β-Catenin signaling induces CYP1A1 expression by disrupting adherens junctions in Caco-2 human colon carcinoma cells

Biochimica et Biophysica Acta 1830 (2013) 2509–2516

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbagen

β-Catenin signaling induces CYP1A1 expression by disrupting adherens junctions in Caco-2 human colon carcinoma cells Shuya Kasai a, b, Takanori Ishigaki b, Ryo Takumi b, Toru Kamimura b, Hideaki Kikuchi a, b,⁎ a b

Science of Biosources, United Graduate School of Agricultural Science, Iwate University, Morioka 020-8551, Japan Department of Biochemistry and Molecular Biology, Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki 036-8561, Japan

a r t i c l e

i n f o

Article history: Received 1 June 2012 Received in revised form 15 October 2012 Accepted 12 November 2012 Available online 19 November 2012 Keywords: Aryl hydrocarbon receptor β-Catenin Cytochrome P-450 1A1 E-cadherin E-cadherin carboxy terminal fragment 2 S-MEM

a b s t r a c t Background: The aryl hydrocarbon (Ah) receptor is one of the best known ligand-activated transcription factors. The present study has focused on the wound-healing process on Ah receptor function. Methods: Depletion of calcium from culture medium of Caco-2 human colon carcinoma cells by transfer to Minimal Essential Medium (Spinner Modification; S-MEM) destroyed adherens junctions and the cells were used as the model of wound-healing process. Results: Calcium depletion induced both nuclear translocation of the Ah receptor, and increased expression of CYP1A1 and Slug mRNAs in Caco-2 cells. However, expression of Slug mRNA was not significantly induced by treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Knockdown of the Ah receptor and treatment with Ah receptor antagonists decreased level of CYP1A1 mRNA. The fragment of E-cadherin released by γ-secretase was not involved in induction of CYP1A1 mRNA following S-MEM treatment. Knockdown of β-catenin increased levels of Ah receptor mRNA, which may be attributable to direct or indirect involvement of β-catenin in suppression of the Ah receptor gene. Conclusions: Our results suggest that mRNA induction of some genes by destruction of adherens junctions depends on the Ah receptor. β-Catenin, one of the components of the adherens junction, was released from the E-cadherin complex, which resulted in its increased interaction with the Ah receptor, and was translocated into the nucleus, and consequently the target genes would be transcribed. General significance: Our observations suggest that some aspects of the molecular mechanism of wound healing involve the Ah receptor. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The aryl hydrocarbon (Ah) receptor is an endogenous target molecule for dioxins, and is thought to be a key intermediate in the induction of a variety of types of toxicity [1–3]. The Ah receptor is a ligand-activated transcription factor that belongs to the basic helix-loop-helix (bHLH)/ Per-ARNT-Sim (PAS) protein family. In the absence of ligand, the Ah receptor cytoplasmic complexes with the molecular chaperone heat shock protein 90 (HSP90), the co-chaperone p23, and hepatitis B virus

Abbreviations: ARNT, Ah receptor nuclear translocator; bHLH, basic helix-loop-helix; CTF2, E-cadherin carboxy terminal fragment 2; CYP1A1, cytochrome P-450 1A1; DAPT, N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester; EMT, epithelial– mesenchymal transitions; FoxM1, forkhead box M1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HSP90, shock protein 90; Lef, lymphoid enhancer factor; MAF, 3-methoxy-4-aminoflavone; PAS, Per-ARNT-Sim; S-MEM, Minimal Essential Medium, Spinner Modification; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; XAP-2, hepatitis B virus X-associated protein-2; XRE, xenobiotic-responsive element ⁎ Corresponding author at: Department of Biochemistry and Biotechnology, Faculty of Agriculture and Life Science, Hirosaki University, 3 Bunkyo-cho, Hirosaki 036-8561, Japan. Tel./fax: +81 172 39 3586. E-mail address: [email protected] (H. Kikuchi). 0304-4165/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bbagen.2012.11.007

X-associated protein-2 (XAP-2). The primary role of this complex is to contribute to the stability and cytoplasmic retention of the Ah receptor. Following ligand binding and nuclear translocation, the Ah receptor dissociates from the complex and forms heterodimer with another bHLH/ PAS transcription factor, Ah receptor nuclear translocator (ARNT), and binds to the xenobiotic-responsive element (XRE) consensus sequence [4,5]. There are several reports that ligand binding is not required for transcriptional activation of the Ah receptor after cells have been subjected to treatments such as the administration of omeprazole [6], destruction of cell–cell adherens junctions [7], and hydrodynamic shearing [8]. Transcriptional activation of Slug, which encodes a zinc finger transcriptional repressor that is crucial for the induction of epithelial–mesenchymal transition (EMT), coincides with nuclear accumulation of the Ah receptor in the HaCaT keratinocyte cell line following incubation in calcium-deficient Minimal Essential Medium, Spinner Modification (S-MEM) [9]. Calcagno et al. used microarray analysis to show that the destruction of adherens junctions by treatment with E-cadherin binding peptide induces expression of the gene that encodes cytochrome P450 1A1 (CYP1A1) in the Caco-2 colon carcinoma cell line [10].

2510

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

Adherens junctions are formed by homophilic binding of the membrane-penetrating E-cadherin protein between neighboring cells in a calcium-dependent manner. The intracellular domain of E-cadherin is anchored by interaction with α-catenin, β-catenin, and p120-catenin [11]. β-Catenin is a mediator of canonical wingless (wg, a fly Wnt gene) signal transduction that is initiated by binding of Wnt to Frizzled. With the discovery that β-catenin binds to the T cell factor/lymphoid enhancer factor class of DNA-binding proteins (TCF/Lef) [12], β-catenin has become known as a transcriptional factor that acts downstream of Wnt signaling and controls the expression of a large number of Wnt target genes. The disruption of the adherens-junction-induced, β-catenin-mediated pathway occurs in processes of wound-healing or epithelial–mesenchymal transition. Furthermore, this pathway plays an important role in processes involved in cell growth and development. E-cadherin is one of most important molecules involved in tissue morphogenesis, wound healing, and cell–cell contact [13,14]. E-cadherin-mediated cell–cell contact can be disrupted by changing the culture medium from Dulbecco's Modified Eagle's Medium (DMEM) to calcium-depleted S-MEM, which mimics an early stage of wound healing. Such disruption causes nuclear localization of β-catenin and induction of Slug expression, followed by inhibition of E-cadherin transcription [15]. In the study reported herein, we focused on the role of the Ah receptor in the transcriptional activation of target genes in conjunction with β-catenin and the mechanism of this activation by examining the effects of disrupting adherens junctions in Caco-2 cells by treatment with S-MEM. 2. Materials and methods 2.1. Cell culture and treatment The human colon adenocarcinoma cell line, Caco-2, was cultured in DMEM supplemented with 0.1 U/l penicillin, 0.1 g/l streptomycin, and 5% fetal bovine serum. Cells were maintained in a CO2 incubator at 37 °C in 5% CO2/95% air at 100% humidity. After cells reached 90% confluence, they were passaged in phosphate-buffered saline (PBS) containing 0.25% trypsin and 0.02% EDTA. For all assays, trypsinized cells were inoculated at a density of 10,000 cells/cm 2 and incubated for 1 week, followed by serum deprivation overnight. To disrupt the intercellular junctions of the confluent cell monolayer, cells were washed with PBS and calcium-free S-MEM (Sigma-Aldrich, Saint Louis, MO, USA) supplemented with 2 mM L-glutamine was added. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD; Cambridge Isotope Laboratories, Andover, MA, USA), PD98059 (Wako Pure Chemical Industries, Osaka, Japan), 3-methoxy-4aminoflavone (MAF; a gift from Dr. S. Safe, A & T University, Texas, USA), and N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT; Calbiochem, San Diego, CA, USA), were dissolved in dimethylsulfoxide (DMSO; Sigma-Aldrich) and applied to cells after dilution in the growth media. 2.2. Reverse transcriptase and quantitative polymerase chain reaction (PCR) After treatment, cells were harvested and frozen at − 80 °C. Total RNA was extracted in accordance with the acid guanidinium phenol chloroform method [16] and 5 μg of total RNA was reversetranscribed to cDNA using M-Mul V Reverse Transcriptase (Fermentas, Hanover, MD, USA) in accordance with the manufacturer's instructions. We amplified cDNAs that encoded CYP1A1, Slug, Ah receptor, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using KOD FX Taq polymerase (Toyobo, Osaka, Japan) and the following primer sets: CYP1A1-F, GTATCGGTGAGACCATTGCC and CYP1A1-R, TCTCAAGCAC CTAAGAGCGC; Slug-F, AGACCCTGGTTGCTTCAAGG and Slug-R, TGGAG

CAGTTTTTGCACTGG; Ah receptor-F, GGACTTGGGTCCAGTCTAATGCAC and Ah receptor-R, AGCCAGGAGGGAACTAGGATTGAG; GAPDH-F, CATC ACCATCTTCCAGGAGC and GAPDH-R, GGATGATGTTCTGGAGAGCC. Specific amplification of the cDNAs was confirmed by checking the lengths of the PCR products (predicted lengths of 180, 157, 296, and 404 bp, respectively), and by sequencing the PCR products after insertion into the vector pT7Blue (Novagen, Madison, WI, USA). The same plasmid DNA was used as a standard for the quantification of cDNA copy numbers. 2.3. Protein extraction After treatment, cells were washed and harvested in cold PBS. Total cellular protein was extracted by sonication of the cells in lysis buffer (10 mM Tris, pH 7.5, 150 mM KCl, 2 mM MgCl2, 1 mM Na3VO4, 0.5 mM dithiothreitol, 10% glycerol, 0.5% Triton X-100, and 1% Nonidet P-40) supplemented with protease inhibitor cocktail (0.2 mM PMSF, 2 μg/ml pepstatin, 2 μg/ml leupeptin, 2 μg/ml chymostatin, 2 μg/ml antipain, 2 μg/ml elastatin, and 4 μg/ml aprotinin). The insoluble fraction was removed by centrifugation at 20,000 g for 10 min at 4 °C. Subcellular fractionation of the nuclear extract and cytoplasmic fraction was performed using the method of Dignam et al. [17] with minor modifications. Cells were washed and harvested in cold PBS and collected by centrifugation at 1000 g for 5 min at 4 °C. Cell pellets were suspended in hypotonic buffer (10 mM Tris, pH 7.5, 2 mM MgCl2, 1 mM Na3VO4, 0.5 mM dithiothreitol, 10% glycerol, and 0.5% Nonidet P-40) supplemented with the protease inhibitor cocktail. The suspension was incubated on ice for 10 min and homogenized by vigorous pipetting. Nuclei were collected by centrifugation at 3300 g for 5 min at 4 °C. The supernatant recovered contained the cytoplasmic fraction. The nuclei were washed again with hypotonic buffer without Nonidet P-40, and collected by centrifugation. The nuclear pellet was suspended in high-salt buffer (20 mM Tris, pH 7.5, 0.3 M KCl, 2 mM MgCl2, 1 mM Na3VO4, 0.5 mM dithiothreitol, and 10% glycerol) supplemented with a cocktail of protease inhibitors. Nuclear protein was extracted by incubating the suspension on ice for 30 min and vortexing several times. The insoluble fraction was removed by centrifugation at 20,000 g for 30 min at 4 °C. Protein concentrations were determined by the Bradford protein assay using commercial reagents (Bio-Rad Laboratories, Hercules, CA, USA). 2.4. Immunoprecipitation To extract protein under native conditions, cells were homogenized in low-stringency buffer (20 mM Tris, pH 7.5, 150 mM KCl, 2 mM MgCl2, 5 mM NaF, 5 mM 2-glycerophosphate, 1 mM Na3VO4, 10% glycerol, and 0.1% Nonidet P-40) supplemented with protease inhibitor cocktail. To precipitate the protein complex that contained the Ah receptor, 4 μl of Dynabeads protein G (Invitrogen, Carlsbad, CA, USA) was mixed with 1 μg of either antibody against Ah receptor (Affinity BioReagents, Golden, CO, USA) or normal mouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and rotated for 1 h. Beads were washed with PBS, then mixed with 1 mg of extracted protein in 0.5 ml of lowstringency buffer, and rotated overnight at 4 °C. Beads were washed three times with low-stringency buffer and immunopurified protein was eluted by boiling the beads in Laemmli Sample Buffer. 2.5. Immunoblotting and densitometry Equivalent amounts of extracted proteins were resolved by SDS-PAGE and transferred to a Hybond-P PVDF membrane (GE Healthcare, Buckinghamshire, UK). Ah receptor protein was detected using the protocol of Dr. H. Ashida, Kobe University, Japan [18]. To detect E-cadherin, 3×FLAG, β-catenin, HSP90, XAP-2, or GAPDH, the membrane was blocked with 5% nonfat dried milk dissolved in PBS containing 0.1% Tween 20. Primary antibodies against E-cadherin (DB Transduction

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

Laboratories, Franklin Lakes, NJ, USA), 3 × FLAG (Sigma-Aldrich), β-catenin (DB Transduction Laboratories), HSP90 (Enzo Life Sciences, Farmingdale, NY, USA), XAP-2 (Novus Biologicals, Littleton, CO, USA) or GAPDH (Santa Cruz Biotechnology), and horseradishperoxidase-conjugated secondary antibody (Dako, Glostrup, Denmark) were diluted 1:5000 in blocking buffer. Specific signals were detected using the ECL system (GE Healthcare Biosciences, Tokyo, Japan). Signal intensities were quantified by densitometry using ImageJ software (National Institutes of Health, Bethesda, MD, USA). 2.6. Immunofluorescent staining of E-cadherin Cells were grown on coverslips in a culture dish. After treatment, cells were washed with cold PBS and fixed with a mixture of methanol and acetone (3:7) for 20 min at − 20 °C. Cells were washed with cold PBS and permeabilized by 0.1% Triton X-100 in PBS for 10 min at room temperature. After washing with PBS containing 0.1% Tween 20, cells were blocked with 2% bovine serum albumin (BSA) in PBS for 30 min, and then incubated overnight at 4 °C with primary antibody against E-cadherin (DB Transduction Laboratories) diluted 1:250 in a solution of 2% BSA prepared in PBS. After washing with PBS containing 0.1% Tween 20, the cells were incubated for 30 min at room temperature with Alexa-Fluor-488-conjugated secondary antibody (Invitrogen) diluted 1:250 in 2% BSA prepared in PBS. After washing with PBS containing 0.1% Tween 20, nuclei were stained with 1.6 μg/ml bisbenzimide (Hoechst 33258; Wako Pure Chemical Industries, Osaka, Japan) for 15 min and sealed with 50% glycerol prepared using PBS. Immunofluorescence was detected with a FV-1000 D confocal laser scanning microscope (Olympus, Tokyo, Japan). Bright field images were acquired using a QICAM 12-bit camera (Qimaging, Surrey, BC, Canada) mounted on an IMT-2 microscope (Olympus, Tokyo, Japan). 2.7. DNA constructs and transfection The β-catenin/p3 × FLAG-CMV10 construct was a kind gift from Dr. S. Monga (University of Pittsburgh School of Medicine, PA, USA) [19]. The pcDNA3-myc-β-catenin was a kind gift from Dr. M. Hijikata (Institute for Virus Research, Kyoto University). The E-cadherin carboxy-terminal fragment 2 (CTF2) was cloned by PCR using Caco-2 cDNA, as described previously [20]. The CTF2 mutant 1 (M1), in which amino acid residues 758–760 are mutated to alanines to prevent interaction with p120, and the CTF2 mutant 2 (M2), which lacks the CH3 domain that interacts with β-catenin, were also constructed as described previously [20]. Cells were transfected with plasmid vectors using TransFast™ Transfection Reagent (Promega, Madison, WI, USA) after they had been grown for 5 days and reached 90% confluence, as described previously [21]. After transfection, cells were incubated for a further 2 days, followed by serum deprivation overnight before use in experiments. The reporter gene assay was carried out by transfection of the CYP1A1 promoter (−1566~ +73)-luciferase/pGL3 and LacZ/pCAG constructs, as described previously [22]. The CYP1A1 promoter contains an XRE sequence within the included region; therefore, the expression of CYP1A1 is under the control of the Ah receptor [23]. After transfection and treatment, cells were lysed in Reporter Lysis Buffer (Promega). The insoluble fraction was removed by centrifugation at 20,000 g for 10 min at 4 °C, and the extracted protein was analyzed by using the luciferase and β-galactosidase assays [24]. Transcriptional activity was expressed as fold induction relative to control samples. 2.8. Knockdown of the Ah receptor and β-catenin Small interfering RNAs (siRNAs) were designed to attenuate expression of the Ah receptor [2,25,26], β-catenin [9], and green fluorescent protein (GFP; control) [26]. All siRNAs were synthesized using the

2511

Silencer® siRNA Construction Kit (Ambion, Austin, TX, USA) in accordance with the manufacturer's instructions. The target sequences used were: AhR-3, CCGACUUAAUACAGAGUUG; β-catenin-1, GUCCUGUAUG AGUGGGAAC; β-catenin-2, AGCUGAUAUUGAUGGACAG; β-catenin-3, CAGUUGUGGUUAAGCUCUU; GFP, GGCUACGUCCAGGAGCGCACC. Cells grown in 60-mm culture dishes for 3 days were transferred to Opti-MEM and incubated overnight. The relevant siRNA was mixed with 4 μl of Lipofectamine™ RNAiMAX Reagent (Invitrogen) in Opti-MEM (GIBCO Laboratories Life Technologies, INC., Grand Island, NY, USA) and applied to the cells. After 24 h of incubation, cells were transferred to normal medium and cultured for a further 2 days before use in experiments. 2.9. Statistical analysis Data are expressed as means ± SD and were analyzed using Student's t test. Significant differences (p b 0.01) are indicated using an asterisk. 3. Results 3.1. Induction of Slug and CYP1A1 mRNA by depletion of Ca 2+ from medium Treatment of Caco-2 cells with S-MEM destroyed adherens junctions (Fig. 1B), induced the expression of CYP1A1 mRNA (Fig. 1A), and released β-catenin from E-cadherin-containing complexes in adherens junctions into the cytoplasm (Fig. 1B). Induction of CYP1A1 mRNA was maximal early in the incubation period (around 4 h), after which in general the level of mRNA began to decrease rapidly, although in the case of TCDD treatment, elevated levels of CYP1A1 mRNA were sustained for >12 h. Next, we tested whether Ca 2 + depletion induced the accumulation of transcripts of Slug, another gene with Ah receptor binding sites (XRE) in the promoter. As shown in Fig. 1C, mRNA transcripts for Slug accumulated rapidly following disruption of adherens junctions, but not by the treatment with TCDD (Fig. 1C). CYP1A1 promoter activity increased until 6 h after transfer to S-MEM and was sustained for 24 h, as determined by the luciferase-reporter assay (Fig. 1E). However, the level of induction of Slug mRNA was low compared with that of CYP1A1 mRNA (Fig. 1C and D). Thereafter, we focused on the mechanism of activation of transcription and the function of the Ah receptor by monitoring the accumulation of CYP1A1 mRNA transcripts during the period shortly after the destruction of adherens junctions following treatment with S-MEM. 3.2. Involvement of Ah receptor in the induction of CYP1A1 mRNA After destruction of the adherens junctions, the Ah receptor migrated into the nucleus (Fig. 2A). The involvement of the Ah receptor in the early stage of CYP1A1 mRNA induction was confirmed by experimental knockdown of the Ah receptor (Fig. 2B and C). The induction of CYP1A1 transcription was inhibited by pretreatment of Caco-2 cells with antagonists against the Ah receptor, such as PD98059 or MAF (Fig. 2D and E). This suggests that the unknown endogenous ligand may activate the Ah receptor. 3.3. An E-cadherin fragment is not involved in induction of CYP1A1 by adherens junction destruction The specific product of γ-secretase cleavage of E-cadherin, CTF2, may play a role in the activation of particular target genes. The cadherin-binding protein p120-catenin (p120) enhances the nuclear translocation of CTF2 and is required for specific binding of CTF2 to DNA [20]. Consequently, we investigated whether CTF2 regulated CYP1A1 transcription in the nucleus. Exogenous expression of CTF2

2512

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

Fig. 1. Induction of the accumulation of Slug and CYP1A1 mRNAs by disruption of adherens junctions. (A) Cells were treated with 5 nM TCDD or vehicle (Cont), or the medium replaced with S-MEM or DMEM (Cont), and incubated for 4 h, 8 h or 12 h. The amounts of CYP1A1 and GAPDH mRNAs were determined using RT-PCR, and expressed as the CYP1A1/GAPDH ratio. (B) Cells were treated with S-MEM or DMEM (Cont) for 1 h before acquiring bright-field images or immunofluorescent staining of E-cadherin. (C, D) Caco-2 cells treated with TCDD, vehicle (Cont), or S-MEM for 2 or 4 h were analyzed using RT-PCR to determine the amounts of Slug (C) and CYP1A1 (D) mRNAs. (E) Cells were transfected with CYP1A1 promoter-luciferase/pGL3 and LacZ/pCAG vectors and then treated with S-MEM or TCDD for 3 h, 6 h, 12 h or 24 h. The transcriptional activity was determined by luciferase activity normalized to β-galactosidase activity and protein concentration, and expressed as fold induction relative to the control.

enhanced luciferase-reporter transcription in Caco-2 cells (Fig. 3A). To test the involvement of CTF2, we constructed the previously described M1 and M2 mutants of CTF2 [20], which lose their capacities to interact with p120 and β-catenin owing to amino-acid replacement in the cadherin homology domain 2 (CH2) and deletion of the CH3 domain, respectively. The expression of CTF2-M1 did not change the level of induction compared with that of the wild type (WT), but expression of CTF2-M2 inhibited the luciferase-reporter reaction (Fig. 3B). Furthermore, a specific inhibitor of γ-secretase, DAPT, was used to inhibit the cleavage activity that resulted in the generation of a CTF2 fragment, as demonstrated by western blot analysis (Fig. 3D). However, given that the level of induction of CYP1A1 mRNA was not changed by the addition of DAPT (Fig. 3E), CTF2 may not play an important role in inducing an increase in the CYP1A1 mRNA transcript.

transient expression did not change the level of induction of CYP1A1 mRNA, as measured using the luciferase-reporter assay (data not shown). In order to detect the endogenous interaction between β-catenin and Ah receptor, we performed immunoprecipitation experiment using anti-β-catenin antibody. Increased levels of β-catenin were detected in the immunoprecipitated fraction from cells treated with S-MEM, but not TCDD (Fig. 4A). This interaction was observed after an incubation time of 30 min, and was sustained until 4 h after commencement of incubation (Fig. 4B). For the detection of Ah receptor in the immuno-precipitation complex by anti-β-catenin, we used transient expression of myc-tagged β-catenin and 3 × FLAG-tagged Ah receptor into COA7 cells. Fig. 4C shows a faint band of 3× FLAG-Ah receptor reacted by the 3 ×FLAG antibody.

3.5. Possible involvement of β-catenin in regulation of the Ah receptor 3.4. Disruption of adherens junctions enhances interaction of β-catenin with the Ah receptor There is a possibility that β-catenin is involved in the CYP1A1transcription complex. To detect its interaction with the Ah receptor, FLAG-tagged β-catenin was transiently expressed in Caco-2 cells. The

To address the biological significance of the interaction of β-catenin with the Ah receptor, an experimental knockdown of β-catenin was performed. Three different siRNAs that were designed to target β-catenin silenced expression of the protein almost completely (Fig. 5A). The knockdown of β-catenin significantly enhanced the

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

2513

A B IB: AhR IB: GAPDH siRNA

C

100 10 100 10 100

10 100 nM

GFP AhR-1

AhR-3

AhR-2

D

RT-PCR

CYP1A1 GAPDH AhR-siRNA

- + - + - + Cont TCDD

S-MEM

E

Fig. 2. Ah-receptor-dependent transcription of CYP1A1. (A) Cells treated with TCDD or S-MEM for 0.5 h, 1 h, 3 h, 6 h or 12 h were subjected to subcellular fractionation, and the abundance of the Ah receptor protein was determined by immunoblotting (IB) of cytoplasmic fractions and nuclear extracts. (B) Cells were transfected with 10 or 100 nM siRNA against GFP or the Ah receptor. Knockdown of Ah receptor protein was confirmed by IB. (C) Cells transfected with siRNA against GFP (−) or the Ah receptor (AhR3 siRNA) (+) were then treated with TCDD or S-MEM for 4 h. The CYP1A1 and GAPDH cDNAs were amplified using RT-PCR, and resolved by agarose gel electrophoresis. (D, E) The inhibitory effect of Ah-receptor antagonists on CYP1A1 induction was assessed in cells pretreated with 10 μM PD98059 (PD) (D) or 1 μM MAF 2 h (E) before treatment with TCDD or S-MEM (4 h).

induction of CYP1A1 mRNA in Caco-2 cells treated with S-MEM or TCDD (Fig. 5B). We used β-catenin knockdown to investigate the involvement of β-catenin in the increase of CYP1A1 transcripts. Indeed, the decrease in β-catenin following siRNA transfection enhanced the induction of CYP1A1 mRNA following treatment with either S-MEM or TCDD. Western blotting (Fig. 5C) and quantitative RT-PCR (Fig. 5D) indicated that the level of the Ah receptor was increased by knockdown of β-catenin.

3-methylchorenthrene [9]. In the case of induction by S-MEM, transcription factors other than the Ah receptor are required for induction of Slug gene expression, because expression of the Slug gene was suppressed, rather than induced, following exposure of Caco-2 (Fig. 1C) or HaCaT cells [9] to agonists of the Ah receptor. Taken together, these observations suggest that S-MEM treatment of Caco-2 cells may provide a good model of wound healing.

4. Discussion

As shown in Fig. 3, cleavage of E-cadherin by γ-secretase to produce the fragments of CTF1, CTF2, and CTF3 occurred following treatment with S-MEM but not TCDD, and was not inhibited specifically by DAPT. Although exogenous expression of CTF2 induced expression of the luciferase-reporter slightly, the γ-secretase inhibitor DAPT (1 mM) did not suppress the level of CYP1A1 mRNA (Fig. 3E). Therefore, E-cadherin/CTF2 does not appear to contribute to the induction of CYP1A1 mRNA following treatment with S-MEM. The possible involvement of CTF2 in induction of the Slug gene in other cultured cell lines remains to be tested.

4.1. Destruction of adherens junctions by S-MEM may provide a model of wound healing As shown in Fig. 1C, treatment of Caco-2 human colon carcinoma cells with S-MEM, but not TCDD, induced Slug gene expression. Transcriptional activation of the Slug gene, which encodes a member of the Snail/Slug family of zinc finger transcriptional repressors that is critical for the induction of EMT, coincides with nuclear accumulation of the Ah receptor in the HaCaT keratinocyte cell line [9]. The same researchers reported that the regulatory sequence of the Slug gene contains five XREs that are essential for its transcription. The Slug gene was induced significantly by treatment with S-MEM, but not so markedly by exposure to the Ah receptor antagonists TCDD (Fig. 1C) and

4.2. Destruction of adherens junctions induces β-catenin signaling

4.3. Biological significance of Ah receptor interaction with β-catenin One possible mechanism underlying the enhancement of CYP1A1 transcription involves the accumulation of β-catenin in the nucleus

2514

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

B

A

∗

C

D

IB: E-cadherin

IB: FLAG Full length

CTF2

CTF2

CTF2

WT

M1

M2

(short exposure) CTF1

E

CTF2 CTF3 (long exposure) DAPT

CTF2 0 0.1

Cont

1

0 0.1

1

S-MEM

0

1

TCDD

Fig. 3. Effect of transfection of E-cadherin/CTF2 on CYP1A1 transcription. (A) Cells were transfected with E-cadherin CTF2/p3 × FLAG-CMV10 (CTF2) or empty vector (−) and then treated with or without S-MEM or TCDD. The transcriptional activity of the Ah receptor was determined using reporter-gene assays. (B) Cells were transfected with DNA encoding wild-type (WT) or mutant (M1, M2) CTF2 before the reporter-gene assay. (C) Expression of the WT and mutant CTF2 proteins following transfection was checked by immunoblotting (IB) to detect the 3 × FLAG epitope. (D) Cells were treated with 0.1 or 1 μM DAPT or vehicle (0) for 2 h, and then treated with S-MEM or TCDD for 30 min. Protein was extracted, and E-cadherin was detected by IB. Molecular sizes of full-length E-cadherin and its cleavage products (CTF1, CTF2, and CTF3) are indicated to the right of the panel. Specific signals of CTF2 detected by long exposure are shown in the lower panel. (E) Cells were treated with 0.1 or 1 μM DAPT or vehicle (0) for 2 h and then treated with or without S-MEM for a further 4 h. Transcriptional induction of the CYP1A1 gene was determined using RT-PCR. The asterisk (*) shows statistical significant, p b 0.05.

by regulation of the rate at which β-catenin bound to the Ah receptor shuttles between the nucleus and the cytosol. Direct binding of forkhead box M1 (FoxM1) to β-catenin enhances nuclear localization of β-catenin and then activates transcription [27]. In this context, the Ah receptor may act as a shuttling partner of β-catenin and synergistically activate transcription of wound-healing-related genes, such as Slug [9]. Accordingly, immunoprecipitation with an antibody against the Ah receptor showed the interaction of β-catenin with the Ah receptor (Fig. 4). However, the reverse experiment (immunoprecipitation with an antibody against β-catenin) failed to demonstrate interaction of the Ah receptor with β-catenin (data not shown). Given that levels of β-catenin in Caco-2 cells are much higher than levels of the Ah receptor, it seems possible that the amount of β-catenin bound to the Ah receptor in the immunoprecipitates was too low to detect by western blot analysis of Ah receptor abundance. Other investigators have used antibodies to the Ah receptor, but not antibodies to β-catenin, to show that the Ah receptor interacts with β-catenin in 5 l rat hepatoma cells [28]. In order to detect of Ah receptor in the immuno-precipitation complex by anti-β-catenin, we performed the transient expression of myc-β-catenin and 3 × FLAG-AhR into COS7 cells. It was confirmed that the 3 × FLAG-AhR was detected in the immuno-precipitates by

anti-myc antibody using the transfected COS7 cell lysates (Fig. 4C). However, it was remained to elucidate the functional interaction between β-catenin and Ah receptor using two mammalian-hybrid assay. The Ah receptor and Wnt/β-catenin cooperate in the induction of Cyp1a1 and Cyp1b1 in WB-F344 cells [29]. Depletion of components of adherens junctions is associated with reduced cell adhesion and enhanced rates of G1–S phase transition [29]. Therefore, we propose a hypothetical model of Slug and CYP1A1 induction in which destruction of adherens junctions by S-MEM may release β-catenin from E-cadherin, enabling it to interact with the Ah receptor, translocate to the nucleus, and activate the target gene (Slug). Simultaneously, Ah receptor that has been activated by an unknown mechanism may translocate to the nucleus, interact with ARNT, and induce CYP1A1 transcription. 4.4. Implications of the increase of Ah receptor following knockdown of β-catenin The response of the Ah receptor to the canonical pathway of Wnt/ β-catenin [28–30] differs from its response to the destruction of

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

A

A

Input

IP: AhR

IP: IgG

2515

IB:β -catenin

IB:β-catenin

IB: GAPDH IB: AhR Un Mock 10 100 β-cat-1

Cont TCDD S-MEM

B

IP: IgG

IP: AhR

Input

10 100 β-cat-2

10 100 β-cat-3

B

IB:β-catenin IB: AhR 0.5 Cont

1 2 S-MEM

4 hours

C

Fig. 4. Interaction of β-catenin with the Ah receptor. (A) Cells were treated with S-MEM or TCDD for 30 min and protein was extracted in low-stringency buffer. The Ah receptor and proteins that were physically associated with it were immunoprecipitated using antibodies against the Ah receptor. (A) The cell lysate (1 mg protein) was immunoprecipitated with 1 μg anti-Ah receptor antibody overnight at 4 °C. The 1/50 amount of cell lysate (20 μg) was loaded as a positive control for immunoprecipitation experiment (Input). The immunoprecipitate was eluted, and β-catenin and Ah receptor proteins were detected by immunoblotting (IB) using anti-β-catenin antibody and anti-Ah receptor antibody, respectively. The arrow shows the position of Ah receptor. (B) Cells treated with S-MEM for 0.5 h, 1 h, 2 h or 4 h were also subjected to immunoprecipitation, as described above. (C) Whole cell homogenate (2.5 mg) of COS7 cells transfected with 3×FLAG-AhR/pCEP4 and myc-β-catenin/pcDNA3 was mixed with Dynabeads protein G (25 μl) crosslinked with antibody against myc or control antibody (5 μg). Immunopurified protein was eluted and performed immunoblotting as described above. A part of the eluate (1/20) was used to check the efficiency of bait immunoprecipitation (IP).

adherens junctions in both our study and that of others [9]. Our data showed that transcription of the gene that encodes the Ah receptor was activated after knockdown of β-catenin, although we do not know the mechanism of upregulation of the Ah receptor that was induced by the sudden decrease in β-catenin. It is tempting to speculate that the Ah receptor may perceive a signal released from dying cells in damaged tissue. As shown in Fig. 2D and E, CYP1A1 induction by S-MEM treatment was blocked by the addition of the Ah receptor antagonists PD98059 and MAF. There is a possibility that the induction of CYP1A1 by S-MEM could be partly related to endogenous Ah receptor ligands produced in the cells, such as kynurenine [31] or FICZ [32]. Mitra et al. have reported that MRJ (DNAJB6) induces degradation of β-catenin and causes partial reversal of the mesenchymal phenotype [33]. In this scenario, disappearance of β-catenin by the induction of its degradation increases the amount of Ah receptor that is available to perceive the tissue damage signal, which activates the transcription of target genes involved in wound healing. Currently, study of the mechanism of induction of the Ah receptor is ongoing in our laboratory.

Acknowledgements We thank Dr. Morel (Universitaire des Saints-Peres) for providing the construct pGL3/hCYP1A1-Luc, Dr. Monga (University of Pittsburgh School of Medicine) for providing the construct for β-catenin and Dr. M. Hijikata (Institute for Virus Research, Kyoto University) for myc-β-catenin. This work was supported in part by a Grant-in-aid for Science Research (C) (No. 21510065) from the Ministry of Education, Culture, Sports, Science

C

Ratio

IB:β -catenin

0.1

IB: AhR

2.1

IB: HSP90

1.2

IB: XAP-2

1.0

IB: GAPDH

0.9

B-catenin-siRNA

D

+

Fig. 5. Involvement of β-catenin in the regulation of CYP1A1 transcription. (A) Cells were transfected with 10 or 100 nM siRNA directed against β-catenin. Extracted protein was subjected to immunoblotting (IB) to detect β-catenin. As a control, untreated cells (Un) and cells treated with transfection reagent without siRNA (Mock) were also analyzed. (B) Cells were transfected with siRNA directed against GFP or β-catenin (β-cat) and then treated with S-MEM or TCDD. Transcriptional induction of the CYP1A1 gene was determined using RT-PCR. (C) Expression of the β-catenin, Ah receptor, HSP90, XAP-2, and GAPDH proteins in control and β-catenin-depleted cells was detected by IB. The signal intensity of each band was estimated by densitometric analysis and indicated as a ratio relative to the control (treated with DMEM), as shown to the right of each panel. (D) The amount of Ah receptor mRNA was quantified using RT-PCR.

and Technology (Monbu Kagakusho), and the Global Environment Research Fund of the Ministry of the Environment, Japan (C-0803).

References [1] P.M. Fernandez Salguero, D.M. Hilbert, S. Rudikoff, J.M. Ward, F.J. Gonzalez, Aryl-hydrocarbon receptor-deficient mice are resistant to 2,3,7,8-tetrachlorodibenzop-dioxin-induced toxicity, Toxicol. Appl. Pharmacol. 140 (1996) 173–179. [2] M. Abdelrahim, R. Smith III, S. Safe, Aryl hydrocarbon receptor gene silencing with small inhibitory RNA differentially modulates Ah-responsiveness in MCF-7 and HepG2 cancer cells, Mol. Pharmacol. 63 (2003) 1373–1381. [3] Y. Shimizu, Y. Nakatsuru, M. Ichinose, Y. Takahashi, H. Kume, J. Mimura, Y. Fujii Kuriyama, T. Ishikawa, Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 779–782. [4] R.J. Kewley, M.L. Whitelaw, A. Chapman Smith, The mammalian basic helix-loophelix/PAS family of transcriptional regulators, Int. J. Biochem. Cell Biol. 36 (2004) 189–204. [5] Y. Fujii Kuriyama, K. Kawajiri, Molecular mechanisms of the physiological functions of the aryl hydrocarbon (dioxin) receptor, a multifunctional regulator that senses and responds to environmental stimuli, Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 86 (2010) 40–53. [6] K.U. Petersen, Review article: omeprazole and the cytochrome P450 system, Aliment. Pharmacol. Ther. 9 (1995) 1–9. [7] T. Ikuta, T. Namiki, Y. Fujii Kuriyama, K. Kawajiri, AhR protein trafficking and function in the skin, Biochem. Pharmacol. 77 (2009) 588–596.

2516

S. Kasai et al. / Biochimica et Biophysica Acta 1830 (2013) 2509–2516

[8] C.M. Sadek, B.L. Allen Hoffmann, Cytochrome P450IA1 is rapidly induced in normal human keratinocytes in the absence of xenobiotics, J. Biol. Chem. 269 (1994) 16067–16074. [9] T. Ikuta, K. Kawajiri, Zinc finger transcription factor Slug is a novel target gene of aryl hydrocarbon receptor, Exp. Cell Res. 312 (2006) 3585–3594. [10] A.M. Calcagno, J.M. Fostel, E.L. Reyner, E. Sinaga, J.T. Alston, W.B. Mattes, T.J. Siahaan, J.A. Ware, Effects of an E-cadherin-derived peptide on the gene expression of Caco-2 cells, Pharm. Res. 21 (2004) 2085–2094. [11] W.J. Nelson, Regulation of cell–cell adhesion by the cadherin-catenin complex, Biochem. Soc. Trans. 36 (2008) 149–155. [12] M. Molenaar, M. van de Wetering, M. Oosterwegel, J. Peterson Maduro, S. Godsave, V. Korinek, J. Roose, O. Destree, H. Clevers, XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos, Cell 86 (1996) 391–399. [13] M. Takeichi, Cadherin cell adhesion receptors as a morphogenetic regulator, Science 251 (1991) 1451–1455. [14] B.M. Gumbiner, Cell adhesion: the molecular basis of tissue architecture and morphogenesis, Cell 84 (1996) 345–357. [15] M. Conacci Sorrell, I. Simcha, T. Ben Yedidia, J. Blechman, P. Savagner, A. Ben Ze'ev, Autoregulation of E-cadherin expression by cadherin–cadherin interactions: the roles of beta-catenin signaling, Slug, and MAPK, J. Cell Biol. 163 (2003) 847–857. [16] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156–159. [17] J.D. Dignam, R.M. Lebovitz, R.G. Roeder, Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei, Nucleic Acids Res. 11 (1983) 1475–1489. [18] S. Nishiumi, N. Yamamoto, R. Kodoi, I. Fukuda, K. Yoshida, H. Ashida, Antagonistic and agonistic effects of indigoids on the transformation of an aryl hydrocarbon receptor, Arch. Biochem. Biophys. 470 (2008) 187–199. [19] G. Zeng, U. Apte, A. Micsenyi, A. Bell, S.P. Monga, Tyrosine residues 654 and 670 in beta-catenin are crucial in regulation of Met-beta-catenin interactions, Exp. Cell Res. 312 (2006) 3620–3630. [20] E.C. Ferber, M. Kajita, A. Wadlow, L. Tobiansky, C. Niessen, H. Ariga, J. Daniel, Y. Fujita, A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus, J. Biol. Chem. 283 (2008) 12691–12700. [21] E. Le Ferrec, D. Lagadic Gossmann, C. Rauch, C. Bardiau, K. Maheo, F. Massiere, M. Le Vee, A. Guillouzo, F. Morel, Transcriptional induction of CYP1A1 by oltipraz in human Caco-2 cells is aryl hydrocarbon receptor- and calcium-dependent, J. Biol. Chem. 277 (2002) 24780–24787. [22] K. Kudo, T. Takeuchi, Y. Murakami, M. Ebina, H. Kikuchi, Characterization of the region of the aryl hydrocarbon receptor required for ligand dependency of

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

transactivation using chimeric receptor between Drosophila and Mus musculus, Biochim. Biophys. Acta 1789 (2009) 477–486. Y. Fujii Kuriyama, J. Mimura, Molecular mechanisms of AhR functions in the regulation of cytochrome P450 genes, Biochem. Biophys. Res. Commun. 338 (2005) 311–317. S. Kasai, H. Kikuchi, The inhibitory mechanisms of the tyrosine kinase inhibitors herbimycin a, genistein, and tyrphostin B48 with regard to the function of the aryl hydrocarbon receptor in Caco-2 cells, Biosci. Biotechnol. Biochem. 74 (2010) 36–43. U.N. Verma, R.M. Surabhi, A. Schmaltieg, C. Becerra, R.B. Gaynor, Small interfering RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells, Clin. Cancer Res. 9 (2003) 1291–1300. M. Perrais, X. Chen, M. Perez Moreno, B.M. Gumbiner, E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions, Mol. Biol. Cell 18 (2007) 2013–2025. N. Zhang, P. Wei, A. Gong, W.T. Chiu, H.T. Lee, H. Colman, H. Huang, J. Xue, M. Liu, Y. Wang, R. Sawaya, K. Xie, W.K. Yung, R.H. Medema, X. He, S. Huang, FoxM1 promotes beta-catenin nuclear localization and controls Wnt target-gene expression and glioma tumorigenesis, Cancer Cell 20 (2011) 427–442. A. Braeuning, C. Kohle, A. Buchmann, M. Schwarz, Coordinate regulation of cytochrome P450 1A1 expression in mouse liver by the aryl hydrocarbon receptor and the {beta}-catenin pathway, Toxicol. Sci. 122 (2011) 16–25. J. Prochazkova, M. Kabatkova, V. Bryja, L. Umannova, O. Bernatik, A. Kozubik, M. Machala, J. Vondracek, The interplay of the aryl hydrocarbon receptor and β-catenin alters both AhR-dependent transcription and Wnt/β-catenin signaling in liver progenitors, Toxicol. Sci. 122 (2011) 349–360. D.R. Chesire, T.A. Dunn, C.M. Ewing, J. Luo, W.B. Isaacs, Identification of aryl hydrocarbon receptor as a putative Wnt/beta-catenin pathway target gene in prostate cancer cells, Cancer Res. 64 (2004) 2523–2533. C.A. Opitz, U.M. Litzenburger, F. Sahm, M. Ott, I. Tritschler, S. Trump, T. Schumacher, L. Jestaedt, D. Schrenk, M. Weller, M. Jugold, G.J. Guillemin, C.L. Miller, C. Lutz, B. Radlwimmer, I. Lehmann, A. von Deimling, W. Wick, M. Platten, An endogenous tumour-promoting ligand of the human aryl hydrocarbon receptor, Nature 478 (2011) 197–203. E. Wincent, J. Bengtsson, A. Mohammadi Bardbori, T. Alsberg, S. Luecke, U. Rannug, A. Rannug, Inhibition of cytochrome P4501-dependent clearance of the endogenous agonist FICZ as a mechanism for activation of the aryl hydrocarbon receptor, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 4479–4484. A. Mitra, M.E. Menezes, L.A. Shevde, R.S. Samant, DNAJB6 induces degradation of beta-catenin and causes partial reversal of mesenchymal phenotype, J. Biol. Chem. 285 (2010) 24686–24694.