilled water (2.0 l). The resulting solution was partitioned consecutively to give hexane (34.1 g), CH2Cl2 (20.0 g), EtOAc (17.9 g), n-BuOH (25.8 g), and H2O (127.2 g) fractions. The hexane fraction was subjected to silica gel column chromatography (stepwise elution with hexane, hexane–CH2Cl2, 10:1, 3:1, 1:1, CH2Cl2, hexane–CH2Cl2–MeOH, 10:10:0.2, 10:10:1, 10:10:2, and CH2Cl2–MeOH, 1:1) resulting in 15 subfractions (H-1 to H-15). Subfraction H-1 was re-chromatographed over an RP-C18 column with 93% MeOH–H2O and MeOH as eluents to afford five further subfractions (H-1-1 to H-1-5). Among these subfractions, H-1-3 was applied to a Sephadex LH-20 column (CH2Cl2–MeOH, 1:1) to obtain compound 1 (512 mg). Compound 1 was obtained as a colorless oil and identified as BCP by comparing its spectroscopic data (1H NMR, 13C NMR and GC/EIMS) and optical rotation ([α ]23 D – 14.8° (c 0.85, CHCl3)) with values in the literature (Barrero et al., 1995). BCP was determined to be 96.8% pure by GC analysis. 2.4. Animals and drug treatment Male ICR mice weighing 24 26 g (Orient Bio Inc., Seongnam, Korea) were kept in a temperature- and humidity-controlled room (257 1 °C and 55 75%, respectively) under a 12 h light–dark cycle. All experiments were approved by the Animal Care Committee of the Sungkyunkwan University School of Pharmacy (SUSP14-36) and performed in accordance with the guidelines of the National Institutes of Health (NIH publication No. 86-23, revised 1985). Mice were fasted for 18 h before each experiment but given tap water ad libitum. Mice were injected intraperitoneally with GalN (800 mg/kg; Sigma-Aldrich) and LPS (40 μg/kg Escherichia coli O111:B4; Sigma-Aldrich) dissolved in phosphate-buffered saline (PBS). BCP (50, 100 and 200 mg/kg) was dissolved in 10% Tween 80-saline and intraperitoneally administered 1 h before GalN/LPS treatment; non-BCP groups received an equivalent volume of 10% Tween 80-saline as the vehicle. The timing of BCP treatments was selected based on a previous report (Paula-Freire et al., 2014). Animals were randomly divided into six groups (each group, n¼ 8 10): (1) vehicle-treated control (control), (2) BCP at 200 mg/ kg-treated control (BCP), (3) vehicle-treated GalN/LPS (GalN/LPS), (4) BCP at 50 mg/kg-treated GalN/LPS (BCP 50 mg/kg þGalN/LPS), (5) BCP at 100 mg/kg-treated GalN/LPS (BCP 100 mg/kg þGalN/ LPS), and (6) BCP at 200 mg/kg-treated GalN/LPS (BCP 200 mg/ kg þGalN/LPS). Mice were killed 1 h or 6 h after GalN/LPS injection, and blood and liver samples were collected. 2.5. Kupffer cells (KCs) isolation and drug treatment Mice liver was perfused through the inferior vena cava with Ca2 þ - and Mg2 þ -free Hank’s balanced salt solution (HBSS) at 37 °C for 5 min at a flow rate of 5 ml/min, and subsequently perfused with HBSS containing 0.04% collagenase IV at 37 °C for 10 min. After the liver was digested, it was excised and cut into small pieces in collagenase buffer. The suspension was filtered through cell strainer and the filtrate was centrifuged two times at 50 g for 4 min at 4 °C to both parenchymal cells (pellets) and nonparenchymal cells (supernatant). The nonparenchymal cell fraction (mostly KCs) in the supernatant was washed and centrifuged at 320 g for 5 min at 4 °C. Cell pellets were suspended in RPMI 1640 and centrifuged on a density cushion of Percoll (25% and 50%) at 800 g for 15 min at 4 °C. The KCs fraction was collected,
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
centrifuged at 320 g for 5 min and suspended again in RPMI 1640. The purity of KCs preparation exceeds 90% by light microscopy and viability was typically more that 95% by trypan blue exclusion assay. KCs were cultured in 24-well culture plate at density of 2 105 cells/well in RPMI 1640 supplemented with 10% FBS and antibiotics (100 U/ml of penicillin G and 100 mg/ml of streptomycin) at 37 °C in the presence of 5% CO2. Experiments were carried out 24 h after the cells were seeded. Cells were treated with various concentrations of BCP (25 200 μmol/l) 1 h before LPS (1 μg/ml) stimulation. After 24 h incubation, the culture media and cells were harvested for further analysis. 2.6. Nitrite assay
615
Table 1 Real-time qRT-PCR primers used in this study. Gene (accession number)
Primer (5’-3’)
Product length
TLR4 (NM_021297. 2) RAGE (NM_ 001271422.1) β-Actin (NM_ 007393.4)
Forward: Reverse: Forward: Reverse: Forward: Reverse:
129
ATGGCATGGCTTACACCACC GAGGCCAATTTTGTCTCCACA ACTACCGAGTCCGAGTCTAC CCCACCTTATTAGGGACACTGG GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
91 154
qRT-PCR, quantitative reverse transcription polymerase chain reaction; RAGE, receptor for advanced glycation end products; TLR4, toll-like receptor 4.
Fifty microliters of culture medium was transferred to new 96well plate and equal volume of Griess reagent (1% sulfanilamide in 5% phosphoric acid and 0.1% naphthylethylenediamine dihydrochloride in distilled water) was mixed, and the absorvance of the mixture at 540 nm was determined with a microplate reader (Emax; Molecular Devices, Sunnyvale, CA, USA). 2.7. Small interfering RNA (siRNA) gene silencing of TLR4 and RAGE The siRNAs for TLR4, RAGE and non-specific control were purchased from Bioneer (AccuTarget™ predesigned siRNA; Daejeon, Korea). siRNA (90 μg) was diluted in 50 μl of 10% glucose solution, and the volume was adjusted to 100 μl using RNase/ s DNase-free water. In a separate tube, 14.4 μl of in vivo-jetPEI (Polyplus Transfection, Illkirch, France) was diluted in 50 μl of 10% glucose solution, and the volume was adjusted to 100 μl. The solutions were mixed and incubated for 15 min to allow the complexes to form. TLR4, RAGE or non-specific control siRNAs were injected via the tail once a day for 2 days. KCs were isolated 2 days after the last siRNA injection. The siRNAs significantly decreased the levels of TLR4 and RAGE protein expression to 16.5% and 21.4%, respectively, compared to those of control siRNA-treated group (supplementary Fig. 1). 2.8. Lethality and serum alanine aminotransferase (ALT) activity The survival rate of animals was monitored during the 24 h after GalN/LPS treatment. Serum ALT activity was measured 6 h after GalN/LPS injection by a standard spectrophotometric procedure using a ChemiLab ALT assay kit (IVDLab Co., Ltd., Uiwang, Korea). 2.9. Histological analysis Liver sections were stained as described previously (Kim et al., 2012). Liver specimens for histopathological analysis were obtained 6 h after GalN/LPS injection. Samples were fixed in 10% neutral-buffered formalin, embedded in paraffin, sliced into 5 μm sections, and stained with hematoxylin and eosin (H&E) for blinded histological assessment. Histological changes were evaluated in randomly chosen histological fields at 200 magnification. 2.10. Serum TNF-α and IL-6 levels Circulating levels of TNF-α and IL-6 were quantified 1 h after GalN/LPS injection using commercial mouse enzyme-linked immunosorbent assay kits (eBioscience, San Diego, CA, USA), according to the manufacturer’s instructions. 2.11. Isolation of cytosolic and nuclear proteins Fresh liver tissue was isolated and homogenized in PRO-PREP (iNtRON Biotechnology Inc., Seongnam, Korea) for whole protein
Fig. 1. Effect of BCP on lethality induced by GalN/LPS. All groups consisted of 10 mice. Mice were intraperitoneally administered vehicle (10% Tween 80-saline) or BCP (50, 100 or 200 mg/kg) 1 h before GalN (800 mg/kg)/LPS (40 μg/kg) treatment. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide.
Table 2 Effect of BCP on serum ALT activity in mice after GalN/LPS injection. Group Control BCP GalN/LPS BCP þ GalN/LPS
Dose (mg/kg)
200 50 100 200
ALT (U/l) 63.1 77.4 72.5 7 5.8 666.7 782.5b 377.4 723.8b,c 352.47 23.9a,c 253.5 7 29.3c
Liver damage was assessed 6h after GalN/LPS injection by measurement of circulating serum ALT activity. Mice were intraperitoneally administered BCP (50, 100 and 200 mg/kg) 1 h before GalN/LPS injection (n¼8–10). The values are represented as mean 7 S.E.M. ALT, alanine aminotransferase; BCP, β-caryophyllene; GalN/LPS, d-galactosamine/lipopolysaccharide. a b c
Denotes significant difference (Po 0.05) versus control group. Denotes significant difference (P o 0.01) versus control group. Denotes significant difference (P o0.01) versus GalN/LPS group.
samples and in NE-PER (Pierce Biotechnology Inc., Rockford, IL, USA) for nuclear and cytosolic protein samples, according to the manufacturer’s instructions. Protein concentrations were determined using a BCA Protein Assay kit (Pierce Biotechnology Inc.). 2.12. Serum preparation for HMGB1 analysis Serum samples were filtered and concentrated using Centricon YM-100 and YM-10 devices (Millipore, Billerica, MA, USA) with fixed-angle (35°), 7500 g for 15 min, 4 °C. Concentrated samples were subjected to 10% sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE).
616
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
Fig. 2. Effect of BCP on the histological changes in the liver 6 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/ LPS injection (n¼ 8 10). Typical images were chosen from each experimental group (original magnification 200 ): (A) control; (B) BCP, normal hepatic architecture; (C) GalN/LPS, extensive areas of inflammation, necrosis, and lymphocyte infiltration around the overall area; and (D) BCP þ GalN/LPS, mild hepatocellular damages and inflammatory infiltration. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide.
Table 3 Effect of BCP on serum TNF-α and IL-6 levels in mice after GalN/LPS injection. Group
TNF-α (pg/ml)
IL-6 (pg/ml)
Control BCP GalN/LPS BCP þ GalN/LPS
13.6 7 0.9 13.1 þ0.8 69.0 7 13.1a 18.17 2.2b
45.8 7 8.1 36.0 7 1.2 1149.5 7 150.0a 672.0 7 93.7a,b
The levels of serum TNF-α and IL-6 were determined at 1h after GalN/LPS injection. Mice were intraperitoneally administered 200 mg/kg BCP 1 h before GalN/LPS injection (n¼8–10). The values are represented as mean7 S.E.M. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide; IL, interleukin; TNF, tumor necrosis factor. a b
Denotes significant difference (P o0.01) versus control group. Denotes significant difference (Po 0.01) versus GalN/LPS group.
content of TLR4, RAGE, NF-κB, phosphorylated (phospho)-p38, p38, phospho-extracellular signal-related kinases (ERK), ERK, phospho-c-Jun N-terminal kinases (JNK), JNK, early growth response protein (Egr)-1 and macrophage inflammatory protein (MIP)-2 protein expression. Protein samples were separated by 10 17% SDS/PAGE and transferred to polyvinylidene fluoride membranes using the Semi-Dry Trans-Blot Cell (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were washed with 0.1% Tween 20 in 1 Tris-buffered saline (TBS/T) and blocked for 1 h at room temperature with 5% (w/v) skim milk powder or 5% (w/v) bovine serum albumin powder in TBS/T. Blocked blots were incubated overnight at 4 °C with primary antibodies, washed 5 times for 8 min each in TBS/T, and incubated with the appropriate secondary antibodies for 1 h at room temperature, followed by detection using an ECL detection system (iNtRON Biotechnology Inc.), according to the manufacturer’s instructions. The intensity of the immunoreactive bands was determined using TotalLab TL 120 software (Nonlinear Dynamics Ltd., Newcastle, UK). The following primary antibodies were used: phospho-p38, p38, phospho-ERK, ERK, phospho-JNK, JNK (all from Cell Signaling Technology, Beverly, MA, USA); NF-κB and lamin B (both from Abcam, Cambridge, MA, USA); TLR4, RAGE, Egr-1 and MIP-2 (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA); and β-actin (Sigma-Aldrich). Protein densities were standardized to β-actin and lamin B for total lysates and nuclear fractions, respectively. 2.14. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Fig. 3. Effect of BCP on serum HMGB1 release in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). The values are represented as mean 7 S.E.M. **Denotes significant difference (Po 0.01) versus control group; þ þ Denotes significant difference (Po 0.01) versus GalN/LPS group. BCP, β-caryophyllene; GalN/ LPS, D-galactosamine/lipopolysaccharide; HMGB1, high-mobility group box 1.
2.13. Western blot immunoassay Soluble protein sample 16 μg was used to determine the
s
Total RNA was extracted from KCs using RNeasy Mini Kit (Qiagen, Limburg, Netherlands), and the first strand of cDNA was synthesized by reverse transcription (EcoDryTM cDNA Synthesis Premix, Takara Bio Inc.). The cDNA was amplified using real-time s qRT-PCR with a thermocycler (Lightcycler Nano, Roche Applied Science, Mannheim, Germany) and SYBR Green detection system (Roche Applied Science). Real-time qRT-PCR was performed with specific amplification cycling conditions as follows: 45 cycles of
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
617
Fig. 4. Effect of BCP on TLR4 and RAGE protein expression in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). TLR4 and RAGE levels in the liver were measured by western blot analysis 1 h after GalN/LPS injection. The values are represented as mean 7 S.E.M. *,**Denote significant differences (Po 0.05, Po 0.01) versus control group; þ þ Denotes significant difference (Po 0.01) versus GalN/LPS group. BCP, β-caryophyllene; GalN/LPS, D-galactosamine/lipopolysaccharide; RAGE, receptor for advanced glycation end products; TLR, toll-like receptor.
Fig. 5. Effect of BCP on MAPK phosphorylation (A) and nuclear NF-κB protein expression (B) in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered vehicle or 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). Total and phospho-p38, ERK and JNK levels in the liver were measured by western blot analysis 1 h after GalN/LPS injection. NF-κB was measured on the nuclear extracts from liver by western blot analysis 1 h after GalN/LPS injection. The values are represented as mean 7S.E.M. *,**Denote significant differences (P o 0.05, Po 0.01) versus control group; þ , þ þ Denote significant differences (Po 0.05, P o0.01) versus GalN/LPS group. BCP, β-caryophyllene; ERK, extracellular signal-related kinase; GalN/LPS, D-galactosamine/lipopolysaccharide; JNK, c-Jun N-terminal kinases; MAPK, mitogen-activated protein kinases; NF-κB, nuclear factor κB.
95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s for TLR4; 45 cycles of 95 °C for 30 s, 50.5 °C for 30 s, 72 °C for 30 s for RAGE; 45 cycles of 94 °C for 30 s, 62 °C for 30 s, 72 °C for 30 s for β-actin. All reactions included an initial denaturation step at 94 °C for 5 min and a final extension step at 72 °C for 7 min. The gene-specific primers are listed in Table 1. The levels of mRNA expression were normalized to the level of the β-actin mRNA expression and expressed relative to the average of all ΔCt-values in each sample using the cycle threshold (Ct) method.
2.15. Statistical analysis Results are presented as mean 7 standard error of the mean (S. E.M.). Survival data were analyzed by Kaplan–Meier curves and the log-rank test. The overall significance of results was analyzed by one-way analysis of variance. Differences between compared groups were considered statistically significant at P o0.05 with the appropriate Bonferroni correction for multiple comparisons.
3. Results 3.1. BCP ameliorates GalN/LPS-induced fulminant hepatic failure To investigate the role of BCP on GalN/LPS-induced lethality and hepatic injury, we initially observed the survival rate within 24 h after GalN/LPS administration. As shown in Fig. 1, the mice began to die 6 h after GalN/LPS administration. The survival rate was 90% at 6 h and stabilized at 20% 23 h after GalN/LPS administration. However, pretreatment with BCP (50, 100 and 200 mg/ kg) before GalN/LPS injection reduced the mortality in a dosedependent manner. The serum ALT activity, which is a serum marker of hepatocyte necrosis, was 63.1 77.4 U/l in the control group. In the GalN/LPS group, the level of serum ALT significantly increased to 666.7 782.5 U/l 6 h after GalN/LPS injection. This increase was attenuated by pretreatment with BCP at 50, 100 and 200 mg/kg (Table 2). BCP alone at 200 mg/kg did not affect the lethality or serum ALT levels. Based on these results, BCP at 200 mg/kg was selected as the optimal effective dose for
618
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
evaluating the molecular mechanisms of BCP against GalN/LPSinduced hepatic injury. The histological features of the control group indicated a normal liver lobular architecture and cell structure (Fig. 2A). BCP alone did not affect the histological features (Fig. 2B). However, 6 h after exposure to GalN/LPS, the livers showed multiple areas of portal inflammation and hemorrhagic necrosis, as well as a severe increase in inflammatory cell infiltration (Fig. 2C). These pathological alterations were ameliorated by BCP treatment (Fig. 2D). 3.2. BCP modulates TNF-α and IL-6 production in GalN/LPS-induced fulminant hepatic failure In the control group, serum levels of both TNF-α and IL-6 were low (Table 3). The serum levels of TNF-α and IL-6 increased 1 h after GalN/LPS injection to 4.5-fold and 25.4-fold, respectively, compared with those in the control group. However, pretreatment with BCP attenuated these increases. 3.3. BCP suppresses serum HMGB1 release in GalN/LPS-induced fulminant hepatic failure Extracellular HMGB1 secreted by activated immune cells during cellular stress plays as a cytokine mediator of inflammation through binding to PRRs (Yasuda et al., 2007). As shown in Fig. 3, at 1 h after GalN/LPS injection, the serum level of HMGB1 increased to 5.1-fold compared with that of the control group. This increase was attenuated by BCP pretreatment. 3.4. BCP suppresses hepatic TLR4 and RAGE activation in GalN/LPSinduced fulminant hepatic failure TLR4 and RAGE recognize and bind to LPS and HMGB1, which subsequently trigger NF-κB and MAPK activation (Visintin et al., 2003; Botos et al., 2011). As shown in Fig. 4, the hepatic levels of TLR4 and RAGE protein content in control animals were very low, but 1 h after GalN/LPS injection, the levels of TLR4 and RAGE protein expression increased to 2.6- and 2.1-fold, respectively, compared with those in the control group. These increases were attenuated by pretreatment with BCP. 3.5. BCP suppresses NF-κB and MAPK activation in GalN/LPS-induced fulminant hepatic failure Nuclear levels of NF-κB protein expression showed a marked increase to 17.0 times that of the control group. This increase was also attenuated by BCP pretreatment (Fig. 5A). Phosphorylation of p38, ERK, and JNK showed a significant increase 1 h after GalN/LPS injection to 1.7, 2.1, and 3.0 times, respectively, those of the control group. These increases were attenuated by BCP pretreatment (Fig. 5B). 3.6. BCP suppresses Egr-1 and MIP-2 protein expression in GalN/LPSinduced fulminant hepatic failure Transcription factor Egr-1 immediately responds to MAPK activation, and mediates various chemokines production including MIP-2 (Yan et al., 2000). The nuclear Egr-1 and total MIP-2 protein levels increased to 2.2 and 1.6 times those of the control group, respectively, 1 h after GalN/LPS injection. These increases were attenuated by BCP pretreatment (Fig. 6). 3.7. BCP inhibits TLR4 and RAGE signaling in LPS-treated KCs To ensure the hepatoprotective effect of BCP against GalN/LPSinduced liver injury through suppressing TLR4 and RAGE
Fig. 6. Effect of BCP on nuclear Egr-1 protein expression and MIP-2 protein expression in the liver 1 h after GalN/LPS injection. Mice were intraperitoneally administered 200 mg/kg BCP 1 h before GalN/LPS injection (n¼ 8 10). Egr-1 was measured on the nuclear extracts from liver by western blot analysis 1 h after GalN/ LPS injection. MIP-2 in the liver was measured by western blot analysis 1 h after GalN/LPS injection. The values are represented as mean 7 S.E.M. *,**Denote significant differences (Po 0.05, P o0.01) versus control group; þ þ Denotes significant difference (Po 0.01) versus GalN/LPS group. BCP, β-caryophyllene; Egr-1, early growth response protein 1; GalN/LPS, D-galactosamine/lipopolysaccharide; MIP, macrophage inflammatory protein.
activation, we pretreated BCP on LPS-activated KCs. BCP (200 μmol/l) did not display any cellular toxicity in KCs (Fig. 7A). LPS increased the production of nitrites, TNF-α and IL-6 by approximately 5.6-fold, 6.1-fold and 4.4-fold in KCs, compared with those of control group, respectively, all of which were suppressed by BCP treatment (Fig. 7B–D). LPS also increased the levels of TLR4 and RAGE mRNA expression by approximately 9.2 and 5.3-fold compared with those of control group, respectively. These increases were suppressed by BCP pretreatment (Fig. 7E). To further verify the involvement of TLR4 and RAGE signaling in the protective effects of BCP, TLR4 and RAGE siRNA was performed in KCs. Non-specific control siRNA transfection did not affect any parameters with regard to the effect of BCP on LPS-activated KCs. As shown in Fig. 8, TLR4 and RAGE siRNA significantly blunted LPSinduced production of TNF-α and IL-6 compared with those of non-specific control siRNA, respectively, and, treatment of BCP further suppressed the TNF-α and IL-6 levels.
4. Discussion BCP, a bioactive herbal ingredient isolated from A. rugosa, is a natural bicyclic sesquiterpene that is a constituent of many essential oils. In a previous study conducted by Gertsch et al. (2008), BCP was shown to be a selective agonist of cannabinoid receptor type-2 and to exert significant cannabimimetic anti-inflammatory effects in mice. Antinociceptive, neuroprotective, and antibacterial
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
619
Fig. 7. Effect of BCP on cell viability (A), production of nitrites (B), TNF-α level (C), IL-6 level (D) and, TLR4 and RAGE mRNA expression (E) in LPS-treated isolated KCs from mice liver. KCs were pretreated with various concentrations of BCP (25–200 μmol/l), followed by stimulation with LPS (1 μg/ml) for 24 h. The values are represented as mean 7 S.E.M. *,**Denote significant differences (Po 0.05, P o0.01) versus control group; þ , þ þ Denote significant differences (Po 0.05, Po 0.01) versus LPS group. BCP, βcaryophyllene; IL, interleukin; KCs, Kupffer cells; LPS, lipopolysaccharide; RAGE, receptor for advanced glycation end products; TLR, toll-like receptor; TNF, tumor necrosis factor.
activities have also been uncovered (Chang et al., 2013; PaulaFreire et al., 2014). Recently, Calleja et al. (2013) demonstrated the antioxidant effects of BCP from carbon tetrachloride-induced liver fibrosis by inhibiting hepatic stellate cell activation. However, the precise mechanism of BCP against acute liver injury has not been documented. In this study, we demonstrated the hepatoprotective effects of BCP against GalN/LPS-induced FHF in mice. Administration of GalN with LPS in mice causes acute liver injury that closely resembles clinical hepatitis caused by endotoxemia or sepsis in both functional and morphological features (Nakama et al., 2001). For this reason, this model has been widely used to investigate the molecular mechanisms underlying the pathophysiology of FHF and evaluate the biological activities of hepatoprotective agents. In this study, mice treated with GalN/LPS began to die 6 h after GalN/LPS injection, and the mortality reached 80% 24 h after GalN/LPS injection. Furthermore, severe necrosis was observed as a result of GalN/LPS injection, which was indicated by GalN/LPS-induced elevation of serum ALT levels. These increases were attenuated by pretreatment with BCP. The histological observations of the liver samples strongly support these results; GalN/LPS caused various histological changes to the liver, including multiple areas of portal inflammation, necrosis, and severe increase in inflammatory cell infiltration. These alterations were attenuated by BCP pretreatment with the affected livers showing only mild necrosis and mild portal inflammation.
Our results suggest that BCP may have potential clinical applications for treating liver diseases. HMGB1 is a DNA-binding protein, which is present in most eukaryotic cells to stabilize nucleosome formation and facilitate gene transcription. However, when released into the extracellular milieu, HMGB1 functions as a prototype DAMP, which is associated with many inflammatory diseases such as ischemia-reperfusion injury, acute pancreatitis, and endotoxemia by PRRs stimulation (Tsung et al., 2005; Yang et al., 2004; Yasuda et al., 2007). A previous study identified HMGB1 as a late mediator of inflammation in LPS-induced endotoxemia (Hasunuma et al., 2002). Meanwhile, Wang et al. (2013) showed that plasma HMGB1 levels increased in the very early stages of GalN/LPS-induced acute liver failure, and neutralizing antibodies as well as siRNA targeting HMGB1 significantly improve the survival rate of GalN/LPS-treated mice. In this study, we showed that serum HMGB1 levels markedly increased 1 h after GalN/LPS treatment and that pretreatment with BCP attenuated the serum HMGB1 levels. TLRs and RAGE, a family of PRRs, play critical roles in the innate immune system by interacting with microbial pathogens as well as endogenous molecules released during cell damage. Both of these receptors share several common ligands, including LPS and HMGB1 (Visintin et al., 2003; Yang et al., 2012). Activation of TLRs and RAGE by ligand binding leads to pro-inflammatory intracellular signaling cascades that, in turn, result in the
620
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
Fig. 8. Effect of BCP on production of proinflammatory cytokines production in respective TLR4 and RAGE siRNA-transfected KCs with LPS treatment. TLR4 and RAGE siRNA-transfected KCs were pretreated with BCP (200 μmol/l), followed by stimulation with LPS (1 μg/ml) for 24 h. The values are represented as mean7 S.E. M. **Denotes significant difference (Po 0.05) versus control siRNA-treated control group; þ , þ þ Denote significant differences (P o0.05, Po 0.01) versus control siRNA-treated LPS group. #,##Denote significant differences (Po 0.05, P o0.01) versus siRNA-treated control group. $Denotes significant difference (Po 0.05) versus siRNA-treated LPS group. BCP, β-caryophyllene; IL, interleukin; KCs, Kupffer cells; LPS, lipopolysaccharide; RAGE, receptor for advanced glycation end products; TLR, tolllike receptor; TNF, tumor necrosis factor.
overexpression of genes for cytokines, growth factors, and adhesion molecules (Botos et al., 2011). Recently, it was suggested that RAGE and some members of the TLRs, especially TLR4, functionally interact to coordinate and regulate immune and inflammatory responses (Ibrahim et al., 2013). RAGE also appears to interact with the toll-interleukin 1 receptor domain containing an adaptor protein and myeloid differentiation primary response gene 88, both of which are intracellular adaptor molecules associated with TLRs to activate downstream signaling (Sakaguchi et al., 2011). The TLR4 antagonist E5564 exhibits hepatoprotective effects by inhibiting endotoxin-induced TNF-α overproduction of macrophages in GalN/LPS-induced liver injury (Kitazawa et al., 2010). In our previous study, scoparone, a major component of Artemisia capillaris (Compositae), showed a hepatoprotective effect against GalN/LPS-induced liver injury via inhibition of the TLR4 signaling pathway (Kang et al., 2013). Recently, Kuhla et al. (2013) demonstrated that activation of RAGE by GalN/LPS injection causes a rapid induction of pro-inflammatory intracellular signaling cascades. In our present study, TLR and RAGE levels markedly increased in both mice challenged by GalN/LPS and LPS-treated KCs. These alterations were attenuated by BCP pretreatment, which suggests that BCP simultaneously down-regulates TLR and RAGE expression. Activation of the TLR4 and RAGE signaling pathways results in the activation of NF-κB to induce expression of proinflammatory cytokine genes (Arancibia et al., 2007; Bierhaus et al., 2005). Previous studies demonstrated a significant decrease in hepatic NF-κB
activation in gene deletions of TLR4 as well as blockade of RAGE by soluble RAGE in mice compared with wild-type mice following induction of hepatic injury by GalN/LPS (Ben Ari et al., 2012; Kuhla et al., 2013). Simultaneously, the activated TLR4 and RAGE also stimulates MAPK pathway, one of the most widespread mechanisms of cell regulation, leading to upregulation of proinflammatory mediators and cell death (Pearson et al., 2001). ERKs, p38 MAPK, and JNKs are three major groups of the MAPK family. In GalN/LPSinduced liver injury, activated MAPKs contribute to the inflammatory response following GalN/LPS intoxication (Kang et al., 2013). In our current study, GalN/LPS significantly increased activation of NF-κB as well as ERK, p38 MAPK, and JNK. In addition, serum TNF-α and IL-6 levels also markedly increased after GalN/ LPS injection. These changes were attenuated by pretreatment with BCP. Our results suggest that the anti-inflammatory response following BCP pretreatment is associated with suppression of NFκB and MAPK activation. Egr-1 is a zinc-finger transcriptional regulator that regulates diverse cellular processes including cell growth, proliferation, differentiation, and death in response to extracellular stimuli. Activation of Egr-1 induced by MAPKs induces expression of various proinflammatory cytokines (TNF-α and IL-1β) as well as chemokines (MIP-2, monocyte chemotactic protein (MCP)-1, and intercellular adhesion molecule (ICAM)-1) (Yan et al., 2000). Pritchard et al. (2007) demonstrated an important role for Egr-1 in the development and progression of GalN/LPS-induced acute liver injury by enhancing expression of TNF-α, MIP-2, MCP-1, and ICAM-1. In our study, the levels of Egr-1 and MIP-2 expression increased after GalN/LPS injection and were attenuated by BCP. Our results imply that BCP inhibits the RAGE-mediated Egr-1 pathway.
5. Conclusions
β-Caryophyllene ameliorates GalN/LPS-induced liver damage through suppression of TLR4 and RAGE-mediated inflammatory signaling pathways. Thus, β-caryophyllene might be useful as a potential therapeutic medication for preventing fulminant hepatic failure. Acknowledgments This research was supported by a Grant (12172MFDS989) from the Ministry of Food and Drug Safety, South Korea in 2013 (“Studies on the Identification of Efficacy of Biologically Active Components from Oriental Herbal Medicines”) and the National Research Foundation of Korea (NRF) grant funded by the Korean government (MEST), South Korea (2012R1A5A2A28671860). Hong-Ik Cho (NRF-2012H1A2A1016419) received ‘Global Ph.D. Fellowship Program’ support from the NRF, South Korea funded by the Ministry of Education, Science, and Technology (MEST) in Korea.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ejphar.2015.08.001.
References Arancibia, S.A., Beltran, C.J., Aguirre, I.M., Silva, P., Peralta, A.L., Malinarich, F., Hermoso, M.A., 2007. Toll-like receptors are key participants in innate immune responses. Biol. Res. 40, 97–112.
H.-I. Cho et al. / European Journal of Pharmacology 764 (2015) 613–621
Barrero, A.F., Molina, J., Oltra, J.E., Altarejos, J., Barragan, A., Lara, A., Segura, M., 1995. Stereochemistry of 14-hydroxy-beta-caryophyllene and related-compounds. Tetrahedron 51, 3813–3822. Ben Ari, Z., Avlas, O., Pappo, O., Zilbermints, V., Cheporko, Y., Bachmetov, L., Zemel, R., Shainberg, A., Sharon, E., Grief, F., Hochhauser, E., 2012. Reduced hepatic injury in Toll-like receptor 4-deficient mice following D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure. Cell. Physiol. Biochem. 29, 41–50. Bierhaus, A., Humpert, P.M., Morcos, M., Wendt, T., Chavakis, T., Arnold, B., Stern, D. M., Nawroth, P.P., 2005. Understanding RAGE, the receptor for advanced glycation end products. J. Mol. Med. (Berl.) 83, 876–886. Botos, I., Segal, D.M., Davies, D.R., 2011. The structural biology of Toll-like receptors. Structure 19, 447–459. Calleja, M.A., Vieites, J.M., Montero-Melendez, T., Torres, M.I., Faus, M.J., Gil, A., Suarez, A., 2013. The antioxidant effect of beta-caryophyllene protects rat liver from carbon tetrachloride-induced fibrosis by inhibiting hepatic stellate cell activation. Br. J. Nutr 109, 394–401. Chang, H.J., Kim, J.M., Lee, J.C., Kim, W.K., Chun, H.S., 2013. Protective effect of betacaryophyllene, a natural bicyclic sesquiterpene, against cerebral ischemic injury. J. Med. Food 16, 471–480. Gertsch, J., Leonti, M., Raduner, S., Racz, I., Chen, J.Z., Xie, X.Q., Altmann, K.H., Karsak, M., Zimmer, A., 2008. Beta-caryophyllene is a dietary cannabinoid. Proc. Natl. Acad. Sci. USA 105, 9099–9104. Hasunuma, R., Maruyama, H., Takimoto, H., Ryll, R., Tanaka, S., Kumazawa, Y., 2002. Does high mobility group 1 protein function as a late mediator for LPS- or TNFinduced shock in galactosamine-sensitized mice? J. Endotoxin Res. 8, 391–398. He, P., Noda, Y., Sugiyama, K., 2001. Green tea suppresses lipopolysaccharide-induced liver injury in D-galactosamine-sensitized rats. J. Nutr. 131, 1560–1567. Ibrahim, Z.A., Armour, C.L., Phipps, S., Sukkar, M.B., 2013. RAGE and TLRs: relatives, friends or neighbours? Mol. Immunol. 56, 739–744. Janeway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Kang, J.W., Kim, D.W., Choi, J.S., Kim, Y.S., Lee, S.M., 2013. Scoparone attenuates Dgalactosamine/lipopolysaccharide-induced fulminant hepatic failure through inhibition of toll-like receptor 4 signaling in mice. Food Chem. Toxicol. 57, 132–139. Kim, D.W., Cho, H.I., Kim, K.M., Kim, S.J., Choi, J.S., Kim, Y.S., Lee, S.M., 2012. Isorhamnetin-3-O-galactoside protects against CCl4-induced hepatic injury in mice. Biomol. Ther. 20, 406–412. Kitazawa, T., Tsujimoto, T., Kawaratani, H., Fukui, H., 2010. Salvage effect of E5564, Toll-like receptor 4 antagonist on D-galactosamine and lipopolysaccharide-induced acute liver failure in rats. J. Gastroenterol. Hepatol. 25, 1009–1012. Kuhla, A., Norden, J., Abshagen, K., Menger, M.D., Vollmar, B., 2013. RAGE blockade and hepatic microcirculation in experimental endotoxaemic liver failure. Br. J. Surg. 100, 1229–1239. Legault, J., Pichette, A., 2007. Potentiating effect of beta-caryophyllene on anticancer activity of alpha-humulene, isocaryophyllene and paclitaxel. J. Pharm. Pharmacol. 59, 1643–1647. Nakama, T., Hirono, S., Moriuchi, A., Hasuike, S., Nagata, K., Hori, T., Ido, A., Hayashi, K., Tsubouchi, H., 2001. Etoposide prevents apoptosis in mouse liver with Dgalactosamine/lipopolysaccharide-induced fulminant hepatic failure resulting in reduction of lethality. Hepatology 33, 1441–1450. Paula-Freire, L.I., Andersen, M.L., Gama, V.S., Molska, G.R., Carlini, E.L., 2014. The oral
621
administration of trans-caryophyllene attenuates acute and chronic pain in mice. Phytomedicine 21, 356–362. Pearson, G., Robinson, F., Beers Gibson, T., Xu, B.E., Karandikar, M., Berman, K., Cobb, M.H., 2001. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22, 153–183. Pritchard, M.T., Roychowdhury, S., McMullen, M.R., Guo, L., Arteel, G.E., Nagy, L.E., 2007. Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G1124–G1133. Sain, S., Naoghare, P.K., Devi, S.S., Daiwile, A., Krishnamurthi, K., Arrigo, P., Chakrabarti, T., 2014. Beta caryophyllene and caryophyllene oxide, isolated from Aegle marmelos, as the potent anti-inflammatory agents against lymphoma and neuroblastoma cells. Antiinflamm. Antiallergy Agents Med. Chem. 13, 45–55. Sakaguchi, M., Murata, H., Yamamoto, K., Ono, T., Sakaguchi, Y., Motoyama, A., Hibino, T., Kataoka, K., Huh, N.H., 2011. TIRAP, an adaptor protein for TLR2/4, transduces a signal from RAGE phosphorylated upon ligand binding. PLoS One 6, e23132. Srikrishna, G., Freeze, H.H., 2009. Endogenous damage-associated molecular pattern molecules at the crossroads of inflammation and cancer. Neoplasia 11, 615–628. Tsung, A., Sahai, R., Tanaka, H., Nakao, A., Fink, M.P., Lotze, M.T., Yang, H., Li, J., Tracey, K.J., Geller, D.A., Billiar, T.R., 2005. The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion. J. Exp. Med. 201, 1135–1143. Visintin, A., Latz, E., Monks, B.G., Espevik, T., Golenbock, D.T., 2003. Lysines 128 and 132 enable lipopolysaccharide binding to MD-2, leading to Toll-like receptor-4 aggregation and signal transduction. J. Biol. Chem. 278, 48313–48320. Wang, W., Sun, L., Deng, Y., Tang, J., 2013. Synergistic effects of antibodies against high-mobility group box 1 and tumor necrosis factor-alpha antibodies on D(þ )-galactosamine hydrochloride/lipopolysaccharide-induced acute liver failure. FEBS J. 280, 1409–1419. Yan, S.F., Fujita, T., Lu, J., Okada, K., Shan Zou, Y., Mackman, N., Pinsky, D.J., Stern, D. M., 2000. Egr-1, a master switch coordinating upregulation of divergent gene families underlying ischemic stress. Nat. Med. 6, 1355–1361. Yang, H., Lundback, P., Ottosson, L., Erlandsson-Harris, H., Venereau, E., Bianchi, M. E., Al-Abed, Y., Andersson, U., Tracey, K.J., Antoine, D.J., 2012. Redox modification of cysteine residues regulates the cytokine activity of high mobility group box-1 (HMGB1). Mol. Med. 18, 250–259. Yang, H., Ochani, M., Li, J., Qiang, X., Tanovic, M., Harris, H.E., Susarla, S.M., Ulloa, L., Wang, H., DiRaimo, R., Czura, C.J., Wang, H., Roth, J., Warren, H.S., Fink, M.P., Fenton, M.J., Andersson, U., Tracey, K.J., 2004. Reversing established sepsis with antagonists of endogenous high-mobility group box 1. Proc. Natl. Acad. Sci. USA 101, 296–301. Yasuda, T., Ueda, T., Shinzeki, M., Sawa, H., Nakajima, T., Takeyama, Y., Kuroda, Y., 2007. Increase of high-mobility group box chromosomal protein 1 in blood and injured organs in experimental severe acute pancreatitis. Pancreas 34, 487–488. Zhang, H., Tasaka, S., Shiraishi, Y., Fukunaga, K., Yamada, W., Seki, H., Ogawa, Y., Miyamoto, K., Nakano, Y., Hasegawa, N., Miyasho, T., Maruyama, I., Ishizaka, A., 2008. Role of soluble receptor for advanced glycation end products on endotoxin-induced lung injury. Am. J. Respir. Crit. Care Med. 178, 356–362.