- Email: [email protected]
[1] CXC chemokine receptor desensitization mediated through ligand-enhanced receptor phosphorylation on serine residues
[ 1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
3
[ I] C - X - C C h e m o k i n e R e c e p t o r D e s e n s i t i z a t i o n M e d i a t e d through Ligand-Enhanced Receptor Phosphorylation on Serine Residues
By A N N
RICHMOND, SUSAN MUELLER, JOHN R . WHITE, a n d WAYNE SCHRAW
Introduction The binding of ligand to most seven-transmembrane (STM) G-proteincoupled receptors leads to changes in the coupling of G proteins to the receptor.l,2 A number of downstream signal transduction pathways become activated, including calcium mobilization, 3'4 phospholipase C, 5 phosphatidylinositol (PI) 3-kinase, 6 mitogen-activated protein (MAP) kinase, 7-1° and serine/threonine and tyrosine kinases. 9,u-15 In addition to these positive signaling events, other kinases are activated that play a role in downregulating the receptor-mediated response to the ligand. 16"iv In particular, the 1 A. Levitzki, Science 241, 800 (1988). 2 S. S. G. Ferguson, L. Menard, L. S. Barak, W. J. Koch, A. M. Colapietro, and M. G. Caron. J. Biol. Chem. 270, 24782 (1995). 3 M. Baggiolini, B. Dewald, and B. Moser, Adv. lmmunol. 55, 97 (1994). 4 T. Geiser, B. Dewald, M. U. Ehrengruber, I. Clark-Lewis, and M. Baggiolini, J. BioL Chem. 268, 15419 (1993). _sM. C. Galas and T. K. Harden, Eur. J. Pharmacol.: Mol. PharmacoL 291, 175 (1995). 6 j. Ding, C. J. Vlahos, R. Liu, R. F. Brown, and J. A. Badwey, J. Biol. Chem. 270,11684 (1995). 7 p. Crespo, T. G. Cachero, N. Z. Xu, and J. S. Gutkind, J. Biol. Chem. 270, 25259 (1995). 8 T. Van Biesen, B. E. Hawes, J. R. Raymond, L. M. Luttrell, W. J. Koch, and R. J. Lefkowitz, J. Biol. Chem. 271, 1266 (1996). 9 S. A. Jones, B. Moser, and M. Thelen, F E B S Lett. 364, 211 (1995). t0 C. Knall, S. Young, J. A. Nick, A. M. Buhl, G, S. Worthen, and G. L. Johnson, J. Biol. Chem. 271, 2832 (1996). i t S. G. Mueller, W. P. Schraw, and A. Richmond, J. BioL Chem. 269, 1973 (1994). 12S. G. Mueller, W. P. Schraw, and A. Richmond, J. Biol. Chem. 270, 10439 (1995). 13 L. M. Luttrell, B. E. Hawes, T. van Biesen, D. K. Luttress, T. J. Lansing, and R. J. Lefkowitz, J. Biol. Chem. 271, 19443 (1996). 14 Q. C. Cheng, J. H. Han, H. G. Thomas, E. Balentien, and A. Richmond, J. Immunol. 148, 451 (1992). ~5Y.-H. Chen, J. Pouyssegur, S. A. Courtneidge, and E. Van Obberghen-Schilling, J. Biol. Chem. 269, 27372 (1994). 16M. Schondorf, F. Bidlingmaier, and A. A. von Rueker, Biochem. Biophys. Res. Commun. 197, 549 (1993). t7 S. Sozzani, M. Molino, M. Locati, W. Luini, C. Cerletti, A. Vecchi, and A. Mantovani, J. lmmunol. 150, 1544 (1993).
METHODS IN ENZYMOLOGY, VOL. 288
Copyright © 1997 by Academic Press All rights of reproduction in any form reserved. 0076-6879/97 $25.00
4
CHEMOKINERECEPTORS
[ 1]
release of free/37 subunits from the tripartite G protein, subsequent to ligand binding, is associated with the activation of a kinase that phosphorylates the receptor, and this event is thought to facilitate sequestration and downregulation of the receptor. 2,t8-23 A number of these G-protein-activated receptor kinases (GRKs) have been characterized and shown to phosphorylate various STM receptors. 24 In general, receptor phosphorylation by GRKs occurs along the carboxyl tail of the receptors. 18,24,25 For some of the STM receptors, both serine and threonine residues become phosphorylated with ligand binding. 26 After the receptor is phosphorylated on certain residues, it loses its ability to respond to a second ligand binding event. This process is known as desensitization. 18'24,25 To determine how the binding of a C-X-C chemokine affects the CXCR2 receptor, we used assays to follow the phosphorylation of CXCR2 in response to ligand binding. After demonstrating that ligand binding to CXCR2 results in the phosphorylation of CXCR2 on serine residues, we developed a series of CXCR2 mutants with serine to alanine substitutions, or truncations at specific serine residues along the carboxyl tail of the receptor, to further characterize the role of individual serine residues in signaling by the CXCR2 receptor. The wild-type CXCR2 cDNA and various receptor mutants are transfected into fibroblast or other cell types that normally do not express C-X-C chemokine receptors. Stable clones of the transfected ceils that express the wild-type or mutant receptors are generated, and receptor phosphorylation, desensitization, and degradation are monitored after ligand activation of the receptor. Comparisons are made between ligand activation of receptor phosphorylation and phorbol ester activation through induction of protein kinase C activity. Receptor desensitization is monitored is j. Pitcher, M. J. Lohse, J. Codina, M. G. Caron, and R. J. Lefkowitz, Biochemistry 31, 3193 (1992). 19 G. Pei, P. Samama, M. Lohse, M. Wang, J. Codina, and R. J. Lefkowitz, Proc. Natl. Acad. Sci. U.S.A. 91, 2699 (1994). 20 R. M. Richardson, H. Ali, E. D. Tomhave, B. Haribabu, and R. Snyderman, J. Biol. Chem. 270, 27829 (1995). 21 V. V. Gurevich, S. B. Dion, J. J. Onorato, J. Ptasienski, C. M. Kim, R. Sterne-Marr, M. M. Hosey, and J. L. Benovic, J. Biol. Chem. 2711, 720 (1995). 22 S. S. G. Ferguson, W. E. Downey III, A.-M. Colapietro, L. S. Barak, L. Menard, and M. G. Caron, Science 271, 363 (1996). 2a M. Oppermann, N. J. Freedman, W. Alexander, and R. J. Lefkowitz, J. Biol. Chem. 271, 13266 (1996). 24 R. J. Lefkowitz, Cell (Cambridge, Mass.) 74, 409 (1993). 25 j. A. Pitcher, J. Inglese, J. B. Higgins, J. L. Arriza, P. J. Casey, C. Kim, J. L. Benovic, M. M. Kwatra, M. G. Caron, and R. J. Lefkowitz, Science 257, 1264 (1992). 26 R. M. Richardson, R. A. DuBose, H. Aft, E. D, Tomhave, D. Haribabu, and R. Synderman, Biochemistry 34, 14193 (1995).
[1]
C - X - C CHEMOKINE RECEPTOR DESENSITIZATION
5
by following the release of intracellular free calcium using Fura-2 following ligand stimulation, or ligand restimulation. For these studies, multiple clones of each mutant are examined, and the ligand binding for each clone is characterized by Scatchard analysis. Methods Generation of Truncated CXCR2 Mutants Polymerase chain reaction (PCR) strategies are employed to generate truncated CXCR2 mutants such that stop codons are introduced at Ser331, Ser-342, or Ser-352. Amplification by PCR is conducted on the cDNA encoding the entire open reading frame for the CXCR2, which has been subcloned into BlueScript (Stratagene, La Jolla, CA). The primer pair for each reaction includes a common primer for the 5' end of the open reading frame. Unique primers that would introduce the desired stop codons are used for the 3' end and are as follows: Ser-331 (331T), gcgaagcttttagatcaagccatgtatagc; Ser-342 (342T), gcgaagcttttaaggcctgctgtctttggg; and Ser-352 (352T), gcgaagcttttaagtgtgccctgaagaaga. These primers also include a HindIII restriction site for future subcloning strategies. The PCR is conducted using 10 ng of the CXCR2/BlueScript plasmid as the template. AmpliTaq (Perkin-Elmer, Norwalk, CT) serves as the polymerase. Typically 30 cycles are completed using an annealing temperature of 48°. The generated PCR fragments are isolated, subcloned into BlueScript, and then sequenced to ensure that the stop codons have been introduced and that the PCR has not generated additional mutations within the fragment. Once the sequences are confirmed, the cDNAs for the truncated receptors are subcloned into the mammalian expression vector pRc/CMV (Invitrogen, San Diego, CA) and subsequently transfected into the cell line of choice, and stable G418-resistant clones are selected. Site-Directed Mutagenesis of CXCR2 Mutagenesis of specific serine to alanine residues is conducted using the pALTER site-directed mutagenesis system (Promega, Madison, WI). The cDNA for the wild-type CXCR2 is subcloned into the pALTER-I plasmid. Single-stranded DNA is isolated for the site-directed mutagenesis. The following mutations are synthesized using the indicated primers: Ser-342-Ala ($342A), agacagcaggccggcctttgttggc; Ser-346-Ala ($346A), tcctttgttggcgcctcttcagggcac; Ser-347-Ala ($347A), ctttgttggctcagcttcagggcaca; Ser-348-Ala ($348A), gttggctcttctgccgggcacacttcc; Ser-346/7/8-Ala (3A), tcctttgttggcgccgctgcagggcacactt. The primers used for the mutagenesis are designed to include novel restriction sites, and thus receptor mutants
6
CHEMOKINERECEPTORS
[ 1]
are initially screened by restriction analysis and subsequently sequenced to ensure that the desired mutation has been incorporated into the cDNA sequence. A Ser-342/6/7/8-Ala mutant is generated by using the Ser-346/ 7/8-Ala mutated sequence as the template and subjecting it to another round of mutagenesis with the Ser-342-Ala primer. Once the mutations are confirmed, the cDNAs encoding the open reading frame for the CXCR2 mutants are subcloned into the pRc/CMV expression vector and transfected into the cell line selected for study; again, stable G418-resistant clones selected.
Generation of Stable Transfectants The transfected cell line [human placental cell line 3ASubE (ATTC, Rockville, MD), human 293 fibroblasts, or Chinese hamster ovarian fibroblasts (CHO cells)] is maintained in 5% fetal bovine serum/Dulbecco's modified Eagle's medium (FBS/DMEM; GIBCO, Grand Island, NY) at 37° with 5% (v/v) CO2. Cells (30-40% confluence) are transfected by the Ca3(PO4)2 precipitation method with 20 k~g of the plasmid construct. Following glycerol shock, stable transfectants are selected in the presence of 400/~g/ml G418. Clonally selected stable transfectants are generated for all receptor mutants. The stable transfectants are analyzed for receptor expression either by Western blot analysis or indirect immunohistochemical staining, then subsequently for [a25I]-MGSA (melanoma growth stimulating activity) binding activity using our standard binding assay. 11Multiple clones are generated for each mutation and analyzed for binding, phosphorylation, and calcium flux.
Radioiodinated Melanoma Growth Stimulating Activity Binding Assay The chemokine MGSA (1/~g) can be iodinated using the chloramine-T method yielding a specific activity of approximately 100/zCi//zg. Alternatively, [125I]-MGSA is available from Dupont-New England Nuclear (Boston, MA) at a specific activity of 272/~Ci//zg. Stable transfectants are plated at a density of 105 cells per well in 24-well plates (Costar, Cambridge, MA). The binding assay is conducted at 4°, 48 hr after the initial plating as previously described. 11The [125I]-MGSA reagent (15,000-30,000 cpm/well) is diluted in binding buffer (0.1% ovalbumin/DMEM), in the absence or presence of unlabeled MGSA (1-256 ng/ml). After 200/zl of diluted [125I]MGSA is added per well, the plates are rocked at 4° for 4 hr. Wells are washed on ice three times with 1.0 ml ice-cold binding buffer. The bound [125I]-MGSA is eluted with two washes of 0.1 N NaOH/I% sodium dodecyl sulfate (SDS) and counted in a gamma counte( (Beckman, Columbia, MD, Gamma 5500). This assay should be repeated in triplicate for each of the representative clones.
[ 1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
7
In Vivo Phosphorylation Assay To characterize the phosphorylation of the CXCR2 receptor in response to ligand binding, the in vivo phosphorylation assay can be performed on cultured cells expressing the transfected wild-type or mutant receptors. 1~ Confluent cell cultures (35-mm plates) are washed twice in 2 ml of serumfree DMEM and incubated in the latter for 40 hr at 37°. The medium is replaced with 2 ml phosphate-free minimal essential medium (MEM; Life Technologies, Gaithersburg, MD), and the cells are incubated for 3 hr more at 37°. After phosphate starvation, cells are incubated in 1 ml phosphatefree MEM containing 250 tzCi/ml ortho[32p]phosphate (9000 Ci/mmol) (Amersham, Arlington Heights, IL) for 3 hr at 37 °. MGSA (5 nM), 12-0tetradecanoylphorbo113-acetate (TPA, 400 nM), or the appropriate vehicle is added directly to the ortho[3Zp]phosphate-containing medium, and cells are incubated for 10 min at 37°. After this incubation, the ortho[3Zp]phos phate-containing medium is removed, plates are put on ice, and 1 ml of Triton X-100 lysis buffer [10 mM Tris, 150 mM NaCI, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 txg/ml aprotinin, 10/~g/ml leupeptin, and 1% (w/v) Triton X-100] is added directly to the plate. Cells are scraped, and the lysate is transferred to a microtube and centrifuged at 15,000 g at 4° in a microfuge for 15 rain. The clarified lysates are transferred to a fresh tube, trichloroacetic acid (TCA)-precipitable counts are determined, and protein concentration is estimated (BCA, Pierce, Rockford, IL). The CXCR2 is typically immunoprecipitated from 5 x 106 TCA-precipitable counts or 10-25 /xg protein/ml buffer. Lysates are incubated with 5/xg of affinity-purified anti-NHz-terminal peptide antibodies specific for the CXCR2, at 4° with rocking for 2 hr, followed by precipitation with 30 /.d of a 1 : 1 dilution of protein A/G agarose (Pierce) for 1 hr at 4 °. The immunoprecipitates are washed four times with 1 ml ice-cold lysis buffer. Washed pellets are denatured in 40 ~1 of 2 x Laemmli sample buffer containing 0.5% SDS and 10% (v/v) 2-mercaptoethanol. Samples are electrophoresed through a 9% SDS-polyacrylamide gel and either dried and analyzed by autoradiography or transblotted onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Richmond, CA) and subjected to autoradiography and Western blot analysis.
Western Blot Analysis The expression and phosphorylation of the CXCR2 receptor or mutant receptors can be followed by Western analysis of whole cell lysates according to our established procedures. 11The PVDF membranes (Bio-Rad) are blocked for 1 hr at room temperature in 5% (w/v) milk powder in
8
CHEMOKINE RECEPTORS
[ 1]
Tris-buffered saline (TBS; 10 mM Tris-HC1, pH 7.5, 150 mM NaC1), then subsequently incubated overnight with the above-mentioned affinity purified anti-NH2-terminal peptide antibodies (2/zg/ml) in 5% milk powder/ TBS. Blots are rinsed with four 5-min washes in TBS, then incubated in the presence of goat anti-rabbit immunoglobulin G (IgG) whole molecule conjugated with alkaline phosphatase (Sigma, St. Louis, MO) at a 1 : 2000 dilution in 5% milk powder/TBS. Blots are washed as described above and developed at pH 9.5 using bromochloroindolyl phosphate (Sigma) and nitro blue tetrazolium (Sigma). 12
Receptor Degradation Studies Confluent cultures (60-mm dishes) of the transfectants are placed in serum-free DMEM and treated with MGSA (50 nM), TPA (400 nM), or the appropriate vehicle control for 2 hr at 37 °. Plates are rinsed on ice with TBS, then scraped in 300/~l of the above-mentioned Triton X-100 lysis buffer. The cell lysates are clarified by centrifugation at 4° for 15 min, the supernatants are transferred to a fresh tube, and protein estimates are performed (BCA, Pierce). Twenty-five micrograms of protein are loaded per lane and electrophoresed through a 9% SDS-polyacrylamide gel, transblotted onto a nitrocellulose membrane, and then analyzed as described above. 11
[35S]Methionine/Cysteine Labeling of 3ASubE P-3 Cells Cells expressing receptor and ceils expressing only the neomycin selection marker are grown to confluence in 35-mm plates. Cells are rinsed twice with phosphate-buffered saline and then incubated with cysteine- and methionine-free MEM (Life Technologies, Gaithersburg, MD) for 1 hr at 37°, after which the culture medium is replaced with cysteine/methioninefree MEM containing 100 t~Ci/ml [35S]cysteine/methionine (Tran35S-label, 1000 Ci/mmol; ICN, Costa Mesa, CA). Cells are labeled for 6 hr at 37°. Cells are rinsed, and fresh medium containing unlabeled cysteine/methionine is added to the cells. Cells are either untreated or treated with MGSA (50 nM) or TPA (400 nM) for 2 hr. Triton X-100 extracts are prepared, and the CXCR2 is immunoprecipitated from an equal number of TCA-precipitable counts (2 × 107 cpm), electrophoresed through a 9% SDS-polyacrylamide gel, dried, and exposed to autoradiographic film.
Calcium Fluorimetry Transfected cells expressing truncation and Ser/Ala mutants are grown until confluent. Cells are released by a short exposure (1-2 min) to Versine (trypsin-EDTA) and washed once in culture medium containing 5% fetal
[1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
9
calf serum (FCS). Cells are then washed a second time in Krebs-Ringer solution (118 mM NaC1, 4.56 mM KCI, 25 mM NaHCO3, 1.03 mM KH2PO4, 11.1 mM glucose, and 5 mM HEPES) minus Ca 2÷ and Mg 2÷. Cells are resuspended at 2 x 106 cells/ml and incubated with Fura-2 for 30 min (2/~M final concentration) at 37 °. After 30 min the volume of buffer is doubled with the Krebs-Ringer (minus Ca 2÷ and Mg 2÷) solution, and the cells are incubated for 10 min at 37°. Cells are then centrifuged (300 g, 6 min) and washed once (50 ml) in Krebs-Ringer solution containing Ca 2÷ and Mg 2÷ (1 mM). The cells are finally adjusted to 1 x 106 cells/ml. Calcium mobilization experiments are performed using a single scanning spectrofluorometer. Data are collected using an IBM Model PS-II computer and analyzed using the software program, Igor, which uses the following equation to determine free Ca2+: Ca 2÷ ( n M ) = 2 2 4 ( F - Fmin)/(Fmax
-
-
F)
where Fmax is the maximum fluorescence (in the presence of 1 mM free Ca 2+) and Fmin is the minimum fluorescence in the presence of EGTA. The constant, 224, is the dissociation (Kd) constant between Fura-2 and Ca 2÷. Generally, cells (2 ml) are allowed to reach 37° for 5 min prior to stimulation with C-X-C chemokine at the indicated concentration. The fluorescence is monitored continually for the specified time. In the crossdesensitization experiments, cells (6 ml total, 1 x 106 cells/ml, 37 °) are stimulated with 20 nM chemokine (stimulated) or buffer (control) for 5 min before being washed three times (15 ml) with Krebs-Ringer buffer plus Ca 2÷ and Mg 2÷. Cells are finally resuspended at (1 × 106 cells/ml) and kept on ice until needed. Cells are allowed to warm to 37° for 5 min before the second stimulus of chemokine (5 nM) as previously described.
Phosphoamino Acid Analysis Phosphoamino acid analysis is performed as described by Boyle et aL2v Briefly, the receptor is immunoprecipitated from ortho[32p]phosphate-la beled 3ASubE P-3 cells, which have been treated with MGSA or vehicle, and the precipitate is electrophoresed through a 7.5% SDS-polyacrylamide gel, transferred to an Immobilon membrane (Millipore, Bedford, MA), and subjected to autoradiography. After autoradiography, the bands corresponding to the CXCR2 are cut from the membrane, incubated in the presence of 6 M HCI for 1 hr at 110°, lyophilized, and then electrophoresed through a cellulose thin-layer plate in two dimensions. The first dimension is in pH 1.9 buffer, and the second dimension is in pH 3.5 buffer. Phosphoserine, phosphothreonine, and phosphotyrosine standards are included in 27W. J. Boyle, P. van der Geer, and T. Hunter, Methods Enzymol. 201, 110 (1991).
10
CHEMOKINE RECEPTORS
[l ]
the loading buffer of the samples. After electrophoresis, the plates are stained with ninhydrin to detect the position of the phosphoamino acid standards and then subjected to autoradiography. GTPT35S Binding Assay
Membranes for the GTpy35S binding assay are prepared using a modified version of a protocol for the isolation of fibroblast membranes. 28 The GTpy35S binding assay is performed as described by Gierschik et aL29 Typically, 2 ~g of crude membranes is used per reaction. The reaction is initiated by the addition of membranes to the reactive mixture, and the reaction is allowed to proceed at 37 ° for 10 min, or as indicated. Nonspecific binding (<15% of total binding) is estimated in the presence of 100 lzM GTP. Reactions are terminated by the addition of 0.9 ml of ice-cold 50 mM Tris-HC1, pH 7.4, 5 mM MgC12, and 1 mM E D T A (wash buffer) to each tube. The contents are transferred to a vacuum-filtration apparatus containing a 0.45-/zm Gelman (Ann Arbor, MI) A/E fiberglass filter. After filtration, the filter is washed three times with 3 ml of ice-cold wash buffer and dried. The amount of GTPy35S bound is determined by scintillation counting (Beckman, LS 3801). Chemotaxis
Although the 3ASubE placental cells are quite efficient for monitoring signal transduction in response to MGSA binding to the CXCR2, these cells do not readily undergo chemotaxis in response to gradients of chemokines. Therefore, we have transfected the wild-type and mutant receptors into the human 293 fibroblast cell line, selected stable polyclonal cell lines expressing this receptor, confirmed that the polyclonal lines specifically bind the MGSA/growth regulated protein (GRO) ligand, and subsequently monitored chemotaxis. For 293 fibroblasts expressing the CXCR2, the protocols of Ben-Baruch et aL 3° c a n be used, with modification. The 96-well chemotaxis chamber (Neuroprobe, Cabin John, MD) is used, and the lower compartment of the chamber is loaded with 360-tzl aliquots of 1 mg/ml ovalbumin in DMEM or M G S A / G R O diluted in ovalbumin/DMEM (chemotaxis buffer). The polycarbonate membrane is the 10/~m pore size that has been coated on both sides with 20 tzg/ml human collagen type IV for 2 hr at 37 ° and stored overnight at 4°. The cells are removed by trypsiniza28 p. H. Howe and E. B. Leof, Biochem. J. 261, 879 (1989). 29 p. Gierschik, R. Moghtader, C. Straub, K. Dieterich, and K. H. Jacobs, Eur. J. Biochem. 197, 725 (1991). 30 A. Ben-Baruch, L. L. Xu, P. R. Young, K. Bengali, J. J. Oppenheim, and J. M. Wang, J. Biol. Chem. 270, 22123 (1995).
[ 1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
11
tion, incubated in 10% FBS in D M E M 1.5 hr at 37° to allow restoration of receptor, washed in chemotaxis buffer, and then placed into the upper chamber in the ovalbumin medium. The chambers are incubated for 4.5-6 hr at 37° in humidifed air with 5% (v/v) CO2, after which the filter is removed, washed, fixed, and stained with a Diff-Quick kit. Quantitation of relative chemotactic index of cells on the lower filter surface was by densitometric scanning of the stained filter using an Epson ES 1200C scanner (Seiko Epson Corp., Torrance, CA) and Adobe Photoshop software (Adobe Systems Inc., San Jose, CA). Digitized images are subsequently quantitated using the Phosphorlmager (Molecular Dynamics, Sunnyvale, CA). Volumes are integrated and normalized to a value of 1. Receptor Sequestration
Receptor sequestration in cells expressing wild-type or mutant receptors can be monitored using a modification of the protocols described by Chuntharapai and Kim. 31 Briefly, confluent 24-well plate cultures of each cell type are pretreated with M G S A / G R O (100 nM) for varying times (10 min to 2 hr) at 4 ° or at 37°. After the initial incubation, the cultures are washed three times with binding buffer (1 mg/ml ovalbumin in DMEM) at 4 °. The presence of the receptor on the cell surface is monitored by indirect immunodetection. After first blocking nonspecific antibody binding sites with a solution of goat anti-mouse IgG (1-5/~g/ml), the cells are incubated with 2/zg of rabbit anti-amino-terminal CXCR2 receptor antibodies (415) per well of cells, u washed three times with ovalbumin/DMEM, and then incubated for 30-60 min at 4 ° with 2 × 105 cpm of goat anti-rabbit 12sIlabeled antibody (ICN, 300/zCi/ml). Nonspecific binding of antibodies is monitored using the rabbit antibody to the carboxyl tail of the CXCR2 followed by goat anti-rabbit a25I-labeled antibody. Alternatively, nonspecific binding can be determined by blocking the binding of the N-terminal antipeptide antibody to CXCR2 with peptides to which the antibody was raised. The nonspecific binding is washed away with three 5-min washes of binding buffer, cells are lysed in SDS/NaOH (1%/0.1 N), and radioactivity is determined by gamma counting. Comments A number of methods have been used to examine phosphorylation sites on receptors: mass spectrophotometric analysis of the in vivo phosphorylated receptors, direct in vitro phosphorylation assays using purified receptor, and analysis of loss of ligand-induced receptor phosphorylation in vivo using cell lines expressing receptor mutants where nonphosphorylatable 31A. Chuntharapai and K. J. Kim, J. lmmunol. 15, 2587 (1995).
12
CHEMOKINE RECEPTORS
[ 11
Full length CXCR2
Serine-342 truncation mutation L r
¥
v
F P
L T
S $
¥
S
r
Y N S
D g G K U r
v
D
r
s
$
g
D II
S
D A L
(R)
ta)
(
Fzo. 1. Diagram showing the placement of the truncation and Ser/Ala mutations in the CXCR2. The serine residues in the carboxyl tail of the receptor that were mutated to alanine are indicated by blackened circles.
[1]
C - X - C CHEMOKINE RECEPTOR DESENSITIZATION
13
Serine-352 truncation mutation L F P P L T
$ S ¥ $ ¥ ~
S L D g G
N F D g F
S D
g
N Serine-331 truncation mutation
n N n____ FIG. 1.
(continued)
14
CHEMOKINERECEPTORS
[ll
amino acids replace the serine, threonine, or tyrosine residues believed to be involved in the phosphorylation event. This third approach is the one we have used here to characterize the ligand-induced receptor phosphorylation of the CXCR2 chemokine receptor. This approach has the advantage of allowing examination of biological consequences of loss of the phosphorylation event, particularly relating to effects on downstream signaling events. Although selection and characterization of stable clones expressing these mutant receptors are somewhat tedious, once selected and characterized, the clones are quite useful to study alterations in calcium flux, receptor sequestration, and receptor degradation. Furthermore, affinity for ligand can be accessed and compared to wild-type receptors with regard to the role of these phosphorylation events in regulation. Care must be taken to verify that differences in response are observed in multiple clones of each mutant, and that the mutation in the receptor does not alter the affinity of the receptor for the ligand. It is also important to determine the number of receptors expressed per mutant clone as compared to wild type to avoid attributing gain or loss of function to an artifact resulting from differential expression of receptor at the cell membrane. This is particularly important for STM receptors, where often only 1 or 2 of every 50 clones selected will actually express the receptor at the cell surface. Screening of selected clones by Western blot will often show receptor expression in the other 48 clones, but ligand binding studies will be negative. Using the methods outlined above, we have determined that phosphorylation of serine residues between 342 and 352 is crucial for ligand-mediated desensitization of the CXCR2 (see Fig. 1). In contrast to the findings with CXCR1 expression in basophilic leukemia cells, where both serine and threonine phosphorylation events were believed to be involved in receptor desensitization, only serine residues of CXCR2 appear to be phosphorylated in 3ASubE placental cells. However, these apparent differences may be cell type specific and not receptor specific. This brings up an important point with regard to selection of the cell type for expression of mutant and wild-type receptors. If the phosphorylation of receptor is believed to affect intracellular signaling events such as calcium flux, it is important to select a cell type that has low endogenous intracellular free calcium, which can be readily increased in response to signals that stimulate release of calcium from intracellular stores. If the end point of phosphorylation is believed to affect cell motility or chemotaxis, then the transfected cell should be one that can show chemotaxis toward the ligand. To this end, we found that although the release of intracellular free calcium could be readily followed in 3ASubE clones, these cells were not readily adaptable to the chemotaxis assay, and for those studies additional stable clones of mutant and wild-type receptor were selected in human 293 kidney fibroblasts. When
[2]
MONOCLONAL ANTIBODIES TO CHEMOKINE RECEPTORS
15
the 342T mutant exhibiting truncation at Ser-342 in the carboxyl tail was expressed in 293 cells, the cells continue to exhibit chemotaxis toward an MGSA gradient, though this mutant exhibits little desensitization after ligand binding. Moreover, this mutant receptor is poorly sequestered following ligand stimulation.32 These data suggest that desensitization is not a required event for chemotaxis. Ben-Baruch et al. have shown that carboxyl tail truncation mutants retain the ability to undergo chemotaxis if as few as eight amino acids remain in the carboxyl tail. 3° Since this would eliminate the serine residues believed to be involved in ligand-induced receptor phosphorylation, the data from our laboratory in combination with their data demonstrate that receptor phosphorylation and desensitization are not directly involved in chemotaxis. We cannot rule out the possibility that there may be long-term effects of failure to desensitize that could ultimately affect chemotaxis. Acknowledgments This work was sponsored by the an Associate Career Scientist A w a r d from the D e p a r t m e n t of Veterans Affairs (A. R.), a grant from the National Cancer Institute (CA34590), the Medical Research Council of C a n a d a (S. M.), and the Skin Disease Center G r a n t (AR41943). 32 S. G. Mueller, J. R. White, W. P. Schraw, V. Lam, and A. Richmond, J. Biol. Chem. 272, 8207 (1997).
[2] Generation of Monoclonal Antibodies to C h e m o k i n e Receptors By
A N A N C H U N T H A R A P A I a n d K . JIN K I M
Introduction A family of chemokines has been identified that contains more than 20 chemokines with the ability to attract and activate leukocytes and play important roles as mediators of inflammation.1'2 These chemokines can be divided into three subfamilies according to the position of the first two cysteines (C-X-C, C-C, and C chemokines). These chemokines often exhibit pleiotropic effects and bind to more than one receptor. Therefore, monoclonal antibodies (MAbs) that are specific to each receptor and/or that J. J. O p p e n h e i m , C. O. Zachariae, N. Mukaida, and K. Matsushima, Annu. Rev. ImmunoL 9, 617 (1991). 2 M. Baggiolini, B. Dewald, and B. Moser, Adv. Immunol. 55, 97 (1994).
METHODS IN ENZYMOLOGY, VOL. 288
Copyright © 1997by AcademicPress All rights of reproduction in any form reserved. {X~76-6879/97$25.00
C-X-C CHEMOKINERECEPTORDESENSITIZATION
3
[ I] C - X - C C h e m o k i n e R e c e p t o r D e s e n s i t i z a t i o n M e d i a t e d through Ligand-Enhanced Receptor Phosphorylation on Serine Residues
By A N N
RICHMOND, SUSAN MUELLER, JOHN R . WHITE, a n d WAYNE SCHRAW
Introduction The binding of ligand to most seven-transmembrane (STM) G-proteincoupled receptors leads to changes in the coupling of G proteins to the receptor.l,2 A number of downstream signal transduction pathways become activated, including calcium mobilization, 3'4 phospholipase C, 5 phosphatidylinositol (PI) 3-kinase, 6 mitogen-activated protein (MAP) kinase, 7-1° and serine/threonine and tyrosine kinases. 9,u-15 In addition to these positive signaling events, other kinases are activated that play a role in downregulating the receptor-mediated response to the ligand. 16"iv In particular, the 1 A. Levitzki, Science 241, 800 (1988). 2 S. S. G. Ferguson, L. Menard, L. S. Barak, W. J. Koch, A. M. Colapietro, and M. G. Caron. J. Biol. Chem. 270, 24782 (1995). 3 M. Baggiolini, B. Dewald, and B. Moser, Adv. lmmunol. 55, 97 (1994). 4 T. Geiser, B. Dewald, M. U. Ehrengruber, I. Clark-Lewis, and M. Baggiolini, J. BioL Chem. 268, 15419 (1993). _sM. C. Galas and T. K. Harden, Eur. J. Pharmacol.: Mol. PharmacoL 291, 175 (1995). 6 j. Ding, C. J. Vlahos, R. Liu, R. F. Brown, and J. A. Badwey, J. Biol. Chem. 270,11684 (1995). 7 p. Crespo, T. G. Cachero, N. Z. Xu, and J. S. Gutkind, J. Biol. Chem. 270, 25259 (1995). 8 T. Van Biesen, B. E. Hawes, J. R. Raymond, L. M. Luttrell, W. J. Koch, and R. J. Lefkowitz, J. Biol. Chem. 271, 1266 (1996). 9 S. A. Jones, B. Moser, and M. Thelen, F E B S Lett. 364, 211 (1995). t0 C. Knall, S. Young, J. A. Nick, A. M. Buhl, G, S. Worthen, and G. L. Johnson, J. Biol. Chem. 271, 2832 (1996). i t S. G. Mueller, W. P. Schraw, and A. Richmond, J. BioL Chem. 269, 1973 (1994). 12S. G. Mueller, W. P. Schraw, and A. Richmond, J. Biol. Chem. 270, 10439 (1995). 13 L. M. Luttrell, B. E. Hawes, T. van Biesen, D. K. Luttress, T. J. Lansing, and R. J. Lefkowitz, J. Biol. Chem. 271, 19443 (1996). 14 Q. C. Cheng, J. H. Han, H. G. Thomas, E. Balentien, and A. Richmond, J. Immunol. 148, 451 (1992). ~5Y.-H. Chen, J. Pouyssegur, S. A. Courtneidge, and E. Van Obberghen-Schilling, J. Biol. Chem. 269, 27372 (1994). 16M. Schondorf, F. Bidlingmaier, and A. A. von Rueker, Biochem. Biophys. Res. Commun. 197, 549 (1993). t7 S. Sozzani, M. Molino, M. Locati, W. Luini, C. Cerletti, A. Vecchi, and A. Mantovani, J. lmmunol. 150, 1544 (1993).
METHODS IN ENZYMOLOGY, VOL. 288
Copyright © 1997 by Academic Press All rights of reproduction in any form reserved. 0076-6879/97 $25.00
4
CHEMOKINERECEPTORS
[ 1]
release of free/37 subunits from the tripartite G protein, subsequent to ligand binding, is associated with the activation of a kinase that phosphorylates the receptor, and this event is thought to facilitate sequestration and downregulation of the receptor. 2,t8-23 A number of these G-protein-activated receptor kinases (GRKs) have been characterized and shown to phosphorylate various STM receptors. 24 In general, receptor phosphorylation by GRKs occurs along the carboxyl tail of the receptors. 18,24,25 For some of the STM receptors, both serine and threonine residues become phosphorylated with ligand binding. 26 After the receptor is phosphorylated on certain residues, it loses its ability to respond to a second ligand binding event. This process is known as desensitization. 18'24,25 To determine how the binding of a C-X-C chemokine affects the CXCR2 receptor, we used assays to follow the phosphorylation of CXCR2 in response to ligand binding. After demonstrating that ligand binding to CXCR2 results in the phosphorylation of CXCR2 on serine residues, we developed a series of CXCR2 mutants with serine to alanine substitutions, or truncations at specific serine residues along the carboxyl tail of the receptor, to further characterize the role of individual serine residues in signaling by the CXCR2 receptor. The wild-type CXCR2 cDNA and various receptor mutants are transfected into fibroblast or other cell types that normally do not express C-X-C chemokine receptors. Stable clones of the transfected ceils that express the wild-type or mutant receptors are generated, and receptor phosphorylation, desensitization, and degradation are monitored after ligand activation of the receptor. Comparisons are made between ligand activation of receptor phosphorylation and phorbol ester activation through induction of protein kinase C activity. Receptor desensitization is monitored is j. Pitcher, M. J. Lohse, J. Codina, M. G. Caron, and R. J. Lefkowitz, Biochemistry 31, 3193 (1992). 19 G. Pei, P. Samama, M. Lohse, M. Wang, J. Codina, and R. J. Lefkowitz, Proc. Natl. Acad. Sci. U.S.A. 91, 2699 (1994). 20 R. M. Richardson, H. Ali, E. D. Tomhave, B. Haribabu, and R. Snyderman, J. Biol. Chem. 270, 27829 (1995). 21 V. V. Gurevich, S. B. Dion, J. J. Onorato, J. Ptasienski, C. M. Kim, R. Sterne-Marr, M. M. Hosey, and J. L. Benovic, J. Biol. Chem. 2711, 720 (1995). 22 S. S. G. Ferguson, W. E. Downey III, A.-M. Colapietro, L. S. Barak, L. Menard, and M. G. Caron, Science 271, 363 (1996). 2a M. Oppermann, N. J. Freedman, W. Alexander, and R. J. Lefkowitz, J. Biol. Chem. 271, 13266 (1996). 24 R. J. Lefkowitz, Cell (Cambridge, Mass.) 74, 409 (1993). 25 j. A. Pitcher, J. Inglese, J. B. Higgins, J. L. Arriza, P. J. Casey, C. Kim, J. L. Benovic, M. M. Kwatra, M. G. Caron, and R. J. Lefkowitz, Science 257, 1264 (1992). 26 R. M. Richardson, R. A. DuBose, H. Aft, E. D, Tomhave, D. Haribabu, and R. Synderman, Biochemistry 34, 14193 (1995).
[1]
C - X - C CHEMOKINE RECEPTOR DESENSITIZATION
5
by following the release of intracellular free calcium using Fura-2 following ligand stimulation, or ligand restimulation. For these studies, multiple clones of each mutant are examined, and the ligand binding for each clone is characterized by Scatchard analysis. Methods Generation of Truncated CXCR2 Mutants Polymerase chain reaction (PCR) strategies are employed to generate truncated CXCR2 mutants such that stop codons are introduced at Ser331, Ser-342, or Ser-352. Amplification by PCR is conducted on the cDNA encoding the entire open reading frame for the CXCR2, which has been subcloned into BlueScript (Stratagene, La Jolla, CA). The primer pair for each reaction includes a common primer for the 5' end of the open reading frame. Unique primers that would introduce the desired stop codons are used for the 3' end and are as follows: Ser-331 (331T), gcgaagcttttagatcaagccatgtatagc; Ser-342 (342T), gcgaagcttttaaggcctgctgtctttggg; and Ser-352 (352T), gcgaagcttttaagtgtgccctgaagaaga. These primers also include a HindIII restriction site for future subcloning strategies. The PCR is conducted using 10 ng of the CXCR2/BlueScript plasmid as the template. AmpliTaq (Perkin-Elmer, Norwalk, CT) serves as the polymerase. Typically 30 cycles are completed using an annealing temperature of 48°. The generated PCR fragments are isolated, subcloned into BlueScript, and then sequenced to ensure that the stop codons have been introduced and that the PCR has not generated additional mutations within the fragment. Once the sequences are confirmed, the cDNAs for the truncated receptors are subcloned into the mammalian expression vector pRc/CMV (Invitrogen, San Diego, CA) and subsequently transfected into the cell line of choice, and stable G418-resistant clones are selected. Site-Directed Mutagenesis of CXCR2 Mutagenesis of specific serine to alanine residues is conducted using the pALTER site-directed mutagenesis system (Promega, Madison, WI). The cDNA for the wild-type CXCR2 is subcloned into the pALTER-I plasmid. Single-stranded DNA is isolated for the site-directed mutagenesis. The following mutations are synthesized using the indicated primers: Ser-342-Ala ($342A), agacagcaggccggcctttgttggc; Ser-346-Ala ($346A), tcctttgttggcgcctcttcagggcac; Ser-347-Ala ($347A), ctttgttggctcagcttcagggcaca; Ser-348-Ala ($348A), gttggctcttctgccgggcacacttcc; Ser-346/7/8-Ala (3A), tcctttgttggcgccgctgcagggcacactt. The primers used for the mutagenesis are designed to include novel restriction sites, and thus receptor mutants
6
CHEMOKINERECEPTORS
[ 1]
are initially screened by restriction analysis and subsequently sequenced to ensure that the desired mutation has been incorporated into the cDNA sequence. A Ser-342/6/7/8-Ala mutant is generated by using the Ser-346/ 7/8-Ala mutated sequence as the template and subjecting it to another round of mutagenesis with the Ser-342-Ala primer. Once the mutations are confirmed, the cDNAs encoding the open reading frame for the CXCR2 mutants are subcloned into the pRc/CMV expression vector and transfected into the cell line selected for study; again, stable G418-resistant clones selected.
Generation of Stable Transfectants The transfected cell line [human placental cell line 3ASubE (ATTC, Rockville, MD), human 293 fibroblasts, or Chinese hamster ovarian fibroblasts (CHO cells)] is maintained in 5% fetal bovine serum/Dulbecco's modified Eagle's medium (FBS/DMEM; GIBCO, Grand Island, NY) at 37° with 5% (v/v) CO2. Cells (30-40% confluence) are transfected by the Ca3(PO4)2 precipitation method with 20 k~g of the plasmid construct. Following glycerol shock, stable transfectants are selected in the presence of 400/~g/ml G418. Clonally selected stable transfectants are generated for all receptor mutants. The stable transfectants are analyzed for receptor expression either by Western blot analysis or indirect immunohistochemical staining, then subsequently for [a25I]-MGSA (melanoma growth stimulating activity) binding activity using our standard binding assay. 11Multiple clones are generated for each mutation and analyzed for binding, phosphorylation, and calcium flux.
Radioiodinated Melanoma Growth Stimulating Activity Binding Assay The chemokine MGSA (1/~g) can be iodinated using the chloramine-T method yielding a specific activity of approximately 100/zCi//zg. Alternatively, [125I]-MGSA is available from Dupont-New England Nuclear (Boston, MA) at a specific activity of 272/~Ci//zg. Stable transfectants are plated at a density of 105 cells per well in 24-well plates (Costar, Cambridge, MA). The binding assay is conducted at 4°, 48 hr after the initial plating as previously described. 11The [125I]-MGSA reagent (15,000-30,000 cpm/well) is diluted in binding buffer (0.1% ovalbumin/DMEM), in the absence or presence of unlabeled MGSA (1-256 ng/ml). After 200/zl of diluted [125I]MGSA is added per well, the plates are rocked at 4° for 4 hr. Wells are washed on ice three times with 1.0 ml ice-cold binding buffer. The bound [125I]-MGSA is eluted with two washes of 0.1 N NaOH/I% sodium dodecyl sulfate (SDS) and counted in a gamma counte( (Beckman, Columbia, MD, Gamma 5500). This assay should be repeated in triplicate for each of the representative clones.
[ 1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
7
In Vivo Phosphorylation Assay To characterize the phosphorylation of the CXCR2 receptor in response to ligand binding, the in vivo phosphorylation assay can be performed on cultured cells expressing the transfected wild-type or mutant receptors. 1~ Confluent cell cultures (35-mm plates) are washed twice in 2 ml of serumfree DMEM and incubated in the latter for 40 hr at 37°. The medium is replaced with 2 ml phosphate-free minimal essential medium (MEM; Life Technologies, Gaithersburg, MD), and the cells are incubated for 3 hr more at 37°. After phosphate starvation, cells are incubated in 1 ml phosphatefree MEM containing 250 tzCi/ml ortho[32p]phosphate (9000 Ci/mmol) (Amersham, Arlington Heights, IL) for 3 hr at 37 °. MGSA (5 nM), 12-0tetradecanoylphorbo113-acetate (TPA, 400 nM), or the appropriate vehicle is added directly to the ortho[3Zp]phosphate-containing medium, and cells are incubated for 10 min at 37°. After this incubation, the ortho[3Zp]phos phate-containing medium is removed, plates are put on ice, and 1 ml of Triton X-100 lysis buffer [10 mM Tris, 150 mM NaCI, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 txg/ml aprotinin, 10/~g/ml leupeptin, and 1% (w/v) Triton X-100] is added directly to the plate. Cells are scraped, and the lysate is transferred to a microtube and centrifuged at 15,000 g at 4° in a microfuge for 15 rain. The clarified lysates are transferred to a fresh tube, trichloroacetic acid (TCA)-precipitable counts are determined, and protein concentration is estimated (BCA, Pierce, Rockford, IL). The CXCR2 is typically immunoprecipitated from 5 x 106 TCA-precipitable counts or 10-25 /xg protein/ml buffer. Lysates are incubated with 5/xg of affinity-purified anti-NHz-terminal peptide antibodies specific for the CXCR2, at 4° with rocking for 2 hr, followed by precipitation with 30 /.d of a 1 : 1 dilution of protein A/G agarose (Pierce) for 1 hr at 4 °. The immunoprecipitates are washed four times with 1 ml ice-cold lysis buffer. Washed pellets are denatured in 40 ~1 of 2 x Laemmli sample buffer containing 0.5% SDS and 10% (v/v) 2-mercaptoethanol. Samples are electrophoresed through a 9% SDS-polyacrylamide gel and either dried and analyzed by autoradiography or transblotted onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Richmond, CA) and subjected to autoradiography and Western blot analysis.
Western Blot Analysis The expression and phosphorylation of the CXCR2 receptor or mutant receptors can be followed by Western analysis of whole cell lysates according to our established procedures. 11The PVDF membranes (Bio-Rad) are blocked for 1 hr at room temperature in 5% (w/v) milk powder in
8
CHEMOKINE RECEPTORS
[ 1]
Tris-buffered saline (TBS; 10 mM Tris-HC1, pH 7.5, 150 mM NaC1), then subsequently incubated overnight with the above-mentioned affinity purified anti-NH2-terminal peptide antibodies (2/zg/ml) in 5% milk powder/ TBS. Blots are rinsed with four 5-min washes in TBS, then incubated in the presence of goat anti-rabbit immunoglobulin G (IgG) whole molecule conjugated with alkaline phosphatase (Sigma, St. Louis, MO) at a 1 : 2000 dilution in 5% milk powder/TBS. Blots are washed as described above and developed at pH 9.5 using bromochloroindolyl phosphate (Sigma) and nitro blue tetrazolium (Sigma). 12
Receptor Degradation Studies Confluent cultures (60-mm dishes) of the transfectants are placed in serum-free DMEM and treated with MGSA (50 nM), TPA (400 nM), or the appropriate vehicle control for 2 hr at 37 °. Plates are rinsed on ice with TBS, then scraped in 300/~l of the above-mentioned Triton X-100 lysis buffer. The cell lysates are clarified by centrifugation at 4° for 15 min, the supernatants are transferred to a fresh tube, and protein estimates are performed (BCA, Pierce). Twenty-five micrograms of protein are loaded per lane and electrophoresed through a 9% SDS-polyacrylamide gel, transblotted onto a nitrocellulose membrane, and then analyzed as described above. 11
[35S]Methionine/Cysteine Labeling of 3ASubE P-3 Cells Cells expressing receptor and ceils expressing only the neomycin selection marker are grown to confluence in 35-mm plates. Cells are rinsed twice with phosphate-buffered saline and then incubated with cysteine- and methionine-free MEM (Life Technologies, Gaithersburg, MD) for 1 hr at 37°, after which the culture medium is replaced with cysteine/methioninefree MEM containing 100 t~Ci/ml [35S]cysteine/methionine (Tran35S-label, 1000 Ci/mmol; ICN, Costa Mesa, CA). Cells are labeled for 6 hr at 37°. Cells are rinsed, and fresh medium containing unlabeled cysteine/methionine is added to the cells. Cells are either untreated or treated with MGSA (50 nM) or TPA (400 nM) for 2 hr. Triton X-100 extracts are prepared, and the CXCR2 is immunoprecipitated from an equal number of TCA-precipitable counts (2 × 107 cpm), electrophoresed through a 9% SDS-polyacrylamide gel, dried, and exposed to autoradiographic film.
Calcium Fluorimetry Transfected cells expressing truncation and Ser/Ala mutants are grown until confluent. Cells are released by a short exposure (1-2 min) to Versine (trypsin-EDTA) and washed once in culture medium containing 5% fetal
[1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
9
calf serum (FCS). Cells are then washed a second time in Krebs-Ringer solution (118 mM NaC1, 4.56 mM KCI, 25 mM NaHCO3, 1.03 mM KH2PO4, 11.1 mM glucose, and 5 mM HEPES) minus Ca 2÷ and Mg 2÷. Cells are resuspended at 2 x 106 cells/ml and incubated with Fura-2 for 30 min (2/~M final concentration) at 37 °. After 30 min the volume of buffer is doubled with the Krebs-Ringer (minus Ca 2÷ and Mg 2÷) solution, and the cells are incubated for 10 min at 37°. Cells are then centrifuged (300 g, 6 min) and washed once (50 ml) in Krebs-Ringer solution containing Ca 2÷ and Mg 2÷ (1 mM). The cells are finally adjusted to 1 x 106 cells/ml. Calcium mobilization experiments are performed using a single scanning spectrofluorometer. Data are collected using an IBM Model PS-II computer and analyzed using the software program, Igor, which uses the following equation to determine free Ca2+: Ca 2÷ ( n M ) = 2 2 4 ( F - Fmin)/(Fmax
-
-
F)
where Fmax is the maximum fluorescence (in the presence of 1 mM free Ca 2+) and Fmin is the minimum fluorescence in the presence of EGTA. The constant, 224, is the dissociation (Kd) constant between Fura-2 and Ca 2÷. Generally, cells (2 ml) are allowed to reach 37° for 5 min prior to stimulation with C-X-C chemokine at the indicated concentration. The fluorescence is monitored continually for the specified time. In the crossdesensitization experiments, cells (6 ml total, 1 x 106 cells/ml, 37 °) are stimulated with 20 nM chemokine (stimulated) or buffer (control) for 5 min before being washed three times (15 ml) with Krebs-Ringer buffer plus Ca 2÷ and Mg 2÷. Cells are finally resuspended at (1 × 106 cells/ml) and kept on ice until needed. Cells are allowed to warm to 37° for 5 min before the second stimulus of chemokine (5 nM) as previously described.
Phosphoamino Acid Analysis Phosphoamino acid analysis is performed as described by Boyle et aL2v Briefly, the receptor is immunoprecipitated from ortho[32p]phosphate-la beled 3ASubE P-3 cells, which have been treated with MGSA or vehicle, and the precipitate is electrophoresed through a 7.5% SDS-polyacrylamide gel, transferred to an Immobilon membrane (Millipore, Bedford, MA), and subjected to autoradiography. After autoradiography, the bands corresponding to the CXCR2 are cut from the membrane, incubated in the presence of 6 M HCI for 1 hr at 110°, lyophilized, and then electrophoresed through a cellulose thin-layer plate in two dimensions. The first dimension is in pH 1.9 buffer, and the second dimension is in pH 3.5 buffer. Phosphoserine, phosphothreonine, and phosphotyrosine standards are included in 27W. J. Boyle, P. van der Geer, and T. Hunter, Methods Enzymol. 201, 110 (1991).
10
CHEMOKINE RECEPTORS
[l ]
the loading buffer of the samples. After electrophoresis, the plates are stained with ninhydrin to detect the position of the phosphoamino acid standards and then subjected to autoradiography. GTPT35S Binding Assay
Membranes for the GTpy35S binding assay are prepared using a modified version of a protocol for the isolation of fibroblast membranes. 28 The GTpy35S binding assay is performed as described by Gierschik et aL29 Typically, 2 ~g of crude membranes is used per reaction. The reaction is initiated by the addition of membranes to the reactive mixture, and the reaction is allowed to proceed at 37 ° for 10 min, or as indicated. Nonspecific binding (<15% of total binding) is estimated in the presence of 100 lzM GTP. Reactions are terminated by the addition of 0.9 ml of ice-cold 50 mM Tris-HC1, pH 7.4, 5 mM MgC12, and 1 mM E D T A (wash buffer) to each tube. The contents are transferred to a vacuum-filtration apparatus containing a 0.45-/zm Gelman (Ann Arbor, MI) A/E fiberglass filter. After filtration, the filter is washed three times with 3 ml of ice-cold wash buffer and dried. The amount of GTPy35S bound is determined by scintillation counting (Beckman, LS 3801). Chemotaxis
Although the 3ASubE placental cells are quite efficient for monitoring signal transduction in response to MGSA binding to the CXCR2, these cells do not readily undergo chemotaxis in response to gradients of chemokines. Therefore, we have transfected the wild-type and mutant receptors into the human 293 fibroblast cell line, selected stable polyclonal cell lines expressing this receptor, confirmed that the polyclonal lines specifically bind the MGSA/growth regulated protein (GRO) ligand, and subsequently monitored chemotaxis. For 293 fibroblasts expressing the CXCR2, the protocols of Ben-Baruch et aL 3° c a n be used, with modification. The 96-well chemotaxis chamber (Neuroprobe, Cabin John, MD) is used, and the lower compartment of the chamber is loaded with 360-tzl aliquots of 1 mg/ml ovalbumin in DMEM or M G S A / G R O diluted in ovalbumin/DMEM (chemotaxis buffer). The polycarbonate membrane is the 10/~m pore size that has been coated on both sides with 20 tzg/ml human collagen type IV for 2 hr at 37 ° and stored overnight at 4°. The cells are removed by trypsiniza28 p. H. Howe and E. B. Leof, Biochem. J. 261, 879 (1989). 29 p. Gierschik, R. Moghtader, C. Straub, K. Dieterich, and K. H. Jacobs, Eur. J. Biochem. 197, 725 (1991). 30 A. Ben-Baruch, L. L. Xu, P. R. Young, K. Bengali, J. J. Oppenheim, and J. M. Wang, J. Biol. Chem. 270, 22123 (1995).
[ 1]
C-X-C CHEMOKINERECEPTORDESENSITIZATION
11
tion, incubated in 10% FBS in D M E M 1.5 hr at 37° to allow restoration of receptor, washed in chemotaxis buffer, and then placed into the upper chamber in the ovalbumin medium. The chambers are incubated for 4.5-6 hr at 37° in humidifed air with 5% (v/v) CO2, after which the filter is removed, washed, fixed, and stained with a Diff-Quick kit. Quantitation of relative chemotactic index of cells on the lower filter surface was by densitometric scanning of the stained filter using an Epson ES 1200C scanner (Seiko Epson Corp., Torrance, CA) and Adobe Photoshop software (Adobe Systems Inc., San Jose, CA). Digitized images are subsequently quantitated using the Phosphorlmager (Molecular Dynamics, Sunnyvale, CA). Volumes are integrated and normalized to a value of 1. Receptor Sequestration
Receptor sequestration in cells expressing wild-type or mutant receptors can be monitored using a modification of the protocols described by Chuntharapai and Kim. 31 Briefly, confluent 24-well plate cultures of each cell type are pretreated with M G S A / G R O (100 nM) for varying times (10 min to 2 hr) at 4 ° or at 37°. After the initial incubation, the cultures are washed three times with binding buffer (1 mg/ml ovalbumin in DMEM) at 4 °. The presence of the receptor on the cell surface is monitored by indirect immunodetection. After first blocking nonspecific antibody binding sites with a solution of goat anti-mouse IgG (1-5/~g/ml), the cells are incubated with 2/zg of rabbit anti-amino-terminal CXCR2 receptor antibodies (415) per well of cells, u washed three times with ovalbumin/DMEM, and then incubated for 30-60 min at 4 ° with 2 × 105 cpm of goat anti-rabbit 12sIlabeled antibody (ICN, 300/zCi/ml). Nonspecific binding of antibodies is monitored using the rabbit antibody to the carboxyl tail of the CXCR2 followed by goat anti-rabbit a25I-labeled antibody. Alternatively, nonspecific binding can be determined by blocking the binding of the N-terminal antipeptide antibody to CXCR2 with peptides to which the antibody was raised. The nonspecific binding is washed away with three 5-min washes of binding buffer, cells are lysed in SDS/NaOH (1%/0.1 N), and radioactivity is determined by gamma counting. Comments A number of methods have been used to examine phosphorylation sites on receptors: mass spectrophotometric analysis of the in vivo phosphorylated receptors, direct in vitro phosphorylation assays using purified receptor, and analysis of loss of ligand-induced receptor phosphorylation in vivo using cell lines expressing receptor mutants where nonphosphorylatable 31A. Chuntharapai and K. J. Kim, J. lmmunol. 15, 2587 (1995).
12
CHEMOKINE RECEPTORS
[ 11
Full length CXCR2
Serine-342 truncation mutation L r
¥
v
F P
L T
S $
¥
S
r
Y N S
D g G K U r
v
D
r
s
$
g
D II
S
D A L
(R)
ta)
(
Fzo. 1. Diagram showing the placement of the truncation and Ser/Ala mutations in the CXCR2. The serine residues in the carboxyl tail of the receptor that were mutated to alanine are indicated by blackened circles.
[1]
C - X - C CHEMOKINE RECEPTOR DESENSITIZATION
13
Serine-352 truncation mutation L F P P L T
$ S ¥ $ ¥ ~
S L D g G
N F D g F
S D
g
N Serine-331 truncation mutation
n N n____ FIG. 1.
(continued)
14
CHEMOKINERECEPTORS
[ll
amino acids replace the serine, threonine, or tyrosine residues believed to be involved in the phosphorylation event. This third approach is the one we have used here to characterize the ligand-induced receptor phosphorylation of the CXCR2 chemokine receptor. This approach has the advantage of allowing examination of biological consequences of loss of the phosphorylation event, particularly relating to effects on downstream signaling events. Although selection and characterization of stable clones expressing these mutant receptors are somewhat tedious, once selected and characterized, the clones are quite useful to study alterations in calcium flux, receptor sequestration, and receptor degradation. Furthermore, affinity for ligand can be accessed and compared to wild-type receptors with regard to the role of these phosphorylation events in regulation. Care must be taken to verify that differences in response are observed in multiple clones of each mutant, and that the mutation in the receptor does not alter the affinity of the receptor for the ligand. It is also important to determine the number of receptors expressed per mutant clone as compared to wild type to avoid attributing gain or loss of function to an artifact resulting from differential expression of receptor at the cell membrane. This is particularly important for STM receptors, where often only 1 or 2 of every 50 clones selected will actually express the receptor at the cell surface. Screening of selected clones by Western blot will often show receptor expression in the other 48 clones, but ligand binding studies will be negative. Using the methods outlined above, we have determined that phosphorylation of serine residues between 342 and 352 is crucial for ligand-mediated desensitization of the CXCR2 (see Fig. 1). In contrast to the findings with CXCR1 expression in basophilic leukemia cells, where both serine and threonine phosphorylation events were believed to be involved in receptor desensitization, only serine residues of CXCR2 appear to be phosphorylated in 3ASubE placental cells. However, these apparent differences may be cell type specific and not receptor specific. This brings up an important point with regard to selection of the cell type for expression of mutant and wild-type receptors. If the phosphorylation of receptor is believed to affect intracellular signaling events such as calcium flux, it is important to select a cell type that has low endogenous intracellular free calcium, which can be readily increased in response to signals that stimulate release of calcium from intracellular stores. If the end point of phosphorylation is believed to affect cell motility or chemotaxis, then the transfected cell should be one that can show chemotaxis toward the ligand. To this end, we found that although the release of intracellular free calcium could be readily followed in 3ASubE clones, these cells were not readily adaptable to the chemotaxis assay, and for those studies additional stable clones of mutant and wild-type receptor were selected in human 293 kidney fibroblasts. When
[2]
MONOCLONAL ANTIBODIES TO CHEMOKINE RECEPTORS
15
the 342T mutant exhibiting truncation at Ser-342 in the carboxyl tail was expressed in 293 cells, the cells continue to exhibit chemotaxis toward an MGSA gradient, though this mutant exhibits little desensitization after ligand binding. Moreover, this mutant receptor is poorly sequestered following ligand stimulation.32 These data suggest that desensitization is not a required event for chemotaxis. Ben-Baruch et al. have shown that carboxyl tail truncation mutants retain the ability to undergo chemotaxis if as few as eight amino acids remain in the carboxyl tail. 3° Since this would eliminate the serine residues believed to be involved in ligand-induced receptor phosphorylation, the data from our laboratory in combination with their data demonstrate that receptor phosphorylation and desensitization are not directly involved in chemotaxis. We cannot rule out the possibility that there may be long-term effects of failure to desensitize that could ultimately affect chemotaxis. Acknowledgments This work was sponsored by the an Associate Career Scientist A w a r d from the D e p a r t m e n t of Veterans Affairs (A. R.), a grant from the National Cancer Institute (CA34590), the Medical Research Council of C a n a d a (S. M.), and the Skin Disease Center G r a n t (AR41943). 32 S. G. Mueller, J. R. White, W. P. Schraw, V. Lam, and A. Richmond, J. Biol. Chem. 272, 8207 (1997).
[2] Generation of Monoclonal Antibodies to C h e m o k i n e Receptors By
A N A N C H U N T H A R A P A I a n d K . JIN K I M
Introduction A family of chemokines has been identified that contains more than 20 chemokines with the ability to attract and activate leukocytes and play important roles as mediators of inflammation.1'2 These chemokines can be divided into three subfamilies according to the position of the first two cysteines (C-X-C, C-C, and C chemokines). These chemokines often exhibit pleiotropic effects and bind to more than one receptor. Therefore, monoclonal antibodies (MAbs) that are specific to each receptor and/or that J. J. O p p e n h e i m , C. O. Zachariae, N. Mukaida, and K. Matsushima, Annu. Rev. ImmunoL 9, 617 (1991). 2 M. Baggiolini, B. Dewald, and B. Moser, Adv. Immunol. 55, 97 (1994).
METHODS IN ENZYMOLOGY, VOL. 288
Copyright © 1997by AcademicPress All rights of reproduction in any form reserved. {X~76-6879/97$25.00