- Email: [email protected]
ATF6 pathway
Biomedicine & Pharmacotherapy 93 (2017) 490–497
Available online at
ScienceDirect www.sciencedirect.com
Original article
b-elemene regulates endoplasmic reticulum stress to induce the apoptosis of NSCLC cells through PERK/IRE1a/ATF6 pathway Ying Liua,b,1, Zi-yu Jianga,c,1, Yuan-li Zhoua , Hui-hui Qiua,c , Gang Wanga,b , Yi Luoa,c , Jing-bing Liua,c, Xiong-wei Liud , Wei-quan Bua,c , Jie Songa,c, Li Cuia,c , Xiao-bin Jiaa,c,* , Liang Fenga,c,* a Key Laboratory of New Drug Delivery Systems of Chinese Materia Medica, Jiangsu Provincial Academy of Chinese Medicine, Jiangsu Nanjing, 210028, PR China b School of Pharmacy, Anhui University of Chinese Medicine, Anhui Hefei 230038, PR China c Third School of Clinical Medical of Nanjing University of Chinese Medicine, Jiangsu Nanjing 210028, PR China d The Affiliated Jiangyin Hospital of Southeast University Medical Collage, Jiangyin 214400, Jiangsu, PR China
A R T I C L E I N F O
Article history: Received 23 April 2017 Received in revised form 28 May 2017 Accepted 20 June 2017 Keywords:
b-elemene Non-small-cell lung cancer Endoplasmic reticulum stress Apoptosis
A B S T R A C T
Endoplasmic reticulum stress (ERs) has been regarded as an important cause for the pathogenesis of nonsmall-cell lung cancer (NSCLC). b-elemene is an active component in the essential oil extracted from a medicinal herb, Curcuma wenyujin, and has been reported to be effective against non-small-cell lung cancer (NSCLC). However, the potential effect and underlying mechanisms of b-elemene on regulating ERs to inhibit NSCLC are still unclear. In the present study, A549 cells and Lewis tumor-bearing C57BL/6J mice were established to evaluate this effect. Visualsonics Vevo 2100 Small Animal Dedicated Highfrequency Color Ultrasound was performed to observe tumor volume in vivo. 3-(4,5-dimethylthiazol-2yl)-2,5- diphenyltetrazolium bromide (MTT) was used to evaluate cell vitality of A549 cells. Furthermore, western blotting (WB), immunohistochemistry (IHC) and quantitative reverse transcription polymerase chain reaction (q-PCR) were applied to detect the ERs-related proteins. Flow cytometry was also applied to detect cell apoptosis and assay kit for reactive oxygen species (ROS) generation. Our results showed that b-elemene inhibited lung cancer tumor growth and cell vitality in a dose- and time-dependent manner. Not only that, b-elemene could up-regulate ERs-related proteins like PERK, IRE1a, ATF6, ATF4, CHOP and down-regulate the Bcl-2 expression. More importantly, ERs inhibitor 4-PBA, IRE1a inhibitor STF-083010, ATF6 inhibitor Anti-ATF6 and PERK inhibitor GSK2656157 can all reduce the amplitude of protein expression changes and apoptosis rates, then weaken the anti-tumor effect of b-elemene. Therefore, the present in vivo and in vitro study revealed that the anti-NSCLC effect of b-elemene is closely related to the activation of ERs through PERK/IRE1a/ATF6 pathway, and this might be beneficial for clinical therapy of NSCLC. © 2017 Elsevier Masson SAS. All rights reserved.
Abbreviations: NSCLC, non-small-cell lung cancer; ER, endoplasmic reticulum; ERs, endoplasmic reticulum stress; 4-PBA, 4-phenylbutyric acid; WB, western blotting; qPCR, quantitative reverse transcription polymerase chain reaction; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; ROS, reactive oxygen species; DCFHDA, 20 ,70 -dichlorofluorescein diacetate; DCF, 20 , 70 -dichlorofluorescin; CTX, Cytoxan; IHC, immunohistochemistry; IRE1a, inositol-requiring enzyme-1a; PERK, PKR-like endoplasmic reticulum kinase; ATF6, activating transcription factor 6; ATF4, activating transcription factor 4; CHOP, C/EBP homologus protein; Bcl-2, B cell lymphoma/ lewkmia-2; GADPH, glyceraldehyde-3-phosphate dehydrogenase; DMSO, dimethyl sulfoxide; OD, optical density; SD, standard deviation; IC50, half-maximal inhibitory concentration; PBS, phosphate buffer saline; PVDF, polyvinylidene fluoride; DMEM, Dulbecco’s modified Eagle's medium; FBS, fetal bovine serum; UPR, unfolded-protein response; ECM, extracellular matrix. * Corresponding authors. E-mail addresses: [email protected] (X.-b. Jia), [email protected] (L. Feng). 1 Ying Liu and Zi-yu Jiang contributed equally to the work. http://dx.doi.org/10.1016/j.biopha.2017.06.073 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
1. Introduction Lung cancer is one of the leading causes of cancer death due to its high morbidity and mortality. In particular, NSCLC accounted for about 80% of all lung cancers [1]. Though endoplasmic reticulum (ER) with a strong system of homeostasis, there are many factors such as hypoxia, oxidative damage or viral infection and pathologic state in the occurrence and development of NSCLC cells. Of note that endoplasmic reticulum sress (ERs) plays an important role in the proliferation and cell vitality of cancer cells. ERs is crucial for maintaining cellular homeostasis environment and activates protein folding reaction (unfolded protein response, UPR) by reducing the synthesis of new proteins. It then could lead to the increase of the partner molecules and promote protein misfolding, which finally promoted cell apoptosis [2]. UPR in ERs have three pathways: PERK pathway, IRE1a pathway and ATF6 pathway. ATF4 is downstream of the PERK protein molecule and also plays an important role in regulating the expression of CHOP [3]. CHOP is expressed in response to ERs. When severe ERs condition appeared, apoptosis starts with the up-regulation of CHOP then activates Bcl-2 to promote apoptosis. The regulation of compounds on ERs of tumor cells are benifical to suppress growth and induce apoptosis of tumors. Elemene (1-methyl-1-vinyl-2, 4-diisopropenyl-cyclohexane), a novel broad-spectrum antitumor molecule, extracted from traditional Chinese medicinal herb Curcuma wenyujin that includes a, b, g and d forms [4]. Its major terpene compounds b-elemene has been developed to a new drug which was approved by the State Food and Drug Administration of China for the treatment of malignant effusion and some solid tumors [5]. Previous studies have shown that b-elemene exhibited anti-cancer effects in many cancer cells, especially lung cancer cells by inducing apoptosis [6]. However, whether b-elemene inhibit proliferation or induce apoptosis of NSCLC cells by regulating ERs still need to be further elucidated. In the present study, we explored the regulation of b-elemene on ERs of NSCLC in vivo and in vitro, and then reveal its mechanism on regulating ERs. This investigation may provides a new insight for the treatment of b-elemene to NSCLC.
491
anti-mouse (lot No., Ab6789) immunoglobulin G (IgG) were all obtained from the Abcam Trading Company Ltd. (Shanghai, China). Allergic ECL chemiluminescence reagent kit (lot No., P0018) and Reactive Oxygen Species assay kit (lot No., S0033) were obtained from Beyotime Institute of Biotechnology (Shanghai, China). 2.2. Cell culture Non-small-cell lung cancer adenocarcinoma cell lines A549 (human) and Lewis (mouse) were both ordered from Nanjing KeyGen Biotech. Co., Ltd. (Nanjing, China). Cells were all cultured in high-glucose DMEM containing 10% inactivated fetal bovine serum (FBS), 80 U/ml of penicillin and 0.08 mg/ml of streptomycin at 37 C with 5% CO2 in a humidified atmosphere and the medium should be replaced every day [7]. After having grown to 80%-85% confluence, cells were digested by 0.25% trypsin-0.02% EDTA solution for the passage or further experiments. 2.3. MTT assay To evaluate inhibitory effects of different concentrations of
b-elemene on A549 cells in vitro, MTT colorimetric method was performed in this study. Cells were seeded in 96-well plates at an approximate density of 1 105 and then divided into different groups. Cells were treated with blank medium without FBS as blank control group, and b-elemene at 1, 2.5, 5, 10, 20, 40, 80, 160, 320 mg/ml respectively as treated group. After 24 h, 48 h and 72 h incubation, MTT (5 mg/ml) of 10 ml was added to each well and then continued to incubate at 37 C for 4 h. Sequentially, DMSO of 100 ml was added after the removal of culture medium. The optical density (OD) at 570 nm was determined using a 96-well plates reader (reference wavelength 630 nm) [8]. All measurements were repeated three times. The survival rates were calculated by the following formula: The cell survival rates (%) = [(the absorbance of treated group absorbance of blank control group)/the absorbance of blank control group] 100% [9]. The IC50 (concentration of drug that inhibits cell growth by 50%) values was calculated by linear regression [10]. 2.4. Flow cytometry analysis
2. Materials and methods 2.1. Reagents and antibodies
b-elemene (lot No.,515-13-9) (purity 99%) was purchased from Yuanda Pharmaceuticals Co., Ltd. (Dalian, China). 4-PBA (lot No., STBG2117 V) (purity 99%) was purchased from SigmaAldrich Chemical Co., Ltd. (St. Louis, MO, USA). STF-083010 (lot No., 4509-10), anti-ATF6 (lot No., 9H209) and GSK2656157 (lot No., S7033) were all ordered from Nanjing KeyGen Biotech. Co., Ltd. (Nanjing, China). DMEM medium (lot No., 160425), 0.25% trypsin (lot No., 20160317), 3-(4, 9 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazoliumbromide (MTT) and dimethyl sulfoxide (DMSO) were provided by Nanjing Sunshine Biotechnology Co., Ltd. (Nanjing, China). Fetal bovine serum (FBS) (lot No., 20151130) was obtained from Invitrogen (Carlsbad, CA, USA). Antibody against CHOP (lot No., YB526) was obtained from Shanghai Yubo biological technology Co., Ltd. (Shanghai, China). Antibodies against PERK (lot No., 3192) and IRE1a (lot No., 3294) were purchased from Cell Signaling Technology, Inc. (ShangHai, China). Anti-ATF6 (lot No., 24169-1-AP) and anti-ATF4 (lot No., 10835-1AP) were purchased from Proteintech Group, Inc. (Wuhan, China). Anti-Bcl-2 (lot No., ab48394) was obtained from Shanghai Maiyueer biological technology Co., Ltd. (Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GADPH) antibody (lot No., Ab8226), HRP-labeled anti-rabbit (lot No.,Ab6721) and
Flow cytometry was used to detect cells apoptosis by staining apoptotic cells with both Annexin V-fluorescein isothiocyanate (FITC) and Propidium iodide (PI) before and after administration. A549 cells were grown in 6-well plates (2 106) overnight and treated with blank medium, 1 mg/ml b-elemene, 1 mg/ml b-elemene plus 2 mg/ml 4-PBA, 5 mg/ml anti-IRE1a plus 1 mg/ml b-elemene, 5 mg/ml anti-ATF6 plus 1 mg/ml b-elemene, 5 mg/ml GSK2656157 plus 1 mg/ml b-elemene, respectively. At the end of incubation, cells were collected and washed twice with ice phosphate-buffered saline (PBS), then 400 ml of PBS binding buffer was added to each tube (12 mm 75 mm, polystyrene round bottom) for suspension [11]. The following 5 ml of annexin V-FITC and 10 ml of PI were added and then incubated at room temperature in the dark for 15 min. Samples were detected by LSRIII flow cytometry and the data were analyzed with CellQuest Pro software (Becton-Dickinson) [12]. 2.5. Western blotting analysis A549 cells (2 106) in 6-well plates were exposed to vehicle and indicated doses of drugs for 24 h, then harvested by trypsinization for WB. After washing with ice-cold PBS, all samples were scraped in 200 ml of Thermo scientific RIPA buffer (50 mM Tris-HCl (pH 7.4), 1.0% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM aprotinin, 1 mg/ml PMSF, leupeptin and pepstatin) (Pierce,
492
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
USA) and mixed with SDS-PAGE sample buffer, boiled for 5 min [13]. Protein concentrations were determined using the BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA) and equal amounts of proteins were seperated on 10% SDS-PAGE, then electrophoretically transferred onto a PVDF (polyvinylidene difluoride) membrane [14]. The membrane were blocked with 5% skimmed milk for 2 h, incubated with the primary antibodies, anti-CHOP (1: 750 dilution), anti-PERK (1: 600 dilution), antiIRE1a (1: 600 dilution), anti-ATF6 (1: 800 dilution), anti-ATF4 (1: 600 dilution) and GAPDH (1: 2500 dilution) at 4 C overnight and then washed twice with TBST (Tris-HCl buffer salt solution). HRPlabeled secondary antibodies (goat anti-rabbit and goat antimouse) at the dilution of 1:1000 were added for incubation in 37 C for 2 h. Immunoreactive protein bands were detected with the ECL system. All data were repeated three times [15].
Table 1 The sequences of the primers for the ER-stress related genes Gene
Sequences (50 -30 )
CHOP
forward: TGGAACCTGAGGAGAGAGTGTT reverse: GGATAATGGGGAGTGGCTGG forward: AGGACAGAGGGGACAGAGTTG reverse: TAATGACCTTTTCTTCCCTGCTCC forward: TAGTCAGTTCTGCGTCCGCT reverse: TTCCAAAAATCCCGAGGCCG forward: AGTATTTTGTCCGCCTGCCG reverse: GCAGAATCCCAATCTTCATCCA forward: CTGATTCTCATTCAGGCTTCTCAC reverse: GAAGGCATCCTCCTTGCTGTT forward: GAAGGTCGGAGTCAACGGAT reverse: CCTGGAAGATGGTGATGGG
PERK IRE1a ATF6 ATF4 GAPDH
2.6. Real-time quantitative polymerase chain reaction (q-PCR) analysis q-PCR assay was used to analyze the mRNA expression of ERs related proteins in A549 cells. Cells in logarithmic growth phase (2 106) were similarly seeded in 6-well plates and cultured for 24 h, and then exposed to drug molecules [16]. Total RNA was extracted from cells using Trizol Reagent (Invitrogen15596-026, USA) and quantified. The cDNA was synthesized using First chain cDNA synthesis kit (ThermoFisherK1622, USA) [17] and the synthetic cDNA was taken as a template to carry out polymerase chain reaction. b-actin was used as the reference. Primers were provided by GenScript Co., Ltd. (Nanjing, China) and designed by Primer software (version 6.0). The specific primer sequences were shown in Table 1. The PCR protocol was as follows: predenaturizing for 10 min at 95 C, denaturizing for 15 s at 95 C, annealing at 60 C for 20 s and extension at 72 C for 40 s [18]. The whole reaction cycled for 40 times and the data was read by fluorescence quantitative PCR automatically. 2.7. Determination of reactive oxygen species (ROS) production The production of ROS was detected by fluorometric assay using 20 , 70 -dichlorofluorescein diacetate (DCFH-DA) which is converted to fluorescent 20 , 70 -dichlorofluorescin (DCF) in the presence of peroxides [19]. A549 cells suspension was adjusted to 2 106 cells in 6-well plates that treated with drug molecules. After removal of cell medium, serum-free medium diluted DCFH-DA was added to a final concentration of 10 mM for 20 min at 37 C. Then, cells were collected and washed with PBS after centrifugation. The fluorescence intensities of the suspensions were recorded with Olymplus IX51 (Olympus, Tokyo, Japan) using the excitation and emission wavelengths of 488 nm and 525 nm, respectively [20]. 2.8. Transplantation of Lewis cells into C57BL/6J mice Lewis tumor-bearing C57BL/6J mice model was established to assess b-elemene efficacy in vivo. Seven-week-old specific pathogen-free male C57BL/6J mice (weight 18–20 g) were obtained from Shanghai SLAC Laboratory Animal Center (Shanghai, China) and maintained ten per cage in animal facility under standard laboratory (temperature: 25 1 C, the relative humidity: 45 5%, and 12 h light/dark cycle with access to food and water ad libitum) in accordance with Chinese legislation on the use and care of laboratory animals [21]. All protocols for experiments were supplied by the Institutional Animal Care and Ethics Committee of Jiangsu Provincial Academy of Chinese Medicine. After seven days of accommodation, cultured Lewis cells were washed with and resuspended in ice-cold PBS diluted to 2.5 107/ ml, then subcutaneously injected into the right shoulder region of
each male mice (0.2 ml of suspension) following the strict sterile operation [22]. After injection, mice were randomly divided into seven groups (ten for each group) and all administered daily for four weeks by intraperitoneally injection. Specific experimental groups are as follows: (1) Blank control group (normal saline of 0.2 ml/d); (2) Negative control group (saline of 2 ml/d); (3) CTX group (20 mg/kg/d as positive drug); (4) b-elemene group (50, 75, 100 mg/kg/d, repectively); (5) 4-PBA + b-elemene group (4-PBA of 50 mg/kg/d, b-elemene of 75 mg/kg/d). Tumor volumes were measured by Visualsonics Vevo 2100 Small Animal Dedicated High-frequency Color Ultrasound and calculated. 2.9. Inhibitory rate and viscera index calculation Tumor volumes were measured using Vevo2100 high resolution small animals ultrasonic imaging system (MS 250, center frequency is 21 MHz, detection width of 23.04 mm, depth of 20.00 mm). The three-dimensional images were to calculate the volume by adjusting the probe on computer ultrasound image. Finally, mice were sacrificed and the tumors, thymus and spleen were dissected and weighed individually [23]. Tumor inhibitory rate (%) and viscera index were calculated by the following formulas: Tumor inhibitory rate (%) = (average tumor weight of model group averge tumor weight of treated group)/averge tumor weight of model group 100%; viscera index = averge viscera weight (g)/averge body weight (g) 100%. 2.10. Immunohistochemistry (IHC) assay IHC assay was processed using a standard immunostaining protocol as previously reported [24]. Paraffin sections of lung cancer tumor tissues from C57BL/6J mice were obtained and deparaffinized. Sequentially, citrate buffer (pH 6.0) was used to get antigen repaired. After that, each slice added two drops of 3% H2O2-methanol solution and incubated at room temperature (15– 25 C) for 10 min to block endogenous peroxidase activity and then labeled with different primary antibodies (1: 100 for CHOP and PERK) for 2 h at 37 C. PBS was used to replace the primary antibody for the negative control [25]. Next, 50–100 ml of readyto-use goat serum was added and incubated for 20 min in a humidified chamber for blocking [26]. DAB Kit (DAB-1031, FuZhou, China) was used as chromogenic agent. Slices were put into hematoxylin solution for redyeing, then dehydrated and sealed the pieces, the protein expression in tissue cells were observed using an IX51 Olympus microscope (Olympus, Tokyo, Japan). Each section selected four photograph fields of vision randomly.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
2.11. Statistical analysis All experiments were repeated at least three times. Data were presented as means standard deviation (SD). The results were analyzed by one-way analysis of variance (ANOVA) with post hoc multiple comparisons and Student’s t-test for the comparison of any two groups. P-value of less than 0.05 was considered statistically significant and all statistical analysis was done by SPSS 21.0. 3. Results 3.1. b-elemene inhibited the cell vitality of A549 cells A549 cells were exposed to different concentrations of
b-elemene to evaluate its survival rates using MTT method. Timeand dose-effect curve of b-elemene on A549 cells were shown in Fig. 1, it can be seen that b-elemene inhibit the cell vitality of A549 cells with the increase of concentration and the extension of time. The half-maximal inhibitory concentration (IC50) values of b-elemene at 48 h were 27.5 mg/ml for A549 cells [27]. Our results indicated that b-elemene could effectively inhibit human lung cells growth and proliferation in a dose- and time-dependent manner. 3.2. b-elemene induced ROS generation in A549 cells Oxidative stress is a potential contributor to ERs of lung cancer cells [28]. The increase of ROS plays a significant role in mediating ERs and may become the trigger of the ERs [29]. After cell culturing for 24 h, added 1 ml of DCFH-DA at a final concentration of 10 mM to each well and incubated at 37 C for 20 min. Then washed with blank medium to remove the probe that did not enter the cell and could significantly improve the level of reactive oxygen species. As depicted in Fig. 2A, an obvious increase in ROS levels was found after b-elemene treatment in A549 cells (p < 0.001), this may hinted the occurrence of ERs. 3.3. b-elemene induced the apoptosis of A549 cells through PERK/ IRE1a/ATF6 pathway Herein, A549 cells were exposed to vehicle and indicated doses of drugs. Cells were collected for apoptosis determination using an Annexin V/PI detection kit [30]. Results were shown in Fig. 2B that cell apoptosis rate in blank control group was 6.91%, manifested with high cell survival rate; cell apoptosis rate of b-elemene group was 48.01%, which increased significantly in contrast to blank control group. Moreover, 4-PBA alleviated cell apoptosis induced by b-elemene with a rate of 31.84%. These findings showed that
Fig. 1. Time- and dose-effect curve of b-elemene on A549 cells. The survival rates of b-elemene were decreased with the extension of exposure time and increase of concentration. The IC50 values of b-elemene at 48 h were 27.5 mg/ml for A549 cells.
493
b-elemene has strong effect on inducing cell apoptosis and ERs inhibitor 4-PBA can prevent b-elemene-induced cell apoptosis. It’s indicated that b-elemene may induces the apoptosis of A549 cells through ERs. In order to clarify the mechanism of apoptosis, different inhibitors were added to investigate cell apoptosis. As depicted in Fig. 3A, compared with the blank control group, b-elemene upregulated CHOP and down-regulated Bcl-2. However, the trend was opposite when A549 cells exposed to ERs inhibitors like the corresponding selective IRE1a inhibitor STF-083010, ATF6 inhibitor Anti-ATF6 and PERK inhibitor GSK2656157. Combined with Fig. 3B, all these suggested that the antitumor effect of b-elemene was due to activating ERs by PERK/IRE1a/ATF6 pathway. 3.4. b-elemene suppressed the development of tumors in C57BL/6J mice It was clearly seen that b-elemene (50, 75, 100 mg/kg) could significantly inhibit the tumor growth of Lewis tumor-bearing C57BL/6J mice in a dose-dependent manner, compared with NS group (Fig. 4A). However, it could attenuate the anti-tumor effect when ERS inhibitor 4-PBA added (Fig. 4A and Table 2). The same results could be observed in Visualsonics Vevo 2100 Small Animal Dedicated High-frequency Color Ultrasound (Fig. 4B). In addition, compared with model group, the immune organ index of positive group was significantly lower than that of b-elemene group (Table 3). Pictures and tables all above suggested that b-elemene could improve body's immune function to a certain extent in its anti-tumor process. And we further inferred that b-elemene may enhance its anti-NSCLC effects by activating ERs. 3.5. Anti-tumor effect of b-elemene is associated with ERs The results of ROS may illustrate the activation of ERs. Combined with western blotting results (Fig. 3B), it showed that the expression of ERs related proteins were up-regulated by b-elemene in contrast to 4-PBA groups. The expression levels of CHOP and PERK protein in IHC (Fig. 5) and PCR (Fig. 3C) results were consistent with WB (Fig. 3A and B). All data revealed that the anti-NSCLC effect of b-elemene was mediate by ERs. 4. Discussion and conclusions
b-elemene has been regarded as a promising antitumor drug that is reported by a lot of literatures. In this study, we established the models of A549 cells and Lewis-bearing C57BL/6J mice to evaluate the effect of b-elemene in NSCLC treatment both in vivo and in vitro, The regulation of b-elemene on ERs of NSCLC cells was evaluated and its possible mechanism was explored for the first time. All evidence has shown that the activation of ERs contributes to the inhibitory effect of anti-NSCLC and this provides an effective strategy to regulate ERs to inhibit the cell viability or induce apoptosis of NSCLC cells. Of note that this regulation might be associated with the activation of PERK/IRE1a/ATF6 pathway. Not only could b-elemene effectively inhibit the activity of tumor cells, but also the survival rates of b-elemene were decreased with the extension of acting time within 24–72 h in the cell vitality test. The survival rates of A549 cells exposed to b-elemene for 24 h, 48 h and 72 h incubation times have no significant differences in Fig. 1. Considering 72 h was too long and former studies have shown that blinding to extend the duration or high-dosing can lead to stronger side effects on the body. Hence, 48 h was chosen as the optimal exposure time for further study in vitro. Accordingly, in vivo experimental results showed that b-elemene had an effect on suppressing tumor growth in doseand time-dependent manner and improving the immune function.
494
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
Fig. 2. Effect of b-elemene on ROS generation (A) and induction of apoptosis (B) in A549 cells. For ROS level, a, blank control group; b, 1 mg/ml b-elemene group. Data were presented as means SD (n = 8). ***p < 0.001, vs. blank control group, #p < 0.05, ##p < 0.01, vs. b-elemene group. Cell apoptosis was detected by Flow cytometry. a, blank control group; b, 1 mg/ml b-elemene group; c, 2 mg/ml 4-PBA plus 1 mg/ml b-elemene group; d, 5 mg/ml anti-IRE1a plus 1 mg/ml b-elemene group; e, 5 mg/ml anti-ATF6 plus 1 mg/ml b-elemene group; f, 5 mg/ml GSK2656157 plus 1 mg/ml b-elemene group.
ER is an extensive intracellular membranous network involved in protein synthesis. Stress condition such as ROS generation can affect the ER steady state, trigger ERs and initiate the UPR. When ERs is excessive and prolonged, transcription of the CHOP is adjusted by modulating the expression of the Bcl-2 protein, leading to apoptosis [31]. Apoptosis, or programmed cell death, plays an essential role in maintaining human stable internal environment [32]. ERs was involved in mediating cell apoptosis. Herein, flow cytometry was used to evaluate that b-elemene induced apoptosis in human lung
cancer cells A549, combined with WB and q-PCR experiments. In this study, a significant apoptosis of A549 cells exposed to b-elemene was observed. Additionally, 4-PBA can also attenuate the apoptosis of A549 cells in the presence of b-elemene. Bcl-2 as an apoptotic gene which has the effect of inhibiting apoptosis. The level of Bcl-2 of A549 cells was also reduced by b-elemene treatment whereas increased significantly by 4-PBA. These findings indicated that the activated pathway of b-elemene on ERs might be related to the down-regulation of Bcl-2, resulting in apoptosis of cancer cells.
Fig. 3. (A) Effect of b-elemene on CHOP and Bcl-2 protein in A549 cells. a, b, c, d, e, f represent blank control group, 1 mg/ml b-elemene group, 2 mg/ml 4-PBA plus 1 mg/ml b-elemene group, 5 mg/ml STF-083010 plus 1 mg/ml b-elemene group, 5 mg/ml anti-ATF6 plus 1 mg/ml b-elemene group, 5 mg/ml GSK2656157 plus 1 mg/ml b-elemene group, respectively. Data were means SD (n = 8). *p < 0.05, **p < 0.01, ***p < 0.001, vs. blank control group, #p < 0.05, ##p < 0.1, ###p < 0.001, vs. b-elemene group. (B) Effect of b-elemene on PERK, IRE1a, ATF6 and ATF4 proteins of A549 cells and verification of three pathways by adding different inhibitors. a, blank control group; b, 1 mg/ml b-elemene group; c, 2 mg/ml 4-PBA plus 1 mg/ml b-elemene group; g, from top to bottom, PERK inhibitor GSK2656157 (5 mg/ml), IRE1a inhibitor STF-083010 (5 mg/ml), ATF6 inhibitor anti-ATF6 (5 mg/ml) added, respectively. (C) The mRNA expression level of ERs related proteins by q-PCR. ***p < 0.001, vs. blank control group; ##p < 0.01, ### p < 0.001, vs. b-elemene group.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
495
Fig. 4. The expression level of ERs related proteins by IHC. a, model group; b, b-elemene group (75 mg/kg); c, b-elemene group (100 mg/kg); d, 4-PBA (50 mg/kg) plus b-elemene (75 mg/kg) group. Data were means SD (n = 8). *p < 0.05, **p < 0.01, vs. blank control group.
To study endoplasmic reticulum stress, it is vital to mention that there are three main transmembrane induction molecules on endoplasm reticulum membrane mediated for adjusting UPR: PRKR-like endoplasmic reticulum kinase (PERK), inosital-requiring enzyme-1 (IRE1) and activating transcription factor 6 (ATF6). The activation of UPR derived essentially from the trigger of these three ER sensors [33,34]. Under ERs, the PERK pathway of cells were upregulated to activate its downstream protein ATF4, which contribute to the alleviation of the adverse reactions of ERs, and
then protect the cell from death. In order to reveal the role of
b-elemene in regulating PERK of A549 cells, PERK inhibitor GSK2656157 was used to show PERK-mediated pathway (Fig. 3B). A significant reduction on apoptosis, CHOP and increase in Bcl-2 of A549 cells can be observed in the treatment of GSK2656157 and b-elemene combination. Additionally, the protein level of ATF4, as a downstream factor of the PERK pathway, was also elevated to activate CHOP mediating the apoptosis of A549 cells. The results confirmed b-elemene regulate ERs of A549 cells by PERK pathway.
Table 2 Effect of b-elemene on inhibition rate of lewis-bearing C57/BL6J mice Groups
Model CTX b-elemene
4-PBA + b-elemene
Dose
Body Weight (g)
mg/kg
d1
d13
– 50 50 75 100 50 + 75
18.06 0.99 19.85 1.01 18.36 0.69 19.18 0.77 19.29 1.16 19.01 1.02
21.52 0.99 16.37 1.74** 21.43 0.47 21.61 0.80 21.25 0.72 21.84 1.02
Note 1: Data were obtained from ten individuals and presented as means SD (n = 10). *P < 0.05,
**
Tumor Weight (g)
IR(%)
1.80 0.45 0.59 0.32** 1.47 0.42 1.20 0.28* 0.91 0.36** 1.56 0.48
– 67.38 18.32 33.41 49.55 13.24
P < 0.01, compared with model group.
Table 3 Effect of b-elemene on immune organ index of lewis-bearing C57/BL6J mice Groups
Dose (mg/kg)
Spleen index (mg/g)
Thymus index (mg/g)
Model CTX b-elemene
– 50 50 75 100 50 + 75
8.66 0.11 7.76 0.24* 8.83 0.52 9.72 0.35* 10.01 0.26** 8.79 0.34
1.12 0.11 0.98 0.05* 1.33 0.06 1.61 0.07* 1.72 0.09* 1.59 0.06*
4-PBA + b-elemene
Note 2: Data were obtained from ten individuals and presented as means SD (n = 10). *P < 0.05,
**
P < 0.01, compared with model group.
496
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
Fig. 5. Effect of b-elemene on tumor tissues of C57BL/6J mice (A) and tumor volumes were measured by Visualsonics Vevo 2100 Small Animal Dedicated High-frequency Color Ultrasound (B). Data were obtained from four individuals and presented as means SD (n = 10). *p < 0.05, **p < 0.01, vs. model group.
IRE1a, as a widely present form of IRE1 in ER embrane, is a crucial mediator of apoptosis of cancer cells [35]. IRE1a can be activatd by the treatment with b-elemene. However, the presence of ERs inhibitor can reduce markedly the expresssion level of IRE1a. In addition, IRE1a specific inhibitor STF-083010 alleviated the cell apoptosis caused by b-elemene (Figs. 2 and 3B). These results illustrate that the regulation of b-elemene on ERs of A549 cells may be related to its activation on IRE1a pathway, at least partially. The in vivo evidence suggested that the regulation of b-elemene on ATF6 has a similar trend. b-elemene activated ATF6 pathway and then elevated the down stream protein CHOP, resulting in apoptosis of A549 cells by attenuating Bcl-2. It means b-elemene on A549 cells can induce ERs, which causes activating ATF6mediated unfolded protein to induce cell apoptosis. The presence of anti-ATF6 can elevate the levels of CHOP and Bcl-2 significantly (Fig. 3A). These findings also suggested the contribution of ERsrelated ATF6 to the modulation of b-elemene on apoptosis of A549 cells (Fig. 6). Overall, we conclude that: (i) b-elemene is effective in surpressing NSCLC; (ii) This anti-tumor effect is associated with the regulation of b-elemene on ERs of lung cancer cells; (iii) The regulation of b-elemene on ERs of lung cancer cells is related to the activation of PERK/IRE1a/ATF6 pathway. The present study provides evidence to our knowledge for the first time that b-elemene inhibits the growth of NSCLC is related to the regulation of ERs. It also provides new insights into the regulation of
b-elemene on NSCLC and potential benefit for intervention and treatment of NSCLC. Although the results from our study indicate that b-elemene may be beneficial for anti-NSCLC. However, the in-depth mechanism of b-elemene on ERs and anti-NSCLC need to be performed in further investigations. Conflict of interest The authors have no conflict of interest to declare.
Fig. 6. b-elemene inhibits NSCLC in vivo and in vitro by activating ER stress, associated with PERK/IRE1a/ATF6 signaling pathway.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
Acknowledgements This study was supported by the National natural science foundation of China (No. 8150141025), National natural science foundation of Jiangsu Province (BK20151045) and Jiangsu Province Youth Medical Talent Project (QNRC2016634). References [1] F. Zhang, L. Xu, X. Qu, M. Zhao, B. Jin, J. Kang, Y. Liu, X. Hu, Synergistic antitumor effect of (-elemene and etoposide is mediated via induction of cell apoptosis and cell cycle arrest in non-small cell lung carcinoma cells, Mol. Med. Rep. 4 (2011) 1189–1193. [2] J. Su, L. Zhou, X. Kong, X. Yang, X. Xiang, Y. Zhang, X. Li, L. Sun, Endoplasmic reticulum is at the crossroads of autophagy, inflammation and apoptosis signaling pathways and participates in the pathogenesis of diabetes mellitus, J. Diabetes Res. 2013 (2013) 193461. [3] H.P. Harding, Y. Zhang, A. Bertolotti, H. Zeng, D. Ron, Perk is essential for translational regulation and cell survival during the unfolded protein response, Mol. Cell. 5 (2000) 897–904. [4] W. Tan, J. Lu, M. Huang, Y. Li, M. Chen, G. Wu, J. Gong, Z. Zhong, Z. Xu, Y. Dang, J. Guo, X. Chen, Y. Wang, Anti-cancer natural products isolated from chinese medicinal herbs, Chin Med. 6 (2011) 27. [5] J. Liu, Y. Zhang, J.L. Qu, L. Xu, K.Z. Hou, J.D. Zhang, X.J. Qu, Y.P. Liu, b-Elemeneinduced autophagy protects human gastric cancer cells from undergoing apoptosis, BMC Cancer. 11 (2011) 183. [6] Q.Q. Li, G. Wang, M. Zhang, C.F. Cuff, L. Huang, E. Reed, b-Elemene, a novel plant-derived antineoplastic agent, increases cisplatin chemosensitivity of lung tumor cells by triggering apoptosis, Oncol. Rep. 22 (2009) 161–170. [7] C. Guan, W. Liu, Y. Yue, H. Jin, X. Wang, X.J. Wang, Inhibitory effect of b-elemene on human breast cancer cells, Int. J. Clin. Exp. Pathol. 7 (2014) 3948–3956. [8] Q.Q. Li, G. Wang, H. Liang, J.M. Li, F. Huang, P.K. Agarwal, Y. Zhong, E. Reed, b-Elemene promotes cisplatin-induced cell death in human bladder cancer and other carcinomas, Anticancer Res. 33 (2013) 1421–1428. [9] Z.J. Dai, W. Tang, W.F. Lu, J. Gao, H.F. Kang, X.B. Ma, W.L. Min, X.J. Wang, W.Y. Wu, Antiproliferative and apoptotic effects of b-elemene on human hepatoma HepG2 cells, Cancer Cell Int. 13 (2013) 27. [10] C.C. Yao, Y.R. Tu, J. Jiang, S.F. Ye, H.X. Du, Y. Zhang, b-Elemene reverses the drug resistance of lung cancer A549/DDP cells via the mitochondrial apoptosis pathway, Oncol. Rep. 31 (2014) 2131–2138. [11] C.L. Li, L. Chang, L. Guo, D. Zhao, H.B. Liu, Q.S. Wang, P. Zhang, W.Z. Du, X. Liu, H. T. Zhang, Y. Liu, Y. Zhang, J.H. Xie, J.G. Ming, Y.Q. Cui, Y. Sun, Z.R. Zhang, C.L. Jiang, b-elemene induces caspase-dependent apoptosis in human glioma cells in vitro through the upregulation of bax and Fas/FasL and downregulation of bcl-2, Asian Pac. J. Cancer Prev. 15 (2014) 10407–10412. [12] B. Zou, Q.Q. Li, J. Zhao, J.M. Li, C.F. Cuff, E. Reed, b-Elemene and taxanes synergistically induce cytotoxicity and inhibit proliferation in ovarian cancer and other tumor cells, Anticancer Res. 33 (2013) 929–940. [13] T.Z. Zhu, X.M. Li, L.H. Luo, X. Wang, Z. Li, P. Xie, X. Gao, Z. Song, J. Su, G. Liang, Reversion of malignant phenotypes of human glioblastoma cells by b-elemene through b-catenin-mediated regulation of stemness-, differentiation- and epithelial-to-mesenchymal transition-related molecules, J. Transl. Med. 13 (2015) 356. [14] J. Zheng, L.T. Ma, Q.Y. Ren, L. Li, Y. Zhang, H.J. Shi, Y. Liu, C.H. Li, Y.Q. Dou, S.D. Li, H. Zhang, M.H. Yaang, The influence of astragalus polysaccharide and b-elemene on LX-2 cell growth, apoptosis and activation, BMC Gastroenterol. 14 (2014) 224. [15] R.X. Lee, Q.Q. Li, E. Reed, b-elemene effectively suppresses the growth and survival of both platinum-sensitive and resistant ovarian tumor cells, Anticancer Res. 32 (2012) 3103–3113. [16] J.L. Zhang, Y.Q. Mao, H. Li, X.N. Cui, The effect of beta-elemene on alpha-tubulin polymerization in human hepatoma HepG2 cells, Chin. J. Cancer Res. 25 (2013) 770–776.
497
[17] H. Zhang, F. Xu, T. Xie, H. Jin, L. Shi, H. Zhang, F. Xu, T. Xie, H. Jin, L. Shi, b-elemene induces glioma cell apoptosis by downregulating survivin and, its interaction with hepatitis B X-interacting protein, Oncol. Rep. 28 (2012) (2012) 2083–2090. [18] G. Li, B. Xie, X. Li, Y. Chen, Y. Xu, M. Xu-Welliver, L. Zou, Downregulation of peroxiredoxin-1 by b-elemene enhances the radiosensitivity of lung adenocarcinoma xenografts, Oncol. Rep. 33 (2015) 1427–1433. [19] M.S. Islam, F. Giampieri, M. Janjusevic, M. Gasparrini, T.Y. Forbes-Hernandez, L. Mazzoni, S. Mazzoni, S.R. Giannubilo, B. Ciavattini, F. Mezzetti, M. Castellucci, M. Battino, P. Ciarmela, An anthocyanin rich strawberry extract induces apoptosis and ROS while decreases glycolysis and fibrosis in human uterine leiomyoma cells, Oncotarget (February 15) (2017), doi:http://dx.doi.org/ 10.18632/oncotarget.15333. [20] S. Ryu, W. Lim, F.W. Bazer, G. Song, Chrysin induces death of prostate cancer cells by inducing ROS and ER stress, J. Cell. Physiol. (February 18) (2017), doi: http://dx.doi.org/10.1002/jcp.25861. [21] N. Yang, C. Li, G. Tian, M.M. Zhu, W.Q. Bu, J. Chen, X.F. Hou, L.Q. Di, X.B. Jia, Z.B. Dong, L. Feng, Organic acid component from Taraxacum mongolicum Hand.Mazz alleviates inflammatory injury in lipopolysaccharide-induced acute tracheobronchitis of ICR mice through TLR4/NF-kB signaling pathway, Int. Immunopharmacol. 34 (2016) 92–100. [22] S.W. Mi, X. Gang, D.L. Yuwen, J. Gao, W.J. Guo, X.F. Wu, X.D. Wu, Y. Sun, Y.Q. Su, Y. Shen, X. Xu, Inhibition of autophagy by andrographolide resensitizes cisplatin-resistant non-small cell lung carcinoma cells via activation of the Akt/mTOR pathway, Toxicol. Appl. Pharmacol. 310 (2016) 78–86. [23] Y.Q. Yao, X. Ding, Y.C. Jia, C.X. Huang, Y.Z. Wang, Y.H. Xu, Anti-tumor effect of b-elemene in glioblastoma cells depends on p38 MAPK activation, Cancer Lett. 264 (2008) 127–134. [24] B.J. Zhao, J. Wang, J. Song, C.F. Wang, J.F. Gu, J.R. Yuan, L. Zhang, J. Jiang, L. Feng, X.B. Jia, Beneficial effects of a flavonoid fraction of herba epimedii on bone metabolism in ovariectomized rats, Planta Med. 82 (2016) 322–329. [25] J. Chen, X.F. Hou, G. Wang, Q.X. Zhong, Y. Liu, H.H. Qiu, N. Yang, J.F. Gu, C.F. Wang, L. Zhang, J. Song, L.Q. Huang, X.B. Jia, M.H. Zhang, L. Feng, Terpene glycoside component from Moutan Cortex ameliorates diabetic nephropathy by regulating endoplasmic reticulum stress-related inflammatory responses, J. Ethnopharmacol. 193 (2016) 433–444. [26] S. Liu, L. Zhou, Y. Zhao, Y. Yuan, b-elemene enhances both radiosensitivity and chemosensitivity of glioblastoma cells through the inhibition of the ATM signaling pathway, Oncol. Rep. 34 (2015) 943–951. [27] E.A. Kiyatkin, H.S. Sharma, Acute methamphetamine intoxication: brain hyperthermia blood-brain barrier, brain edema, and morphological cell abnormalities, Int. Rev. Neurobiol. 88 (2009) 65–100. [28] M. Shen, L. Wang, B. Wang, T. Wang, G. Yang, L. Shen, T. Wang, X. Guo, Y. Liu, Y. Xia, L. Jia, X. Wang, Activation of volume-sensitive outwardly rectifying chloride channel by ROS contributes to ER stress and cardiac contractile dysfunction: involvement of CHOP through Wnt, Cell. Death. Dis. 5 (2014) e1528. [29] L. Hong, Y. Zeng, D. Yang, Inhibitory effect of b-elemene on human airway granulation tissue in vivo and in vitro, Respiration 92 (2016) 329–338. [30] J.S. Liu, S.C. He, Z.L. Zhang, R. Chen, L. Fan, G.L. Qiu, S. Chang, L. Li, X.M. Che, Anticancer effects of b-elemene in gastric cancer cells and its potential underlying proteins: a proteomic study, Oncol. Rep. 32 (2014) 2635–2647. [31] J. Xu, H. Hu, B. Chen, R.C. Yue, Z. Zhou, Y. Liu, S. Zhang, L. Xu, H. Wang, Z.P. Yu Lycopene, Protects against hypoxia/reoxygenation injury by alleviating ER stress induced apoptosis in neonatal mouse cardiomyocytes, PLoS One 10 (2015) e0136443. [32] M.M. Pore, T.J. Hiltermann, F.A. Kruyt, Targeting apoptosis pathways in lung cancer, Cancer Lett. 305 (2011) 218–227. [33] M. Schröder, R.J. Kaufman, ER stress and the unfolded protein response, Mutat. Res./Fundam. Mol. Mech. Mutagen. 569 (2005) 29–63. [34] T. Takeichi, E.L. Wang, O. Kitamura, The effects of low-dose methamphetamine pretreatment on endoplasmic reticulum stress and methamphetamine neurotoxicity in the rat midbrain, Leg. Med. 14 (2012) 69–77. [35] J.X. Zhang, Y. Liang, Y.B. Lin, Y.B. Liu, Y. You, W.Q. Yin, IRE1a-TRAF2-ASK1 pathway is involved in CSTMP-induced apoptosis and ER stress in human nonsmall cell lung cancer A549 cells, Biomed. Pharmacother. 82 (2016) 281–289.
Available online at
ScienceDirect www.sciencedirect.com
Original article
b-elemene regulates endoplasmic reticulum stress to induce the apoptosis of NSCLC cells through PERK/IRE1a/ATF6 pathway Ying Liua,b,1, Zi-yu Jianga,c,1, Yuan-li Zhoua , Hui-hui Qiua,c , Gang Wanga,b , Yi Luoa,c , Jing-bing Liua,c, Xiong-wei Liud , Wei-quan Bua,c , Jie Songa,c, Li Cuia,c , Xiao-bin Jiaa,c,* , Liang Fenga,c,* a Key Laboratory of New Drug Delivery Systems of Chinese Materia Medica, Jiangsu Provincial Academy of Chinese Medicine, Jiangsu Nanjing, 210028, PR China b School of Pharmacy, Anhui University of Chinese Medicine, Anhui Hefei 230038, PR China c Third School of Clinical Medical of Nanjing University of Chinese Medicine, Jiangsu Nanjing 210028, PR China d The Affiliated Jiangyin Hospital of Southeast University Medical Collage, Jiangyin 214400, Jiangsu, PR China
A R T I C L E I N F O
Article history: Received 23 April 2017 Received in revised form 28 May 2017 Accepted 20 June 2017 Keywords:
b-elemene Non-small-cell lung cancer Endoplasmic reticulum stress Apoptosis
A B S T R A C T
Endoplasmic reticulum stress (ERs) has been regarded as an important cause for the pathogenesis of nonsmall-cell lung cancer (NSCLC). b-elemene is an active component in the essential oil extracted from a medicinal herb, Curcuma wenyujin, and has been reported to be effective against non-small-cell lung cancer (NSCLC). However, the potential effect and underlying mechanisms of b-elemene on regulating ERs to inhibit NSCLC are still unclear. In the present study, A549 cells and Lewis tumor-bearing C57BL/6J mice were established to evaluate this effect. Visualsonics Vevo 2100 Small Animal Dedicated Highfrequency Color Ultrasound was performed to observe tumor volume in vivo. 3-(4,5-dimethylthiazol-2yl)-2,5- diphenyltetrazolium bromide (MTT) was used to evaluate cell vitality of A549 cells. Furthermore, western blotting (WB), immunohistochemistry (IHC) and quantitative reverse transcription polymerase chain reaction (q-PCR) were applied to detect the ERs-related proteins. Flow cytometry was also applied to detect cell apoptosis and assay kit for reactive oxygen species (ROS) generation. Our results showed that b-elemene inhibited lung cancer tumor growth and cell vitality in a dose- and time-dependent manner. Not only that, b-elemene could up-regulate ERs-related proteins like PERK, IRE1a, ATF6, ATF4, CHOP and down-regulate the Bcl-2 expression. More importantly, ERs inhibitor 4-PBA, IRE1a inhibitor STF-083010, ATF6 inhibitor Anti-ATF6 and PERK inhibitor GSK2656157 can all reduce the amplitude of protein expression changes and apoptosis rates, then weaken the anti-tumor effect of b-elemene. Therefore, the present in vivo and in vitro study revealed that the anti-NSCLC effect of b-elemene is closely related to the activation of ERs through PERK/IRE1a/ATF6 pathway, and this might be beneficial for clinical therapy of NSCLC. © 2017 Elsevier Masson SAS. All rights reserved.
Abbreviations: NSCLC, non-small-cell lung cancer; ER, endoplasmic reticulum; ERs, endoplasmic reticulum stress; 4-PBA, 4-phenylbutyric acid; WB, western blotting; qPCR, quantitative reverse transcription polymerase chain reaction; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; ROS, reactive oxygen species; DCFHDA, 20 ,70 -dichlorofluorescein diacetate; DCF, 20 , 70 -dichlorofluorescin; CTX, Cytoxan; IHC, immunohistochemistry; IRE1a, inositol-requiring enzyme-1a; PERK, PKR-like endoplasmic reticulum kinase; ATF6, activating transcription factor 6; ATF4, activating transcription factor 4; CHOP, C/EBP homologus protein; Bcl-2, B cell lymphoma/ lewkmia-2; GADPH, glyceraldehyde-3-phosphate dehydrogenase; DMSO, dimethyl sulfoxide; OD, optical density; SD, standard deviation; IC50, half-maximal inhibitory concentration; PBS, phosphate buffer saline; PVDF, polyvinylidene fluoride; DMEM, Dulbecco’s modified Eagle's medium; FBS, fetal bovine serum; UPR, unfolded-protein response; ECM, extracellular matrix. * Corresponding authors. E-mail addresses: [email protected] (X.-b. Jia), [email protected] (L. Feng). 1 Ying Liu and Zi-yu Jiang contributed equally to the work. http://dx.doi.org/10.1016/j.biopha.2017.06.073 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
1. Introduction Lung cancer is one of the leading causes of cancer death due to its high morbidity and mortality. In particular, NSCLC accounted for about 80% of all lung cancers [1]. Though endoplasmic reticulum (ER) with a strong system of homeostasis, there are many factors such as hypoxia, oxidative damage or viral infection and pathologic state in the occurrence and development of NSCLC cells. Of note that endoplasmic reticulum sress (ERs) plays an important role in the proliferation and cell vitality of cancer cells. ERs is crucial for maintaining cellular homeostasis environment and activates protein folding reaction (unfolded protein response, UPR) by reducing the synthesis of new proteins. It then could lead to the increase of the partner molecules and promote protein misfolding, which finally promoted cell apoptosis [2]. UPR in ERs have three pathways: PERK pathway, IRE1a pathway and ATF6 pathway. ATF4 is downstream of the PERK protein molecule and also plays an important role in regulating the expression of CHOP [3]. CHOP is expressed in response to ERs. When severe ERs condition appeared, apoptosis starts with the up-regulation of CHOP then activates Bcl-2 to promote apoptosis. The regulation of compounds on ERs of tumor cells are benifical to suppress growth and induce apoptosis of tumors. Elemene (1-methyl-1-vinyl-2, 4-diisopropenyl-cyclohexane), a novel broad-spectrum antitumor molecule, extracted from traditional Chinese medicinal herb Curcuma wenyujin that includes a, b, g and d forms [4]. Its major terpene compounds b-elemene has been developed to a new drug which was approved by the State Food and Drug Administration of China for the treatment of malignant effusion and some solid tumors [5]. Previous studies have shown that b-elemene exhibited anti-cancer effects in many cancer cells, especially lung cancer cells by inducing apoptosis [6]. However, whether b-elemene inhibit proliferation or induce apoptosis of NSCLC cells by regulating ERs still need to be further elucidated. In the present study, we explored the regulation of b-elemene on ERs of NSCLC in vivo and in vitro, and then reveal its mechanism on regulating ERs. This investigation may provides a new insight for the treatment of b-elemene to NSCLC.
491
anti-mouse (lot No., Ab6789) immunoglobulin G (IgG) were all obtained from the Abcam Trading Company Ltd. (Shanghai, China). Allergic ECL chemiluminescence reagent kit (lot No., P0018) and Reactive Oxygen Species assay kit (lot No., S0033) were obtained from Beyotime Institute of Biotechnology (Shanghai, China). 2.2. Cell culture Non-small-cell lung cancer adenocarcinoma cell lines A549 (human) and Lewis (mouse) were both ordered from Nanjing KeyGen Biotech. Co., Ltd. (Nanjing, China). Cells were all cultured in high-glucose DMEM containing 10% inactivated fetal bovine serum (FBS), 80 U/ml of penicillin and 0.08 mg/ml of streptomycin at 37 C with 5% CO2 in a humidified atmosphere and the medium should be replaced every day [7]. After having grown to 80%-85% confluence, cells were digested by 0.25% trypsin-0.02% EDTA solution for the passage or further experiments. 2.3. MTT assay To evaluate inhibitory effects of different concentrations of
b-elemene on A549 cells in vitro, MTT colorimetric method was performed in this study. Cells were seeded in 96-well plates at an approximate density of 1 105 and then divided into different groups. Cells were treated with blank medium without FBS as blank control group, and b-elemene at 1, 2.5, 5, 10, 20, 40, 80, 160, 320 mg/ml respectively as treated group. After 24 h, 48 h and 72 h incubation, MTT (5 mg/ml) of 10 ml was added to each well and then continued to incubate at 37 C for 4 h. Sequentially, DMSO of 100 ml was added after the removal of culture medium. The optical density (OD) at 570 nm was determined using a 96-well plates reader (reference wavelength 630 nm) [8]. All measurements were repeated three times. The survival rates were calculated by the following formula: The cell survival rates (%) = [(the absorbance of treated group absorbance of blank control group)/the absorbance of blank control group] 100% [9]. The IC50 (concentration of drug that inhibits cell growth by 50%) values was calculated by linear regression [10]. 2.4. Flow cytometry analysis
2. Materials and methods 2.1. Reagents and antibodies
b-elemene (lot No.,515-13-9) (purity 99%) was purchased from Yuanda Pharmaceuticals Co., Ltd. (Dalian, China). 4-PBA (lot No., STBG2117 V) (purity 99%) was purchased from SigmaAldrich Chemical Co., Ltd. (St. Louis, MO, USA). STF-083010 (lot No., 4509-10), anti-ATF6 (lot No., 9H209) and GSK2656157 (lot No., S7033) were all ordered from Nanjing KeyGen Biotech. Co., Ltd. (Nanjing, China). DMEM medium (lot No., 160425), 0.25% trypsin (lot No., 20160317), 3-(4, 9 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazoliumbromide (MTT) and dimethyl sulfoxide (DMSO) were provided by Nanjing Sunshine Biotechnology Co., Ltd. (Nanjing, China). Fetal bovine serum (FBS) (lot No., 20151130) was obtained from Invitrogen (Carlsbad, CA, USA). Antibody against CHOP (lot No., YB526) was obtained from Shanghai Yubo biological technology Co., Ltd. (Shanghai, China). Antibodies against PERK (lot No., 3192) and IRE1a (lot No., 3294) were purchased from Cell Signaling Technology, Inc. (ShangHai, China). Anti-ATF6 (lot No., 24169-1-AP) and anti-ATF4 (lot No., 10835-1AP) were purchased from Proteintech Group, Inc. (Wuhan, China). Anti-Bcl-2 (lot No., ab48394) was obtained from Shanghai Maiyueer biological technology Co., Ltd. (Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GADPH) antibody (lot No., Ab8226), HRP-labeled anti-rabbit (lot No.,Ab6721) and
Flow cytometry was used to detect cells apoptosis by staining apoptotic cells with both Annexin V-fluorescein isothiocyanate (FITC) and Propidium iodide (PI) before and after administration. A549 cells were grown in 6-well plates (2 106) overnight and treated with blank medium, 1 mg/ml b-elemene, 1 mg/ml b-elemene plus 2 mg/ml 4-PBA, 5 mg/ml anti-IRE1a plus 1 mg/ml b-elemene, 5 mg/ml anti-ATF6 plus 1 mg/ml b-elemene, 5 mg/ml GSK2656157 plus 1 mg/ml b-elemene, respectively. At the end of incubation, cells were collected and washed twice with ice phosphate-buffered saline (PBS), then 400 ml of PBS binding buffer was added to each tube (12 mm 75 mm, polystyrene round bottom) for suspension [11]. The following 5 ml of annexin V-FITC and 10 ml of PI were added and then incubated at room temperature in the dark for 15 min. Samples were detected by LSRIII flow cytometry and the data were analyzed with CellQuest Pro software (Becton-Dickinson) [12]. 2.5. Western blotting analysis A549 cells (2 106) in 6-well plates were exposed to vehicle and indicated doses of drugs for 24 h, then harvested by trypsinization for WB. After washing with ice-cold PBS, all samples were scraped in 200 ml of Thermo scientific RIPA buffer (50 mM Tris-HCl (pH 7.4), 1.0% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM aprotinin, 1 mg/ml PMSF, leupeptin and pepstatin) (Pierce,
492
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
USA) and mixed with SDS-PAGE sample buffer, boiled for 5 min [13]. Protein concentrations were determined using the BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA) and equal amounts of proteins were seperated on 10% SDS-PAGE, then electrophoretically transferred onto a PVDF (polyvinylidene difluoride) membrane [14]. The membrane were blocked with 5% skimmed milk for 2 h, incubated with the primary antibodies, anti-CHOP (1: 750 dilution), anti-PERK (1: 600 dilution), antiIRE1a (1: 600 dilution), anti-ATF6 (1: 800 dilution), anti-ATF4 (1: 600 dilution) and GAPDH (1: 2500 dilution) at 4 C overnight and then washed twice with TBST (Tris-HCl buffer salt solution). HRPlabeled secondary antibodies (goat anti-rabbit and goat antimouse) at the dilution of 1:1000 were added for incubation in 37 C for 2 h. Immunoreactive protein bands were detected with the ECL system. All data were repeated three times [15].
Table 1 The sequences of the primers for the ER-stress related genes Gene
Sequences (50 -30 )
CHOP
forward: TGGAACCTGAGGAGAGAGTGTT reverse: GGATAATGGGGAGTGGCTGG forward: AGGACAGAGGGGACAGAGTTG reverse: TAATGACCTTTTCTTCCCTGCTCC forward: TAGTCAGTTCTGCGTCCGCT reverse: TTCCAAAAATCCCGAGGCCG forward: AGTATTTTGTCCGCCTGCCG reverse: GCAGAATCCCAATCTTCATCCA forward: CTGATTCTCATTCAGGCTTCTCAC reverse: GAAGGCATCCTCCTTGCTGTT forward: GAAGGTCGGAGTCAACGGAT reverse: CCTGGAAGATGGTGATGGG
PERK IRE1a ATF6 ATF4 GAPDH
2.6. Real-time quantitative polymerase chain reaction (q-PCR) analysis q-PCR assay was used to analyze the mRNA expression of ERs related proteins in A549 cells. Cells in logarithmic growth phase (2 106) were similarly seeded in 6-well plates and cultured for 24 h, and then exposed to drug molecules [16]. Total RNA was extracted from cells using Trizol Reagent (Invitrogen15596-026, USA) and quantified. The cDNA was synthesized using First chain cDNA synthesis kit (ThermoFisherK1622, USA) [17] and the synthetic cDNA was taken as a template to carry out polymerase chain reaction. b-actin was used as the reference. Primers were provided by GenScript Co., Ltd. (Nanjing, China) and designed by Primer software (version 6.0). The specific primer sequences were shown in Table 1. The PCR protocol was as follows: predenaturizing for 10 min at 95 C, denaturizing for 15 s at 95 C, annealing at 60 C for 20 s and extension at 72 C for 40 s [18]. The whole reaction cycled for 40 times and the data was read by fluorescence quantitative PCR automatically. 2.7. Determination of reactive oxygen species (ROS) production The production of ROS was detected by fluorometric assay using 20 , 70 -dichlorofluorescein diacetate (DCFH-DA) which is converted to fluorescent 20 , 70 -dichlorofluorescin (DCF) in the presence of peroxides [19]. A549 cells suspension was adjusted to 2 106 cells in 6-well plates that treated with drug molecules. After removal of cell medium, serum-free medium diluted DCFH-DA was added to a final concentration of 10 mM for 20 min at 37 C. Then, cells were collected and washed with PBS after centrifugation. The fluorescence intensities of the suspensions were recorded with Olymplus IX51 (Olympus, Tokyo, Japan) using the excitation and emission wavelengths of 488 nm and 525 nm, respectively [20]. 2.8. Transplantation of Lewis cells into C57BL/6J mice Lewis tumor-bearing C57BL/6J mice model was established to assess b-elemene efficacy in vivo. Seven-week-old specific pathogen-free male C57BL/6J mice (weight 18–20 g) were obtained from Shanghai SLAC Laboratory Animal Center (Shanghai, China) and maintained ten per cage in animal facility under standard laboratory (temperature: 25 1 C, the relative humidity: 45 5%, and 12 h light/dark cycle with access to food and water ad libitum) in accordance with Chinese legislation on the use and care of laboratory animals [21]. All protocols for experiments were supplied by the Institutional Animal Care and Ethics Committee of Jiangsu Provincial Academy of Chinese Medicine. After seven days of accommodation, cultured Lewis cells were washed with and resuspended in ice-cold PBS diluted to 2.5 107/ ml, then subcutaneously injected into the right shoulder region of
each male mice (0.2 ml of suspension) following the strict sterile operation [22]. After injection, mice were randomly divided into seven groups (ten for each group) and all administered daily for four weeks by intraperitoneally injection. Specific experimental groups are as follows: (1) Blank control group (normal saline of 0.2 ml/d); (2) Negative control group (saline of 2 ml/d); (3) CTX group (20 mg/kg/d as positive drug); (4) b-elemene group (50, 75, 100 mg/kg/d, repectively); (5) 4-PBA + b-elemene group (4-PBA of 50 mg/kg/d, b-elemene of 75 mg/kg/d). Tumor volumes were measured by Visualsonics Vevo 2100 Small Animal Dedicated High-frequency Color Ultrasound and calculated. 2.9. Inhibitory rate and viscera index calculation Tumor volumes were measured using Vevo2100 high resolution small animals ultrasonic imaging system (MS 250, center frequency is 21 MHz, detection width of 23.04 mm, depth of 20.00 mm). The three-dimensional images were to calculate the volume by adjusting the probe on computer ultrasound image. Finally, mice were sacrificed and the tumors, thymus and spleen were dissected and weighed individually [23]. Tumor inhibitory rate (%) and viscera index were calculated by the following formulas: Tumor inhibitory rate (%) = (average tumor weight of model group averge tumor weight of treated group)/averge tumor weight of model group 100%; viscera index = averge viscera weight (g)/averge body weight (g) 100%. 2.10. Immunohistochemistry (IHC) assay IHC assay was processed using a standard immunostaining protocol as previously reported [24]. Paraffin sections of lung cancer tumor tissues from C57BL/6J mice were obtained and deparaffinized. Sequentially, citrate buffer (pH 6.0) was used to get antigen repaired. After that, each slice added two drops of 3% H2O2-methanol solution and incubated at room temperature (15– 25 C) for 10 min to block endogenous peroxidase activity and then labeled with different primary antibodies (1: 100 for CHOP and PERK) for 2 h at 37 C. PBS was used to replace the primary antibody for the negative control [25]. Next, 50–100 ml of readyto-use goat serum was added and incubated for 20 min in a humidified chamber for blocking [26]. DAB Kit (DAB-1031, FuZhou, China) was used as chromogenic agent. Slices were put into hematoxylin solution for redyeing, then dehydrated and sealed the pieces, the protein expression in tissue cells were observed using an IX51 Olympus microscope (Olympus, Tokyo, Japan). Each section selected four photograph fields of vision randomly.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
2.11. Statistical analysis All experiments were repeated at least three times. Data were presented as means standard deviation (SD). The results were analyzed by one-way analysis of variance (ANOVA) with post hoc multiple comparisons and Student’s t-test for the comparison of any two groups. P-value of less than 0.05 was considered statistically significant and all statistical analysis was done by SPSS 21.0. 3. Results 3.1. b-elemene inhibited the cell vitality of A549 cells A549 cells were exposed to different concentrations of
b-elemene to evaluate its survival rates using MTT method. Timeand dose-effect curve of b-elemene on A549 cells were shown in Fig. 1, it can be seen that b-elemene inhibit the cell vitality of A549 cells with the increase of concentration and the extension of time. The half-maximal inhibitory concentration (IC50) values of b-elemene at 48 h were 27.5 mg/ml for A549 cells [27]. Our results indicated that b-elemene could effectively inhibit human lung cells growth and proliferation in a dose- and time-dependent manner. 3.2. b-elemene induced ROS generation in A549 cells Oxidative stress is a potential contributor to ERs of lung cancer cells [28]. The increase of ROS plays a significant role in mediating ERs and may become the trigger of the ERs [29]. After cell culturing for 24 h, added 1 ml of DCFH-DA at a final concentration of 10 mM to each well and incubated at 37 C for 20 min. Then washed with blank medium to remove the probe that did not enter the cell and could significantly improve the level of reactive oxygen species. As depicted in Fig. 2A, an obvious increase in ROS levels was found after b-elemene treatment in A549 cells (p < 0.001), this may hinted the occurrence of ERs. 3.3. b-elemene induced the apoptosis of A549 cells through PERK/ IRE1a/ATF6 pathway Herein, A549 cells were exposed to vehicle and indicated doses of drugs. Cells were collected for apoptosis determination using an Annexin V/PI detection kit [30]. Results were shown in Fig. 2B that cell apoptosis rate in blank control group was 6.91%, manifested with high cell survival rate; cell apoptosis rate of b-elemene group was 48.01%, which increased significantly in contrast to blank control group. Moreover, 4-PBA alleviated cell apoptosis induced by b-elemene with a rate of 31.84%. These findings showed that
Fig. 1. Time- and dose-effect curve of b-elemene on A549 cells. The survival rates of b-elemene were decreased with the extension of exposure time and increase of concentration. The IC50 values of b-elemene at 48 h were 27.5 mg/ml for A549 cells.
493
b-elemene has strong effect on inducing cell apoptosis and ERs inhibitor 4-PBA can prevent b-elemene-induced cell apoptosis. It’s indicated that b-elemene may induces the apoptosis of A549 cells through ERs. In order to clarify the mechanism of apoptosis, different inhibitors were added to investigate cell apoptosis. As depicted in Fig. 3A, compared with the blank control group, b-elemene upregulated CHOP and down-regulated Bcl-2. However, the trend was opposite when A549 cells exposed to ERs inhibitors like the corresponding selective IRE1a inhibitor STF-083010, ATF6 inhibitor Anti-ATF6 and PERK inhibitor GSK2656157. Combined with Fig. 3B, all these suggested that the antitumor effect of b-elemene was due to activating ERs by PERK/IRE1a/ATF6 pathway. 3.4. b-elemene suppressed the development of tumors in C57BL/6J mice It was clearly seen that b-elemene (50, 75, 100 mg/kg) could significantly inhibit the tumor growth of Lewis tumor-bearing C57BL/6J mice in a dose-dependent manner, compared with NS group (Fig. 4A). However, it could attenuate the anti-tumor effect when ERS inhibitor 4-PBA added (Fig. 4A and Table 2). The same results could be observed in Visualsonics Vevo 2100 Small Animal Dedicated High-frequency Color Ultrasound (Fig. 4B). In addition, compared with model group, the immune organ index of positive group was significantly lower than that of b-elemene group (Table 3). Pictures and tables all above suggested that b-elemene could improve body's immune function to a certain extent in its anti-tumor process. And we further inferred that b-elemene may enhance its anti-NSCLC effects by activating ERs. 3.5. Anti-tumor effect of b-elemene is associated with ERs The results of ROS may illustrate the activation of ERs. Combined with western blotting results (Fig. 3B), it showed that the expression of ERs related proteins were up-regulated by b-elemene in contrast to 4-PBA groups. The expression levels of CHOP and PERK protein in IHC (Fig. 5) and PCR (Fig. 3C) results were consistent with WB (Fig. 3A and B). All data revealed that the anti-NSCLC effect of b-elemene was mediate by ERs. 4. Discussion and conclusions
b-elemene has been regarded as a promising antitumor drug that is reported by a lot of literatures. In this study, we established the models of A549 cells and Lewis-bearing C57BL/6J mice to evaluate the effect of b-elemene in NSCLC treatment both in vivo and in vitro, The regulation of b-elemene on ERs of NSCLC cells was evaluated and its possible mechanism was explored for the first time. All evidence has shown that the activation of ERs contributes to the inhibitory effect of anti-NSCLC and this provides an effective strategy to regulate ERs to inhibit the cell viability or induce apoptosis of NSCLC cells. Of note that this regulation might be associated with the activation of PERK/IRE1a/ATF6 pathway. Not only could b-elemene effectively inhibit the activity of tumor cells, but also the survival rates of b-elemene were decreased with the extension of acting time within 24–72 h in the cell vitality test. The survival rates of A549 cells exposed to b-elemene for 24 h, 48 h and 72 h incubation times have no significant differences in Fig. 1. Considering 72 h was too long and former studies have shown that blinding to extend the duration or high-dosing can lead to stronger side effects on the body. Hence, 48 h was chosen as the optimal exposure time for further study in vitro. Accordingly, in vivo experimental results showed that b-elemene had an effect on suppressing tumor growth in doseand time-dependent manner and improving the immune function.
494
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
Fig. 2. Effect of b-elemene on ROS generation (A) and induction of apoptosis (B) in A549 cells. For ROS level, a, blank control group; b, 1 mg/ml b-elemene group. Data were presented as means SD (n = 8). ***p < 0.001, vs. blank control group, #p < 0.05, ##p < 0.01, vs. b-elemene group. Cell apoptosis was detected by Flow cytometry. a, blank control group; b, 1 mg/ml b-elemene group; c, 2 mg/ml 4-PBA plus 1 mg/ml b-elemene group; d, 5 mg/ml anti-IRE1a plus 1 mg/ml b-elemene group; e, 5 mg/ml anti-ATF6 plus 1 mg/ml b-elemene group; f, 5 mg/ml GSK2656157 plus 1 mg/ml b-elemene group.
ER is an extensive intracellular membranous network involved in protein synthesis. Stress condition such as ROS generation can affect the ER steady state, trigger ERs and initiate the UPR. When ERs is excessive and prolonged, transcription of the CHOP is adjusted by modulating the expression of the Bcl-2 protein, leading to apoptosis [31]. Apoptosis, or programmed cell death, plays an essential role in maintaining human stable internal environment [32]. ERs was involved in mediating cell apoptosis. Herein, flow cytometry was used to evaluate that b-elemene induced apoptosis in human lung
cancer cells A549, combined with WB and q-PCR experiments. In this study, a significant apoptosis of A549 cells exposed to b-elemene was observed. Additionally, 4-PBA can also attenuate the apoptosis of A549 cells in the presence of b-elemene. Bcl-2 as an apoptotic gene which has the effect of inhibiting apoptosis. The level of Bcl-2 of A549 cells was also reduced by b-elemene treatment whereas increased significantly by 4-PBA. These findings indicated that the activated pathway of b-elemene on ERs might be related to the down-regulation of Bcl-2, resulting in apoptosis of cancer cells.
Fig. 3. (A) Effect of b-elemene on CHOP and Bcl-2 protein in A549 cells. a, b, c, d, e, f represent blank control group, 1 mg/ml b-elemene group, 2 mg/ml 4-PBA plus 1 mg/ml b-elemene group, 5 mg/ml STF-083010 plus 1 mg/ml b-elemene group, 5 mg/ml anti-ATF6 plus 1 mg/ml b-elemene group, 5 mg/ml GSK2656157 plus 1 mg/ml b-elemene group, respectively. Data were means SD (n = 8). *p < 0.05, **p < 0.01, ***p < 0.001, vs. blank control group, #p < 0.05, ##p < 0.1, ###p < 0.001, vs. b-elemene group. (B) Effect of b-elemene on PERK, IRE1a, ATF6 and ATF4 proteins of A549 cells and verification of three pathways by adding different inhibitors. a, blank control group; b, 1 mg/ml b-elemene group; c, 2 mg/ml 4-PBA plus 1 mg/ml b-elemene group; g, from top to bottom, PERK inhibitor GSK2656157 (5 mg/ml), IRE1a inhibitor STF-083010 (5 mg/ml), ATF6 inhibitor anti-ATF6 (5 mg/ml) added, respectively. (C) The mRNA expression level of ERs related proteins by q-PCR. ***p < 0.001, vs. blank control group; ##p < 0.01, ### p < 0.001, vs. b-elemene group.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
495
Fig. 4. The expression level of ERs related proteins by IHC. a, model group; b, b-elemene group (75 mg/kg); c, b-elemene group (100 mg/kg); d, 4-PBA (50 mg/kg) plus b-elemene (75 mg/kg) group. Data were means SD (n = 8). *p < 0.05, **p < 0.01, vs. blank control group.
To study endoplasmic reticulum stress, it is vital to mention that there are three main transmembrane induction molecules on endoplasm reticulum membrane mediated for adjusting UPR: PRKR-like endoplasmic reticulum kinase (PERK), inosital-requiring enzyme-1 (IRE1) and activating transcription factor 6 (ATF6). The activation of UPR derived essentially from the trigger of these three ER sensors [33,34]. Under ERs, the PERK pathway of cells were upregulated to activate its downstream protein ATF4, which contribute to the alleviation of the adverse reactions of ERs, and
then protect the cell from death. In order to reveal the role of
b-elemene in regulating PERK of A549 cells, PERK inhibitor GSK2656157 was used to show PERK-mediated pathway (Fig. 3B). A significant reduction on apoptosis, CHOP and increase in Bcl-2 of A549 cells can be observed in the treatment of GSK2656157 and b-elemene combination. Additionally, the protein level of ATF4, as a downstream factor of the PERK pathway, was also elevated to activate CHOP mediating the apoptosis of A549 cells. The results confirmed b-elemene regulate ERs of A549 cells by PERK pathway.
Table 2 Effect of b-elemene on inhibition rate of lewis-bearing C57/BL6J mice Groups
Model CTX b-elemene
4-PBA + b-elemene
Dose
Body Weight (g)
mg/kg
d1
d13
– 50 50 75 100 50 + 75
18.06 0.99 19.85 1.01 18.36 0.69 19.18 0.77 19.29 1.16 19.01 1.02
21.52 0.99 16.37 1.74** 21.43 0.47 21.61 0.80 21.25 0.72 21.84 1.02
Note 1: Data were obtained from ten individuals and presented as means SD (n = 10). *P < 0.05,
**
Tumor Weight (g)
IR(%)
1.80 0.45 0.59 0.32** 1.47 0.42 1.20 0.28* 0.91 0.36** 1.56 0.48
– 67.38 18.32 33.41 49.55 13.24
P < 0.01, compared with model group.
Table 3 Effect of b-elemene on immune organ index of lewis-bearing C57/BL6J mice Groups
Dose (mg/kg)
Spleen index (mg/g)
Thymus index (mg/g)
Model CTX b-elemene
– 50 50 75 100 50 + 75
8.66 0.11 7.76 0.24* 8.83 0.52 9.72 0.35* 10.01 0.26** 8.79 0.34
1.12 0.11 0.98 0.05* 1.33 0.06 1.61 0.07* 1.72 0.09* 1.59 0.06*
4-PBA + b-elemene
Note 2: Data were obtained from ten individuals and presented as means SD (n = 10). *P < 0.05,
**
P < 0.01, compared with model group.
496
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
Fig. 5. Effect of b-elemene on tumor tissues of C57BL/6J mice (A) and tumor volumes were measured by Visualsonics Vevo 2100 Small Animal Dedicated High-frequency Color Ultrasound (B). Data were obtained from four individuals and presented as means SD (n = 10). *p < 0.05, **p < 0.01, vs. model group.
IRE1a, as a widely present form of IRE1 in ER embrane, is a crucial mediator of apoptosis of cancer cells [35]. IRE1a can be activatd by the treatment with b-elemene. However, the presence of ERs inhibitor can reduce markedly the expresssion level of IRE1a. In addition, IRE1a specific inhibitor STF-083010 alleviated the cell apoptosis caused by b-elemene (Figs. 2 and 3B). These results illustrate that the regulation of b-elemene on ERs of A549 cells may be related to its activation on IRE1a pathway, at least partially. The in vivo evidence suggested that the regulation of b-elemene on ATF6 has a similar trend. b-elemene activated ATF6 pathway and then elevated the down stream protein CHOP, resulting in apoptosis of A549 cells by attenuating Bcl-2. It means b-elemene on A549 cells can induce ERs, which causes activating ATF6mediated unfolded protein to induce cell apoptosis. The presence of anti-ATF6 can elevate the levels of CHOP and Bcl-2 significantly (Fig. 3A). These findings also suggested the contribution of ERsrelated ATF6 to the modulation of b-elemene on apoptosis of A549 cells (Fig. 6). Overall, we conclude that: (i) b-elemene is effective in surpressing NSCLC; (ii) This anti-tumor effect is associated with the regulation of b-elemene on ERs of lung cancer cells; (iii) The regulation of b-elemene on ERs of lung cancer cells is related to the activation of PERK/IRE1a/ATF6 pathway. The present study provides evidence to our knowledge for the first time that b-elemene inhibits the growth of NSCLC is related to the regulation of ERs. It also provides new insights into the regulation of
b-elemene on NSCLC and potential benefit for intervention and treatment of NSCLC. Although the results from our study indicate that b-elemene may be beneficial for anti-NSCLC. However, the in-depth mechanism of b-elemene on ERs and anti-NSCLC need to be performed in further investigations. Conflict of interest The authors have no conflict of interest to declare.
Fig. 6. b-elemene inhibits NSCLC in vivo and in vitro by activating ER stress, associated with PERK/IRE1a/ATF6 signaling pathway.
Y. Liu et al. / Biomedicine & Pharmacotherapy 93 (2017) 490–497
Acknowledgements This study was supported by the National natural science foundation of China (No. 8150141025), National natural science foundation of Jiangsu Province (BK20151045) and Jiangsu Province Youth Medical Talent Project (QNRC2016634). References [1] F. Zhang, L. Xu, X. Qu, M. Zhao, B. Jin, J. Kang, Y. Liu, X. Hu, Synergistic antitumor effect of (-elemene and etoposide is mediated via induction of cell apoptosis and cell cycle arrest in non-small cell lung carcinoma cells, Mol. Med. Rep. 4 (2011) 1189–1193. [2] J. Su, L. Zhou, X. Kong, X. Yang, X. Xiang, Y. Zhang, X. Li, L. Sun, Endoplasmic reticulum is at the crossroads of autophagy, inflammation and apoptosis signaling pathways and participates in the pathogenesis of diabetes mellitus, J. Diabetes Res. 2013 (2013) 193461. [3] H.P. Harding, Y. Zhang, A. Bertolotti, H. Zeng, D. Ron, Perk is essential for translational regulation and cell survival during the unfolded protein response, Mol. Cell. 5 (2000) 897–904. [4] W. Tan, J. Lu, M. Huang, Y. Li, M. Chen, G. Wu, J. Gong, Z. Zhong, Z. Xu, Y. Dang, J. Guo, X. Chen, Y. Wang, Anti-cancer natural products isolated from chinese medicinal herbs, Chin Med. 6 (2011) 27. [5] J. Liu, Y. Zhang, J.L. Qu, L. Xu, K.Z. Hou, J.D. Zhang, X.J. Qu, Y.P. Liu, b-Elemeneinduced autophagy protects human gastric cancer cells from undergoing apoptosis, BMC Cancer. 11 (2011) 183. [6] Q.Q. Li, G. Wang, M. Zhang, C.F. Cuff, L. Huang, E. Reed, b-Elemene, a novel plant-derived antineoplastic agent, increases cisplatin chemosensitivity of lung tumor cells by triggering apoptosis, Oncol. Rep. 22 (2009) 161–170. [7] C. Guan, W. Liu, Y. Yue, H. Jin, X. Wang, X.J. Wang, Inhibitory effect of b-elemene on human breast cancer cells, Int. J. Clin. Exp. Pathol. 7 (2014) 3948–3956. [8] Q.Q. Li, G. Wang, H. Liang, J.M. Li, F. Huang, P.K. Agarwal, Y. Zhong, E. Reed, b-Elemene promotes cisplatin-induced cell death in human bladder cancer and other carcinomas, Anticancer Res. 33 (2013) 1421–1428. [9] Z.J. Dai, W. Tang, W.F. Lu, J. Gao, H.F. Kang, X.B. Ma, W.L. Min, X.J. Wang, W.Y. Wu, Antiproliferative and apoptotic effects of b-elemene on human hepatoma HepG2 cells, Cancer Cell Int. 13 (2013) 27. [10] C.C. Yao, Y.R. Tu, J. Jiang, S.F. Ye, H.X. Du, Y. Zhang, b-Elemene reverses the drug resistance of lung cancer A549/DDP cells via the mitochondrial apoptosis pathway, Oncol. Rep. 31 (2014) 2131–2138. [11] C.L. Li, L. Chang, L. Guo, D. Zhao, H.B. Liu, Q.S. Wang, P. Zhang, W.Z. Du, X. Liu, H. T. Zhang, Y. Liu, Y. Zhang, J.H. Xie, J.G. Ming, Y.Q. Cui, Y. Sun, Z.R. Zhang, C.L. Jiang, b-elemene induces caspase-dependent apoptosis in human glioma cells in vitro through the upregulation of bax and Fas/FasL and downregulation of bcl-2, Asian Pac. J. Cancer Prev. 15 (2014) 10407–10412. [12] B. Zou, Q.Q. Li, J. Zhao, J.M. Li, C.F. Cuff, E. Reed, b-Elemene and taxanes synergistically induce cytotoxicity and inhibit proliferation in ovarian cancer and other tumor cells, Anticancer Res. 33 (2013) 929–940. [13] T.Z. Zhu, X.M. Li, L.H. Luo, X. Wang, Z. Li, P. Xie, X. Gao, Z. Song, J. Su, G. Liang, Reversion of malignant phenotypes of human glioblastoma cells by b-elemene through b-catenin-mediated regulation of stemness-, differentiation- and epithelial-to-mesenchymal transition-related molecules, J. Transl. Med. 13 (2015) 356. [14] J. Zheng, L.T. Ma, Q.Y. Ren, L. Li, Y. Zhang, H.J. Shi, Y. Liu, C.H. Li, Y.Q. Dou, S.D. Li, H. Zhang, M.H. Yaang, The influence of astragalus polysaccharide and b-elemene on LX-2 cell growth, apoptosis and activation, BMC Gastroenterol. 14 (2014) 224. [15] R.X. Lee, Q.Q. Li, E. Reed, b-elemene effectively suppresses the growth and survival of both platinum-sensitive and resistant ovarian tumor cells, Anticancer Res. 32 (2012) 3103–3113. [16] J.L. Zhang, Y.Q. Mao, H. Li, X.N. Cui, The effect of beta-elemene on alpha-tubulin polymerization in human hepatoma HepG2 cells, Chin. J. Cancer Res. 25 (2013) 770–776.
497
[17] H. Zhang, F. Xu, T. Xie, H. Jin, L. Shi, H. Zhang, F. Xu, T. Xie, H. Jin, L. Shi, b-elemene induces glioma cell apoptosis by downregulating survivin and, its interaction with hepatitis B X-interacting protein, Oncol. Rep. 28 (2012) (2012) 2083–2090. [18] G. Li, B. Xie, X. Li, Y. Chen, Y. Xu, M. Xu-Welliver, L. Zou, Downregulation of peroxiredoxin-1 by b-elemene enhances the radiosensitivity of lung adenocarcinoma xenografts, Oncol. Rep. 33 (2015) 1427–1433. [19] M.S. Islam, F. Giampieri, M. Janjusevic, M. Gasparrini, T.Y. Forbes-Hernandez, L. Mazzoni, S. Mazzoni, S.R. Giannubilo, B. Ciavattini, F. Mezzetti, M. Castellucci, M. Battino, P. Ciarmela, An anthocyanin rich strawberry extract induces apoptosis and ROS while decreases glycolysis and fibrosis in human uterine leiomyoma cells, Oncotarget (February 15) (2017), doi:http://dx.doi.org/ 10.18632/oncotarget.15333. [20] S. Ryu, W. Lim, F.W. Bazer, G. Song, Chrysin induces death of prostate cancer cells by inducing ROS and ER stress, J. Cell. Physiol. (February 18) (2017), doi: http://dx.doi.org/10.1002/jcp.25861. [21] N. Yang, C. Li, G. Tian, M.M. Zhu, W.Q. Bu, J. Chen, X.F. Hou, L.Q. Di, X.B. Jia, Z.B. Dong, L. Feng, Organic acid component from Taraxacum mongolicum Hand.Mazz alleviates inflammatory injury in lipopolysaccharide-induced acute tracheobronchitis of ICR mice through TLR4/NF-kB signaling pathway, Int. Immunopharmacol. 34 (2016) 92–100. [22] S.W. Mi, X. Gang, D.L. Yuwen, J. Gao, W.J. Guo, X.F. Wu, X.D. Wu, Y. Sun, Y.Q. Su, Y. Shen, X. Xu, Inhibition of autophagy by andrographolide resensitizes cisplatin-resistant non-small cell lung carcinoma cells via activation of the Akt/mTOR pathway, Toxicol. Appl. Pharmacol. 310 (2016) 78–86. [23] Y.Q. Yao, X. Ding, Y.C. Jia, C.X. Huang, Y.Z. Wang, Y.H. Xu, Anti-tumor effect of b-elemene in glioblastoma cells depends on p38 MAPK activation, Cancer Lett. 264 (2008) 127–134. [24] B.J. Zhao, J. Wang, J. Song, C.F. Wang, J.F. Gu, J.R. Yuan, L. Zhang, J. Jiang, L. Feng, X.B. Jia, Beneficial effects of a flavonoid fraction of herba epimedii on bone metabolism in ovariectomized rats, Planta Med. 82 (2016) 322–329. [25] J. Chen, X.F. Hou, G. Wang, Q.X. Zhong, Y. Liu, H.H. Qiu, N. Yang, J.F. Gu, C.F. Wang, L. Zhang, J. Song, L.Q. Huang, X.B. Jia, M.H. Zhang, L. Feng, Terpene glycoside component from Moutan Cortex ameliorates diabetic nephropathy by regulating endoplasmic reticulum stress-related inflammatory responses, J. Ethnopharmacol. 193 (2016) 433–444. [26] S. Liu, L. Zhou, Y. Zhao, Y. Yuan, b-elemene enhances both radiosensitivity and chemosensitivity of glioblastoma cells through the inhibition of the ATM signaling pathway, Oncol. Rep. 34 (2015) 943–951. [27] E.A. Kiyatkin, H.S. Sharma, Acute methamphetamine intoxication: brain hyperthermia blood-brain barrier, brain edema, and morphological cell abnormalities, Int. Rev. Neurobiol. 88 (2009) 65–100. [28] M. Shen, L. Wang, B. Wang, T. Wang, G. Yang, L. Shen, T. Wang, X. Guo, Y. Liu, Y. Xia, L. Jia, X. Wang, Activation of volume-sensitive outwardly rectifying chloride channel by ROS contributes to ER stress and cardiac contractile dysfunction: involvement of CHOP through Wnt, Cell. Death. Dis. 5 (2014) e1528. [29] L. Hong, Y. Zeng, D. Yang, Inhibitory effect of b-elemene on human airway granulation tissue in vivo and in vitro, Respiration 92 (2016) 329–338. [30] J.S. Liu, S.C. He, Z.L. Zhang, R. Chen, L. Fan, G.L. Qiu, S. Chang, L. Li, X.M. Che, Anticancer effects of b-elemene in gastric cancer cells and its potential underlying proteins: a proteomic study, Oncol. Rep. 32 (2014) 2635–2647. [31] J. Xu, H. Hu, B. Chen, R.C. Yue, Z. Zhou, Y. Liu, S. Zhang, L. Xu, H. Wang, Z.P. Yu Lycopene, Protects against hypoxia/reoxygenation injury by alleviating ER stress induced apoptosis in neonatal mouse cardiomyocytes, PLoS One 10 (2015) e0136443. [32] M.M. Pore, T.J. Hiltermann, F.A. Kruyt, Targeting apoptosis pathways in lung cancer, Cancer Lett. 305 (2011) 218–227. [33] M. Schröder, R.J. Kaufman, ER stress and the unfolded protein response, Mutat. Res./Fundam. Mol. Mech. Mutagen. 569 (2005) 29–63. [34] T. Takeichi, E.L. Wang, O. Kitamura, The effects of low-dose methamphetamine pretreatment on endoplasmic reticulum stress and methamphetamine neurotoxicity in the rat midbrain, Leg. Med. 14 (2012) 69–77. [35] J.X. Zhang, Y. Liang, Y.B. Lin, Y.B. Liu, Y. You, W.Q. Yin, IRE1a-TRAF2-ASK1 pathway is involved in CSTMP-induced apoptosis and ER stress in human nonsmall cell lung cancer A549 cells, Biomed. Pharmacother. 82 (2016) 281–289.