1-Methylcyclopropene alleviates peel browning of ‘Nanguo’ pears by regulating energy, antioxidant and lipid metabolisms after long term refrigeration

Scientia Horticulturae 247 (2019) 254–263

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

1-Methylcyclopropene alleviates peel browning of ‘Nanguo’ pears by regulating energy, antioxidant and lipid metabolisms after long term refrigeration ⁎

Dongbing Taoa, Junwei Wanga,b, , Lei Zhanga,b, Yangao Jiangb, Mei Lvc,

T

⁎⁎

a

Department of Food Science, Shenyang Agricultural University, Shenyang, 110866, PR China Experimental Teaching Center, Shenyang Normal University, Shenyang, 110034, PR China c Shenyang Grain and Oil Food Science Institute, Shenyang, 110025, PR China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Nanguo’ pear Peel browning 1-MCP treatment Enzyme activity Gene expression

Ripening of ‘Nanguo’ pears (Pyrus ussuriensis Maxim.) can be slowed down by cold storage, but the peel of fruit is prone to browning when they are returned to room temperature. In this study, effects of 1-methylcyclopropene (1-MCP) treatment on peel browning (PB) of ‘Nanguo’ pears, as well as on energy, antioxidant and lipid metabolisms, were investigated during shelf life after cold storage. 1-MCP treatment inhibited the occurrence of PB in ‘Nanguo’ pears during 15 d of shelf life at 20 °C. 1-MCP treated fruit showed higher firmness, glutathione (GSH) content, ATP concentration and energy charge (EC) value. Meanwhile, lower ethylene production and respiration rate, content of H2O2 and O2·−, glutathione disulphide (GSSG) content, as well as malondialdehyde (MDA) concentration and electrolyte leakage were detected in 1-MCP treated fruit. Activities and gene expression level of ATP synthase (ATPase), NADH dehydrogenase (NDA), vacuolar proton-inorganic pyrophosphatase (VPP) and glutathione peroxidase (GPX) were promoted by 1-MCP treatment. Activities and gene expression level of phospholipase D (PLD) and lipoxygenase (LOX) were inhibited by 1-MCP treatment. These results indicated that 1-MCP treatment could effectively alleviate PB in ‘Nanguo’ pears and the possible mechanisms were discussed.

1. Introdution ‘Nanguo’ pear (Pyrus ussuriensis Maxim.) is one of the most famous and economically important varieties in Liaoning province, China. However, this kind of respiration climacteric fruit has relative short shelf life which is normally less than 20 d (Wang et al., 2017a). Cold storage is used as the traditional method for extending the postharvest storage period of the fruit. Storage at low temperature could retard the ripening and senescence of the pear, but the fruit was susceptible to the occurrence of peel browning (PB) during shelf life at room temperature after long period of cold storage (Sheng et al., 2016; Wang et al., 2017a, b; Zhang et al., 2018). PB of ‘Nanguo’ pear, which usually appears even before fruit ripening and softening, is deemed to be one of the representations of chilling injury (CI) and has caused great loss to the quality and commodity value of fruit. The incidence of PB in ‘Nanguo’ pear is mainly resulted from the enzymatic oxidation of phenols by polyphenol oxidases (PPOs) which are originally separated in different compartments of cells, owing to the ⁎

damage of cellular membrane (Sheng et al., 2016; Wang et al., 2017b). Cellular energy levels, which have often been reported to change after cold storage (Liu et al., 2011, 2016; Palma et al., 2015; Shan et al., 2016), play pivotal roles in regulating the physiological metabolism and maintaining the integrity of membrane system in postharvest fruit (Cheng et al., 2015; Jin et al., 2014; Wang et al., 2013). It was reported that the incident of PB in longan fruit was companied by the decline in ATP content and energy charge (EC) (Lin et al., 2018). As a consequence, the elevation of reactive oxygen species (ROS) caused by reduced cellular energy level due to long-term refrigeration would result in the breakdown of cellular membranes, leading to the oxidation of phenols to o-quinones and the browning in pears (Veltman et al., 2003; Wang et al., 2013). Our previous proteomic study has screened the differentially expressed proteins during occurrence of PB in ‘Nanguo’ pear (Wang et al., 2017b). Three key enzymes, ATP synthase (ATPase), NADH dehydrogenase (NDA) and vacuolar proton-inorganic pyrophosphatase (VPP), which involved in oxidative phosphorylation, were differentially

Corresponding author at: Shenyang Normal University., No. 253 Huanghe Road, Shenyang, 110034, PR China. Corresponding author. E-mail addresses: [email protected] (J. Wang), [email protected] (M. Lv).

⁎⁎

https://doi.org/10.1016/j.scienta.2018.12.025 Received 11 August 2018; Received in revised form 17 December 2018; Accepted 19 December 2018 0304-4238/ © 2018 Elsevier B.V. All rights reserved.

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

level of ATPase, NDA, VPP, GPX, PLD and LOX. Three replicates were performed for each sample.

expressed (Wang et al., 2017b). Oxidative phosphorylation, which is one of the most important energy metabolism pathways, conducts the third stage of respiration metabolism in the inner mitochondrial membrane and generates almost 95% of the cellular energy (Qin et al., 2009). In addition, glutathione peroxidase (GPX), which can catalyze the reduction of H2O2 or organic hydroperoxides to water (Passaia et al., 2013), was found to be differentially expressed. GPX scavenges ROS, such as O2·− and H2O2, and prevents them from over-accumulation (Huan et al., 2016b). Furthermore, phospholipase D (PLD), which is often considered as key enzyme in membrane lipid peroxidation (Sheng et al., 2016), and LOX, which catalyzes the peroxidation of polyunsaturated fatty acids (Shewfelt and Rosario, 2000) and triggers the destabilization of cell membranes (Gao et al., 2018), were also detected differentially expressed. Changes in activities and gene expression level of enzymes involved in energy, antioxidant and lipid metabolisms may have great influences on the energy level and the maintenance of membrane system of fruit cells. 1-methylcyclopropene (1-MCP), a widely used inhibitor of ethylene perception (Lurie and Watkins, 2012), is deemed to interact with ethylene receptors and prevent ethylene-dependent responses (Watkins, 2006). 1-MCP has been reported to show effective inhibition on development of CI in some postharvest fruit such as grape (Dou et al., 2005), mandarins (Salvador et al., 2006), loquat (Cao et al., 2010), okra (Huang et al., 2012), plum (Velardo-Micharet et al., 2017) and apple (Du et al., 2017). On the contrary, the incidence of internal disorder in ‘Rocha’ pear (Saquet and Almeida, 2017) and peel damage of citrus fruit (Establés-Ortiz et al., 2016) was increased under the treatment of 1-MCP. The objective of this study was to investigate the effect of 1-MCP treatment on energy, antioxidant and lipid metabolisms accompanied by occurrence of PB in ‘Nanguo’ pear during shelf life after cold storage. Browning index (BI), firmness, ethylene production, respiration rate, content of H2O2 and O2·−, content of GSH and GSSG, electrolyte leakage, MDA concentration, ATP concentration and EC in fruit after cold storage for 120 d were investigated. Moreover, we examined the changes in activities and gene expression level of ATPase, NDA, VPP, GPX, PLD and LOX. The potential roles of the energy, antioxidant and lipid metabolisms in response to 1-MCP treatment were discussed.

2.2. Analysis of fruit maturity Firmness was analyzed by using a texture analyzer (TA-XT2iPlus; StableMicro System, Guildford, UK) equipped with an 8-mm plunger tip, and the penetration rate was 3 mm s−1 with a final penetration depth of 8 mm. Four measurements were carried out on opposite sides of the fruit. The ethylene production and respiration rate were measured by using a gas analyzer (PBI-Dansensor Checkmate 9900, Denmark) and a gas chromatograph (CP-3800, Varian, USA) with DB-5 capillary column (30 m × 0.25 mm × 0.25 μm; Agilent Corp., Santa Clara, CA, USA) and a flame ionization detector. Fruit samples were placed in 700 ml jars sealed for 5 h at 20 °C. Then a total of 1 ml of headspace gas was sampled. The temperatures of injector, detector and oven were 110 °C, 140 °C, and 90 °C, respectively. 2.3. Analysis of browning index Analysis of BI was carried out by using the method of Yang et al. (2010). PB degrees were firstly graded by the area of browning on peel as follows: 0 = no browning, 1 = less than 1/3 browning, 2 = 1/3 - 2/ 3 browning, 3 = more than 2/3 browning. BI was then calculated by the formula: BI (%) = (Σ (browning degree × fruit number of this degree)) / (the highest browning degree × total fruit number) × 100%. 2.4. Analysis of malondialdehyde (MDA) and electrolyte leakage Concentration of MDA was determined by using the method described of Sun et al. (2011). Sample of peel (1 g) was homogenized in 5 ml of 1 g L−1 trichloroacetic acid (TCA), and centrifuged at 10,000 g for 20 min. The supernatant (2 mL) was mixed with 2 ml of 6.7 g L−1 thiobarbituric acid (TBA). Then the mixture was heated at 100 °C for 20 min and cooled on ice immediately. After centrifuged at 5000 g for 10 min, the absorbance of supernatant was detected at 450, 532 and 600 nm using a spectrophotometer (TU-1810 DSPC, Beijing Puxi Instrument Co., Beijing, China). The MDA concentration was calculated by using the formula: MDA concentration (μmol kg−1) = [6.45 × (A532 - A600) - 0.56 × A450] × 5. Electrolyte leakage was determined by using the method described by Zhu et al. (2009). Peel samples (20 pieces) of 1 cm diameter were immerged in 40 ml of double-distilled water. A conductivity meter (DDS-307, Shanghai Precise Science Instrument Co., Shanghai, China) was used for the measurement of electrolyte leakage. P0 was detected as initial electrolyte leakage, and P1 was detected 10 min later. After boiling for 10 min and cooling to 20 °C, P2 was measured as final electrolyte leakage. The electrolyte leakage was calculated by using the formula: Electrolyte leakage (%) = (P1 - P0) / (P2 - P0).

2. Materials and methods 2.1. Fruit materials and sampling Samples of pear fruit (Pyrus ussuriensis Maxim. cv ‘Nanguo’) were harvested on September 12th, 2017 at an orchard in Anshan, Liaoning province, China. Fruit were then transported to laboratory immediately on the day of harvest. Fruit without decay or damage and with uniform size were selected for analysis. Pear samples were randomly divided into four groups of 660 fruit each. All the groups of pears were kept at 0 ± 0.5 °C for 20 h of precooling. For group of 1–3, the pears were kept in nine plastic containers of 220 fruit each for 20 h, and then stored at 0 °C for 0 d, 60 d or 120 d respectively. 1-MCP treated group was exposed to 0.5 μL L−1 1-MCP (SmartFresh, AgroFresh Inc., USA) for 20 h in three identical plastic containers of 220 fruit each, and then stored at 0 °C for 120 d. The release of 1-MCP was conducted by dissolving power in 1 ml distilled water in a glass dish. Relative humidity (RH) was maintained at 85–90 % during the entire storage period. After cold storage, fruit were transferred to shelf life at room temperature (20 °C) for 15 d. For each group, fruit were sampled at a 3-day interval during the shelf life. Analysis of BI, firmness, ethylene production, respiration rate, content of H2O2 and O2·−, content of GSH and GSSG, electrolyte leakage, MDA concentration, ATP concentration and EC value, enzyme activities of ATPase, NDA, VPP, GPX, PLD and LOX was conducted on 3 replicates of 27 fruit at each sampling point. Meanwhile, peel of 9 fruit was frozen in liquid nitrogen for the measurement of genes expression

2.5. Analysis of H2O2 and O2·− content Peel samples were ground to a fine powder in liquid nitrogen, and then the content of H2O2 and O2·− was measured by using the modified method of Sun et al. (2016). For analysis of H2O2, 0.05 g powdered sample was mixed with 1 ml of cold acetone and incubated for 10 min at 25 °C. After centrifugation at 20,000 g for 10 min, 500 μL supernatant was mixed with 50 μL of 5% (w/v) titanous sulfate and 100 μL of 100% ammonia. The mixture was centrifuged at 20,000 g for 10 min, and then the supernatant was discarded. The precipitate was mixed with 2 ml of 2 mol L−1 H2SO4 and washed three times using acetone. The absorbance was measured at 415 nm. For determination of O2·−, 0.15 g of sample powder was homogenized with 1 ml of 0.05 mol L−1 phosphate buffer solution containing 255

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Table 1 Primers for Real-time q-PCR Analysis. Protein

Accession number

Forward primer (5'-3')

Reverse primer (5'-3')

Product size (bp)

ATPase NDA VPP GPX PLD LOX ACTIN

G2I8 × 8 M5XWQ3 Q8GT22 Q6A4W8 B0FBL2 A0A0B4VBV9 JN684184

GCCAATTGATTCTGAGTAGCTTT CAACTTGCTTGCAGTAATTCCAG ATTGCCACTTATGCCAATGCTAG TCAATCCACGATTTCACTGTCAAG CATTGTGTCTTATGCCCTCGT TGAGCCATTTGTGATAGCGG TTGGGATGGGTCAGAAGG

GGTATTTCGGTTTCCAGGGTAG ATAACAGCTGCAGTCCCCAATC CTACCAGGTCAGCCCCAACATC CTTGTCAAAGATGGGATACTCAGC CCAGACCCCCAACAAAACTAAC TGTGAGAACTTGTCGTGCGG CTGTGAGCAGAACTGGGTG

155 130 290 280 160 121 186

0.002 mol L-1 hydroxylamine hydrochloride (pH 7.8), and then centrifuged at 20,000 g for 15 min A total of 600 μL supernatant was mixed with 400 μL phosphate buffer solution, and incubated for 30 min at 25 °C. After added 1 ml of 0.017 mol L−1 L-sulfanilic acid and 1 ml of 0.007 mol L−1 L-1-α-naphthylamine, the mixture was shaken for 30 min. The absorbance was determined at 530 nm.

2.9. RNA isolation and cDNA synthesis Total RNA was extracted from 0.05 - 0.1 g frozen peel sample by using RNAprep Pure Plant (Polysaccharide & Polyphenolics-rich) kit (Tiangen, Beijing, China). The purity and concentration of total RNA was measured by using a spectrophotometer (NanoDropND-2000, Thermo, Germany) at 260 nm. The integrity of RNA was determined by using 1.0% agarose gels electrophoresis. Synthesis of first strand cDNA was conducted by using TIANScript RT kit (Tiangen, Beijing, China).

2.6. Analysis of ATP, ADP and AMP concentrations and energy charge Concentrations of ATP, ADP and AMP were measured by using the modified method of Wang et al. (2017a). 2 g peel sample was ground in liquid nitrogen with 5 ml 0.6 mol L−1 perchloric acid. Then the mixture was centrifuged at 18,000 g for 12 min at 4 °C A total of 3 ml supernatant was obtained and the pH was adjusted to 6.6–6.8 using 1 mol L-1 KOH immediately. After diluted to 4 mL, the solution was passed through a 0.45 mm filter (Millipore Corp., Bedford, MA, USA). A HPLC instrument (Agilent 1100, Agilent Corp., Santa Clara, CA, USA) with reserved-phase Nova-Pak C18 column (5 μm, 5 × 250 mm; Agilent Corp., Santa Clara, CA, USA) was used for the measurement. Mobile phase A consisted of 0.04 mol L−1 KH2PO4 and 0.06 mol L−1 K2HPO4 in deionized water and the pH was adjusted to 7.0 using 0.1 mol L−1 KOH. Mobile phase B was pure acetonitrile. The flow rate was 1.2 ml min−1. The elution was carried out by a linear gradient program with 75–100% A and 0–25% B for 7 min. The injection volume was 10 μL, and UV detection wavelength was at 254 nm. ATP, ADP, and AMP concentrations were calculated using the external standard curve, while energy charge (EC) was calculated according to the formula: [ATP + (1/2) ADP] / [ATP + ADP + AMP].

2.10. Analysis of gene expression Gene expression level of related enzymes was analyzed using an iQ5 real-time PCR system (Bio-Rad, USA). The operation parameters were set up following the instruction of RealMasterMix (SYBR Green) (Tiangen) under the following conditions: 30 s at 95 °C, 40 cycles of 5 s at 95 °C, and 34 s at 58 °C. To normalize small differences in template amounts, Actin gene (PpActin, JN684184) of Pyrus was used as an internal control (Zhou et al., 2015). The primers (Table 1) were designed according to related genes sequences by using Primer Premier 5.0 software. 2.11. Statistical analyses Analysis was performed according to a completely randomized design. SPSS software was used to analyze the effect of treatments on the data presented in Figures and tables by using analysis of variance (ANOVA). Duncan’s multiple range tests was used to determine significant differences at the 5% level.

2.7. Analysis of GSH and GSSG content 3. Results

A total of 2 g peel sample was homogenized in 0.05 mol L−1 sodium phosphate buffer (pH 7.0), and then centrifuged at 10,000 g for 20 min at 4 °C. The supernatant was used for analysis of GSH and GSSG by using the method of Castillo and Greppin (1988). The reaction mixture for GSH determination consisted of 0.06 mol L−1 K-phosphate0.0025 mol L−1 EDTA buffer (pH 7.5), 0.00006 mol L−1 DTNB (5, 5′dithiobis-2-nitrobenzoic acid). Extract of 100 μL was added to a final volume of 1 mL, and incubated for 10 min. The absorbance was measured at 412 nm. The standard reaction mixture for determination of total glutathione (GSH + GSSH) contained 0.06 mol L−1 K-phosphate-0.0025 mol L−1 EDTA buffer (pH 7.5), 0.00006 mol L−1 DTNB, 0.5 units of glutathione reductase, 0.0002 mol L−1 NADPH. Extract of 10 μL was added to a final volume of 1 mL. The absorbance was measured at 412 nm.

3.1. Fruit maturity and browning index There was no significant difference in firmness of ‘Nanguo’ pears among groups on the day of removal from cold storage, which proved that the postharvest ripening was effectively postponed by refrigeration (Table 2). Then the fruit showed a normal softening tendency during shelf life at room temperature. The decrease in fruit firmness was closely related to the length of cold storage, mainly manifested in the lower firmness found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d from day 3 to day 15. In addition, 1-MCP treatment inhibited the decease of fruit firmness. Significantly higher firmness was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d from day 3 to day 15. Ethylene production in all groups of fruit maintained constant from day 0 to day 6, with a rapid promotion on day 9, and then increased steadily until the end of shelf life. Significantly higher ethylene production was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d from day 3 to day 15, and to that of fruit stored for 60 d and 90 d from day 9 to day 15, respectively. 1-MCP treatment inhibited the increase in ethylene production of refrigerated fruit, and significantly lower ethylene production was found in 1-MCP treated fruit compared to that of fruit stored for 120 d from

2.8. Analysis of enzyme activity Enzyme activities of NDA, VPP, and ATPase were measured by using the method described by Mushtaq et al. (2013) and Yin et al. (2015) respectively. Enzyme activities of GPX were measured by using the method of Huan et al. (2016a). Enzyme activity of PLD was measured by using the method of Sheng et al. (2016). Enzyme activities of LOX were measured by using the method described by Axelrod et al. (1981). 256

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Table 2 Maturity of refrigerated ‘Nanguo’ pears during shelf life. Treatment

Firmness (N)

Ethylene production (μL kg−1 h−1)

Respiration rate (mgCO2 kg−1 h−1)

0d 30 d 60 d 90 d 120 d 120 d+1-MCP 0d 30 d 60 d 90 d 120 d 120 d+1-MCP 0d 30 d 60 d 90 d 120 d 120 d+1-MCP

Shelf life 0d

3d

6d

9d

12 d

63.49 a 62.19 a 59.73 a 59.05 a 58.63 a 60.52 a 3.18 a 3.25 a 4.25 a 4.62 a 5.73 a 4.39 a 8.27 a 8.68 a 9.15 a 11.07 a 11.53 a 9.42 a

61.39 a 60.27 a 57.26 ab 55.24 bc 51.47 c 60.41 a 4.76 a 4.93 a 6.13 ab 6.85 ab 8.77 b 5.83 a 10.37 a 10.92 a 11.62 a 12.96 a 13.46 a 11.26 a

59.76 a 58.62 a 55.89 ab 52.71bc 47.69 c 58.73 a 6.36 a 6.89 a 8.17 ab 8.56 ab 9.16 b 6.96 a 13.18 a 13.85 a 14.88 a 17.82 ab 18.78 b 13.65 a

56.26 a 54.37 ab 50.36 bc 47.11cd 44.57 d 54.68 ab 16.42 a 17.04 ab 19.28 bc 20.37 c 25.37 d 15.52 a 21.87 ab 22.54 ab 23.25 bc 26.91 cd 28.59 d 19.64 a

50.15 48.85 45.27 42.96 39.73 47.56 28.83 29.56 31.75 33.29 42.79 26.67 19.58 20.69 22.53 26.58 27.62 18.47

15 d a ab bc cd d ab a ab bc c d a ab ab b cd d a

42.56 40.46 33.69 31.37 27.64 35.83 43.11 44.27 48.96 52.73 67.52 39.86 17.34 18.83 20.84 23.36 24.38 16.22

a ab bc cd d c ab b c d e a ab ab bc c c a

Means with different letters are significantly different at P < 0.05. Means ± SE of three replicates are shown.

3.2. Electrolyte leakage and MDA concentration

compared to that of unrefrigerated fruit (Fig. 2A). Electrolyte leakage in fruit stored for 120 d increased dramatically during shelf life, with a sharp increase on day 9. Higher electrolyte leakage was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d during the shelf life. 1-MCP treatment relieved the increase of electrolyte leakage in fruit. The electrolyte leakage in 1-MCP treated fruit remained constant during the first 9 d, and significantly lower electrolyte leakage was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d during the whole shelf life. MDA concentration in all groups of fruit increased continuously during shelf life (Fig. 2B). However, the increase of MDA concentration in fruit was related to the length of cold storage, which mainly manifested in the higher MDA concentration observed in fruit that stored for 120 d during the whole shelf life. 1-MCP treatment effectively inhibited the increase of MDA concentration in fruit. Significantly lower MDA concentration was found in 1-MCP treated fruit compared to that of fruit stored for 120 d from day 3 to day 15. Electrolyte leakage and MDA concentration was 12% and 17% lower in 1-MCP treated fruit than that of fruit stored for 120 d on day 15 of shelf life, respectively.

The electrolyte leakage of fruit stored for 60 d, 90 d and 120 d increased significantly on the day of removal from cold storage

3.3. H2O2 and O2·− content

day 3 to day 15 of shelf life. Respiration rate increased continuously and peaked on day 9, and then followed by a decrease from day 9 to day 15. Significantly higher respiration rate was detected in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d and 60 d from day 6 to day 15. However, respiration rate of 1-MCP treated fruit was significantly lower compared to that of fruit stored for 120 d from day 6 to day 15 of shelf life at 20 °C. As shown in Fig. 1, there was no PB phenomenon appeared in unrefrigerated fruit and that stored for 30 d and 60 d during the shelf life. With regard to the fruit that were stored for 90 d and 120 d, PB began to appear on day 12 and day 6 respectively, and the BI increased sharply until the end of shelf life. However, the development of PB in fruit stored for 120 d was delayed to day 12 by 1-MCP treatment, and significantly lower BI was found in 1-MCP treated fruit compared to that stored for 120 d from day 9 to day 15. BI was 62% and 52% lower in 1MCP treated fruit than that of fruit stored for 120 d on day 12 and day 15, respectively.

Content of H2O2 in refrigerated fruit increased steadily during shelf life at 20 °C, with a sharp increase on day 12 (Fig. 2C). The uptrend in H2O2 content was aggravated by the extension of storage period. Significantly higher content of H2O2 was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d. 1-MCP treatment effectively inhibited the generation of H2O2 in fruit. Significantly lower content of H2O2 was found in 1-MCP treated fruit compared to that of fruit stored for 120 d during the whole shelf life. Content of O2·− increased dramatically during the shelf life (Fig. 2D). Higher content of H2O2 was detected in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d. Whereas, the increase of O2·− content in fruit was relieved by 1-MCP treatment. The content of O2·− in 1-MCP treated fruit remained stable during the first 3 d, and significant lower O2·− content was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d during the shelf life.

Fig. 1. BI of ‘Nanguo’ pears during shelf life at 20 °C following 120 d of cold storage at 0 °C. Means ± SE of three replicates are shown. 257

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Fig. 2. Electrolyte leakage (A), MDA concentration (B), H2O2 content (C), O2·− content (D), GSH content (E) and GSSG content (F) of ‘Nanguo’ pears during shelf life at 20 °C following 120 d of cold storage at 0 °C. Means ± SE of three replicates are shown.

The concentration of GSSG in fruit stored for 30 d, 60 d, 90 d and 120 d increased dramatically during the first 9 d during shelf life, and then deceased slightly afterward (Fig. 2F). Significant higher concentration of GSSG was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d. 1-MCP treatment inhibited the increase of GSSG concentration in fruit. GSSG concentration in 1-MCP treated fruit kept increasing during the first 12 d, and then remained stable from day 12 to day 15. Significantly lower GSSG concentration was found in 1-MCP treated fruit compared to that of fruit stored for 120 d during the whole shelf life.

3.4. GSH and GSSG concentration GSH concentration in fruit decreased continuously during the whole shelf life at room temperature (Fig. 2E). However, long-term refrigeration aggravated the decrease of GSH concentration in fruit, which manifested in lower GSH concentration detected in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 120 d. 1-MCP treatment effectively relieved the downtrend of GSH concentration in fruit. Significantly higher GSH concentration was found in 1-MCP treated fruit compared to that of fruit stored for 120 d during the shelf life. GSH concentration in 1-MCP treated fruit was 1.9-fold and 3.0-fold compared to that of fruit stored for 120 d on day 6 and day 9 of shelf life, respectively.

258

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Fig. 3. Concentration of ATP (A), ADP (B), AMP (C) and energy charge (D) in ‘Nanguo’ pears during shelf life at 20 °C following 120 d of cold storage at 0 °C. Means ± SE of three replicates are shown.

steadily until the last day. Lower AMP concentration was found in 1MCP treated fruit compared to that of fruit stored for 120 d during shelf life except for day 15. EC of fruit decreased constantly during the whole shelf life, with sharp decrease from day 12 to day 15 (Fig. 3D). Consistent with the changing trend of ATP concentration, lower energy charge was found in fruit undergoing longer period of cold storage. However, the decline in EC was retarded under 1-MCP treatment. EC in 1-MCP treated fruit remained constant from day 0 to day 12, and then decreased sharply on day 15. Higher EC was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d during the whole shelf life.

3.5. Energy status ATP concentration in fruit decreased dramatically during the 15 d of shelf life, and the decrease in ATP concentration was aggravated by the extension of storage period (Fig. 3A). Lower ATP concentration was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d during the shelf life. However, the severity of the downtrend in ATP concentration was relieved by 1MCP treatment. Higher ATP concentration was found in 1-MCP treated fruit compared to that of fruit stored for 120 d during the whole shelf life, and concentration of ATP in 1-MCP treated fruit was 1.8-fold compared to that of fruit stored for 120 d on the last day of shelf life. ADP concentration in all groups of fruit increased dramatically during the first 6 d of shelf life, and then decreased sharply until the last day (Fig. 3B). Fruit stored for 120 d showed higher ADP concentration during the shelf life. The increase of ADP concentration in fruit stored for 120 d was dramatically inhibited by 1-MCP treatment. ADP concentration in 1-MCP treated fruit was almost constant from day 0 to day 6, and then decreased rapidly until the end of shelf life. Lower ADP concentration was found in 1-MCP treated fruit compared to that of fruit stored for 120 d during the shelf life. AMP concentration in unrefrigerated fruit and that stored for 30 d and 60 d remained constant during the first 3 d, with a dramatic increase from day 3 to day 9, and then decreased until the end of shelf life (Fig. 3C). AMP concentration in fruit that stored for 90 d and 120 d showed a dramatic increasing trend during the first 6 d, and then decreased sharply. Higher AMP concentration was detected in fruit stored for 120 d during the shelf life. The AMP concentration in 1-MCP treated fruit maintained constant during the first 3 d of shelf life and increased

3.6. Activities and gene expression of related enzymes The ATPase activity of unrefrigerated fruit and that stored for 30 d and 60 d increased sharply during the first 6 d, but significantly lower ATPase activity was found in fruit stored for 60 d from day 6 to day 15 (Fig. 4A). Long-term refrigeration had more adverse impact on the ATPase activity of fruit, which presented on lower ATPase activity detected in fruit stored for 90 d and 120 d than that in the other 3 groups. ATPase activity in fruit stored for 120 d was dramatically promoted by 1-MCP treatment during the first 9 d, and significantly higher ATPase activity was found in 1-MCP treated fruit compared to that of fruit stored for 120 d from day 3 to day 12. ATPase activity in 1MCP treated fruit was 1.2-fold and 1.3-fold compared to that of fruit stored for 120 d on day 6 and day 9, respectively. NDA activity in all groups of fruit increased dramatically during the first 9 d of shelf life, and then decreased rapidly until the last day (Fig. 4B). Duration of cold storage had a serious effect on NDA activity, which reflected in the 259

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Fig. 4. Activity of ATPase (A), NDA (B), VPP (C), GPX (D), PLD (E) and LOX (F) in ‘Nanguo’ pears during shelf life at 20 °C following 120 d of cold storage at 0 °C. Means ± SE of three replicates are shown.

during the first 9 d, and then decreased rapidly until the end of shelf life (Fig. 4F). Higher LOX activity was detected in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d during the whole shelf life. 1-MCP treatment restrained the increase of LOX activity, and 35% lower level of LOX activity was found in 1-MCP treated fruit than that of fruit stored for 120 d on day 9 of shelf life. Gene expression level of ATPase in all the groups of fruit decreased sharply during the first 9 d, and then maintained at low level (Fig. 5A). Long-term refrigeration aggravated the decrease in gene expression level of ATPase in fruit. Significantly lower gene expression level of ATPase was detected in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d from day 3 to day 9. 1-MCP treatment effectively inhibited the decrease in gene expression level of ATPase from day 0 to day 9, and 1.6-fold and 2.5-fold higher gene expression level of ATPase was found in 1-MCP treated fruit than that in fruit stored for 120 d on day 6 and day 9, respectively. Similar to the changing trend of activity, gene expression level of NDA increased rapidly during the first 9 d, and then decreased sharply afterwards (Fig. 5B). Lower gene expression level of NDA was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d from day 3 to day 15. 1-MCP treatment promoted the gene expression level of NDA, and significantly higher gene expression level of NDA was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d during shelf life except the day of removal. Contrary to the activity of VPP, gene expression level of VPP decreased during the first 9 d, and then increased again until end of

lower NDA activity found in fruit stored for 120 d. 1-MCP treatment promoted the NDA activity of fruit from day 3 to day 9, and relieved the rapid decrease of NDA activity on day 12. Significantly higher NDA activity was found in 1-MCP treated fruit compared to that of fruit stored for 120 d from day 3 to day 15 of shelf life. VPP activity of unrefrigerated fruit increased sharply during the first 6 d, and then decreased until the end of shelf life (Fig. 4C). Long-term refrigeration had an inhibitory effect on the VPP activity of fruit. VPP activity of fruit stored for 120 d was lower than that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 120 d. The activity of VPP in fruit was effectively promoted by 1-MCP treatment from day 3 to day 9. Higher VPP activity was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d during shelf life. GPX activity in all groups of fruit increased dramatically and peaked on day 9, and then decreased until the end of shelf life (Fig. 4D). Lower GPX activity was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d. 1-MCP treatment effectively promoted the GPX activity on day 9, and significantly higher GPX activity was found in 1-MCP treated fruit compared to that of fruit stored for 120 d during shelf life. PLD activity increased dramatically during the first 6 d, followed by a rapid decrease on day 9, and remained stable until the end of shelf life (Fig. 4E). Long-term refrigeration dramatically promoted the uptrend of PLD activity, and PLD activity of fruit stored for 120 d was up-regulated by 1.2-fold compared to that of unrefrigerated fruit on day 6. 1-MCP treatment restrained the dramatic increase of PLD activity in fruit. Lower level of PLD activity was found in 1-MCP treated fruit during the whole shelf life. LOX activity in fruit increased sharply 260

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Fig. 5. Relative gene expression of ATPase (A), NDA (B), VPP (C), GPX (D), PLD (E) and LOX (F) in ‘Nanguo’ pears during shelf life at 20 °C following 120 d of cold storage at 0 °C. Expression level was shown as a ratio relative to the day that fruit were pre-cooling, which was set as 1. Means ± SE of three replicates are shown.

expression level of LOX, and significantly lower gene expression level of LOX was detected in 1-MCP treated fruit compared to that of fruit stored for 120 d during the whole shelf life.

shelf life (Fig. 5C). Gene expression level of VPP in fruit that stored for 120 d was severely suppressed from day 3 to day 9, and significantly lower gene expression level of VPP was found in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d from day 3 to day 9. 1-MCP treatment effectively alleviated the decline in gene expression level of VPP during the first 9 d, and significantly higher gene expression level of VPP was found in 1-MCP treated fruit compared to that of fruit stored for 120 d from day 3 to day 9. Gene expression level of GPX in fruit decreased continuously during the shelf life (Fig. 5D). The length of refrigeration had an adverse effect on gene expression level of GPX. Lower gene expression level of GPX was detected in fruit stored for 120 d compared to that of unrefrigerated fruit and fruit stored for 30 d, 60 d and 90 d during the whole shelf life. 1-MCP treatment alleviated the decrease in gene expression level of GPX in fruit, and 1.3-fold and 1.4-fold higher gene expression level of GPX were found in 1-MCP treated fruit than that of fruit stored for 120 d on day 6 and day 9, respectively. Gene expression level of PLD in fruit rose rapidly to a peak on day 9, and then drop sharply on day 12 (Fig. 5E). Long-term refrigeration aggravated the uptrend in gene expression level of PLD, and higher gene expression level of PLD was detected in fruit stored for 120 d during the shelf life. 1-MCP treatment effectively alleviated the increase in gene expression level of PLD on day 9, and 39% lower gene expression level of PLD was found in 1-MCP treated fruit than that of fruit stored for 120 d on day 9. Gene expression level of LOX in fruit increased markedly during the first 6 d, followed by remaining stable from day 6 to day 9, and then dropped rapidly until the end of shelf life (Fig. 5F). Higher gene expression level of LOX was detected in fruit stored for 120 d during the shelf life. 1-MCP treatment effectively inhibited the increase in gene

4. Discussion The sharp increase in fruit respiration rate and ethylene production on day 9 exhibited a normal climacteric feature of ‘Nanguo’ pear. The generation of H2O2 and O2·− during fruit senescence is unavoidable (Huan et al., 2016b), because they are natural by-products of aerobic metabolism, generated from the electron transport chains of respiration (Chomkitichai et al., 2014). The overproduction of ethylene caused by cold storage may accelerate programmed cell death by generating ROS, leading to over-mature physiological disorders during the shelf life of pear fruit (Zhai et al., 2018). In this study, severe PB in ‘Nanguo’ pear was accompanied by increased content of H2O2 and O2·−, which demonstrated that the generation of ROS seriously affected this type of physiological disorder during shelf life after refrigeration. The constant stress of ROS resulting from low-temperature storage can lead to less cellular energy being available to maintain membrane integrity in fruit (Wang et al., 2017a). Energy supply in fruit cells, which plays crucial roles in physiological process of postharvest fruit, is an important factor in controlling fruit ripening and senescence (Jin et al., 2014; Yao et al., 2014). Increasing studies have reported that cellular energy deficiency could result in physiological disorder, leading to incidence of CI in various kinds of fruit which experienced cold storage (Jin et al., 2014; Li et al., 2016; Pan et al., 2017; Shan et al., 2016; Liu et al., 2011). Decreased content of ATP and energy charge in ‘Baifeng’ peach was found after storage at 0 °C accompanied 261

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

that of fruit stored for 120 d during shelf life, which was coincided with the higher GSH concentration, leading to lower H2O2 and O2·− contents. These results suggested that the antioxidant capacity and ability of ROS scavenging of refrigerated ‘Nanguo’ pear were promoted by 1MCP treatment. Furthermore, ATP is essential for the synthesis of ROS scavenging enzymes such as GPX, and non-enzyme scavengers like GSH (Tian et al., 2013; Yi et al., 2008, 2010), which was also manifested in higher activity and gene expression level of GPX, as well as increased GSH content found in the 1-MCP treated fruit in this study. PLD and LOX, which are related to lipid oxidative metabolism, have been suggested to have significant impact on cellular membrane deterioration and induction of CI in fruit (He et al., 2017; Kumar et al., 2018; You et al., 2014; Liu et al., 2011; Gao et al., 2018; Wang et al., 2016). He et al. (2017) reported that the senescence of banana fruit was accelerated by chilly stress at 7 °C, accompanying by activation of PLD and declined cellular energy level. Similarly, the development of CI symptoms was accompanied by a significant increase in LOX activity in sweet pepper fruit, and the pattern appeared to coincide with the increase of electrolyte leakage and MDA content, while the relief of CI in pepper fruit was resulted from the decrease in LOX activity (Wang et al., 2016). 1-MCP treated fruit exhibited lower activities and genes expression level of PLD and LOX, leading to alleviation on cellular membrane peroxidation, which resulted in decreased electrolyte leakage and MDA content. As a consequence, the maintenance of cellular compartmentalization caused by promoted energy metabolism and antioxidant metabolism, as well as inhibited cellular membrane peroxidation metabolism, which effectively avoided the contact between phenols and phenolase that were from different cell organs, resulted in the alleviation of PB in the pear fruit.

with the development of internal browning (Jin et al., 2014). Moreover, it was reported that H2O2 accelerated the occurrence of PB in ‘Fuyan’ longan by enhancing the decrease in ATP and speeding up the process of membrane damage (Lin et al., 2017b). Electrolyte leakage and MDA are main parameters which are usually used to evaluate the degree of membrane lipid peroxidation and to reflect the cellular membrane integrity (Sheng et al., 2016). In this study, incidence of PB in pear fruit during shelf life after long-term refrigeration was accompanied by decreased energy level, and increased electrolyte leakage and MDA concentration. The results further indicated that the increase of H2O2 and O2·− induced PB in pears partly due to the energy deficiency and the loss of cellular compartmentalization. The status of cellular energy also plays key roles in ROS scavenging system during the development of disease and the occurrence of browning in harvested fruit (Lin et al., 2017a). GSH, which is one of the most important non-enzymatic antioxidant compounds (Koh et al., 2007), has an vital function in maintaining cellular redox status and plays a significant role in antioxidant protection (Cai et al., 2011). GSH serves as a reductant which results in the reduction of ROS to the form of water or alcohol compound, by means of the formation of oxidized GSH or GSSG (Lum et al., 2016). In our study, declined GSH and elevated GSSG were detected in refrigerated pear fruit during the first 9 d of shelf life, which indicated a decrease of the ROS scavenging capacity during the occurrence of PB in fruit. Afterwards, low level of GSH and high level of GSSG were maintained in fruit stored for 120 d from day 9 to day 15, accompanied by sharply decreased ATP concentration and EC value, which further proved that the disorders in the ROS scavenging system may be caused by the lower level of cellular energy in pear fruit. 1-MCP treatment has been reported to delay the senescence and to alleviate the CI symptom in postharvest fruit such as apple (Du et al., 2017), pear (Dong et al., 2015), peach (Huan et al., 2016a), okra (Huang et al., 2012), plum (Velardo-Micharet et al., 2017) and banana (Pongprasert and Srilaong, 2014). In our work, 1-MCP treatment alleviated PB symptom in refrigerated ‘Nanguo’ pears during shelf life, accompanied by elevated EC level and GSH concentration, as well as reduced level of cellular membrane peroxidation and decreased concentrations of ROS. 1-MCP alleviated the alterations of physiological metabolisms in pear fruit by ways of regulating the expression of genes encoding enzymes involved in relative physiological pathways. Elevated cellular energy status in the pear fruit under 1-MCP treatment might be associated with the promoted activities and genes expression level of energy related enzymes. ATPase has been referred as the ‘master enzyme’ which locates on inner mitochondrial membrane and plays an important role in oxidative phosphorylation pathway (Muzi et al., 2016; Lin et al., 2018). NDA is the key enzyme responsible for the synthesis and supply of ATP (Shikanai, 2016). VPP was considered to play pivot roles in regulating cellular pH (Yin et al., 2015). 1-MCP treatment promoted energy metabolism via increasing the activities and gene expression level of ATPase, NDA and VPP, resulting in increase of ATP content and EC level. Maintenance of activities and genes expression level of the energy-related enzymes is crucial for ensuring sufficient cellular energy and sustaining normal physiological metabolisms in fruit cells. It has been reported that under oxidative stress conditions, GPX becomes the main H2O2 scavenging enzyme in plants (Halusková et al., 2009), and the activity and gene expression level of GPX are generally increased (Passaia et al., 2013; Bela et al., 2015). For example, gene expression level of GPX was significantly induced in rice after 2, 4 and 8 h of H2O2 treatment and subjected to a 10 °C climate for 24 h (Passaia et al., 2013). Moreover, the incidence of internal browning in loquat fruit was inhibited, and increased GSH content as well as the enhancement of GPX were detected, which suggested that glutathione metabolism has important roles in alleviating oxidative damage and enhancing chilling tolerance (Cai et al., 2011). 1-MCP treated fruit exhibited higher activity and gene expression level of GPX compared to

5. Conclusions In conclusion, incidence of PB in ‘Nanguo’ pears during shelf life after cold storage was alleviated by 1-MCP treatment. Energy, antioxidant and lipid metabolisms have a significant impact on the development of PB. Increased activities and genes expression level of ATPase, NDA and VPP, and elevated ATP concentration and EC were associated with the maintenance of normal physiological metabolisms in fruit. In addition, the increased activity and gene expression level of GPX, and the increased content of GSH were associated with the enhanced oxidation resistance to ROS, as indicated by lower content of H2O2 and O2·−. Moreover, inhibited activity and genes expression level of PLD and LOX may play a key role in relieving the degradation of cellular membrane, as shown in decreased electrolyte leakage and MDA concentration. Acknowledgement This work was supported by the Basic Research Program of Education Department of Liaoning (LFW 201707), and Innovation and Entrepreneurship Foundation of Liaoning (No. 201860019). References Axelrod, B., Cheesbrough, T.M., Leakso, S., 1981. Lipoxygenase from soybeans. Methods Enzymol. 7, 443–451. Bela, K., Horváth, E., Gallé, Á., Szabados, L., Tari, I., Csiszár, J., 2015. Plant glutathione peroxidases: emerging role of the antioxidant enzymes in plant development and stress responses. J. Plant. Physiol. 176, 192–201. Cai, Y.T., Cao, S.F., Yang, Z.F., Zheng, Y.H., 2011. MeJA regulates enzymes involved in ascorbic acid and glutathione metabolism and improves chilling tolerance in loquat fruit. Postharvest Biol. Technol. 59, 324–326. Cao, S., Zheng, Y., Wang, K., Rui, H., Shang, H., Tang, S., 2010. The effects of 1- methylcyclopropene on chilling and cell wall metabolism in loquat fruit. J. Hortic. Sci. Biotechnol. 85, 147–153. Castillo, F.J., Greppin, H., 1988. Extracellular ascorbic acid and enzyme activities related to ascorbic acid metabolism in Sedum album L. Leaves after ozone exposure. Environ. Exp. Bot. 28, 232–238.

262

Scientia Horticulturae 247 (2019) 254–263

D. Tao et al.

Mariath, J.E.A., Margis, R., Margis-Pinheiro, M., 2013. The mitochondrial glutathione peroxidase GPX3 is essential for H2O2 homeostasis and root and shoot development in rice. Plant. Sci. 208, 93–101. Pongprasert, N., Srilaong, V., 2014. A novel technique using 1-MCP microbubbles for delaying postharvest ripening of banana fruit. Postharvest Biol. Technol. 95, 42–45. Qin, G.Z., Wang, Q., Liu, J., Li, B.Q., Tian, S.P., 2009. Proteomic analysis of changes in mitochondrial protein expression during fruit senescence. Proteomics 9, 4241–4253. Salvador, A., Carvalho, C., Monterde, A., Martínez-Jávega, J., 2006. Note. 1-MCP effect on chilling injury development in ‘Nova’ and ‘Ortanique’ mandarins. Food Sci. Technol. Int. 12, 165–170. Saquet, A., Almeida, D., 2017. Internal disorders of ‘Rocha’ pear affected by oxygen partial pressure and inhibition of ethylene action. Postharvest Biol. Technol. 128, 54–62. Shan, T.M., Jin, P., Zhang, Y., Huang, Y.P., Wang, X.L., Zheng, Y.H., 2016. Exogenous glycine betaine treatment enhances chilling tolerance of peach fruit during cold storage. Postharvest Biol. Technol. 114, 104–110. Sheng, L., Zhou, X., Liu, Z.Y., Wang, J.W., Zhou, Q., Wang, L., Zhang, Q., Ji, S.J., 2016. Changed activities of enzymes crucial to membrane lipid metabolism accompany pericarp browning in ‘Nanguo’ pears during refrigeration and subsequent shelf life at room temperature. Postharvest Biol. Technol. 117, 1–8. Shewfelt, R.L., Rosario, B.A., 2000. The role of lipid peroxidation in storage disorders of fresh fruits and vegetables. HortScience 35, 575–579. Shikanai, T., 2016. Chloroplast NDH: A different enzyme with a structure similar to that of respiratory NADH dehydrogenase. Biochim. Biophys. Acta-Bioenergetics 1857, 1015–1022. Sun, J., You, X.G., Li, L., Peng, H.X., Su, W.Q., Li, C.B., He, Q.G., Liao, F., 2011. Effects of a phospholipase D inhibitor on postharvest enzymatic browning and oxidative stress of litchi fruit. Postharvest Biol. Technol. 62, 288–294. Sun, Y., Wang, H., Liu, S., Peng, X., 2016. Exogenous application of hydrogen peroxide alleviates drought stress in cucumber seedlings. S. Afr. J. Bot. 106, 23–28. Tian, S.P., Qin, G.Z., Li, B.Q., 2013. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. Plant. Mol. Biol. 82, 593–602. Velardo-Micharet, B., Pintado, C.M., Dupille, E., Ayuso-Yuste, M.C., Lozano, M., BernalteGarcía, M.J., 2017. Effect of ripening stage, 1-MCP treatment and different temperature regimes on long term storage of ‘Songold’ Japanese plum. Sci. Hortic. 214, 233–241. Veltman, R.H., Lenthéric, I., Van der Plas, L.H.W., Peppelenbos, H.W., 2003. Internal browning in pear fruit (Pyrus communis L. cv Conference) may be a result of a limited availability of energy and antioxidants. Postharvest Biol. Technol. 28, 295–302. Wang, H., Qian, Z.J., Ma, S.M., Zhou, Y.C., Patrick, J.W., Duan, X.W., Jiang, Y.M., Qu, H.X., 2013. Energy status of ripening and postharvest senescent fruit of litchi (Litchi chinensis Sonn.). BMC Plant. Biol. 13, 55. Wang, Q., Ding, T., Zuo, J.H., Gao, L.P., Fan, L.L., 2016. Amelioration of postharvest chilling injury in sweet pepper by glycine betaine. Postharvest Biol. Technol. 112, 114–120. Wang, J.W., Zhou, X., Zhou, Q., Cheng, S.C., Wei, B.D., Ji, S.J., 2017a. Low temperature conditioning alleviates peel browning by modulating energy and lipid metabolisms of ‘Nanguo’ pears during shelf life after cold storage. Postharvest Biol. Technol. 131, 10–15. Wang, J.W., Zhou, X., Zhou, Q., Liu, Z.Y., Sheng, L., Cheng, S.C., Ji, S.J., 2017b. Proteomic analysis of peel browning of ‘Nanguo’ pears after low-temperature storage. J. Sci. Food Agric. 97, 2460–2467. Watkins, C.B., 2006. The use of 1-methylcyclopropene (1-MCP) on fruits and vegetables. Biotechnol. Adv. 24, 389–409. Yang, W.D., Li, J.K., Zhang, P., Zhang, P., 2010. Effects of slowly cooling treatment on browning regulation of ‘Nanguo’ pear during storage at low temperature. Stor. Proc. 2, 16–19. Yao, F.R., Huang, Z.H., Li, D.M., Wang, H., Xu, X.L., Jiang, Y.M., Qu, H.H., 2014. Phenolic components, antioxidant enzyme activities and anatomic structure of longan fruit pericarp following treatment with adenylate triphosphate. Sci. Hortic. 180, 6–13. Yi, C., Qu, H.X., Jiang, Y.M., Shi, J., Duan, X.W., Joyce, D.C., Li, Y.B., 2008. ATP-induced changes in energy status and membrane integrity of harvested litchi fruit and its relation to pathogen resistance. J. Phytopathol. 156, 365–371. Yi, C., Jiang, Y.M., Shi, J., Qu, H.X., Xue, S., Duan, X.W., Shi, J.Y., Prasad, N.K., 2010. ATP-regulation of antioxidant properties and phenolics in litchi fruit during browning and pathogen infection process. Food Chem. 118, 42–47. Yin, X.M., Liang, X., Zhang, R., Yu, L., Xu, G.H., Zhou, Q.S., Zhan, X.H., 2015. Impact of phenanthrene exposure on activities of nitrate reductase, phosphoenolpyruvate carboxylase, vacuolar H+-pyrophosphatase and plasma membrane H+-ATPase in roots of soybean, wheat and carrot. Environ. Exp. Bot. 113, 59–66. You, X.R., Zhang, Y.Y., Li, L., Li, Z.C., Li, M.J., Li, C.B., Zhu, J.H., Peng, H.X., Sun, J., 2014. Cloning and molecular characterization of phospholipase D (PLD) delta gene from longan (Dimocarpus longan Lour.). Mol. Biol. Rep. 41, 4351–4360. Zhai, R., Liu, J.L., Liu, F.X., Zhao, Y.X., Liu, L.L., Fang, C., Wang, H.B., Li, X.Y., Wang, Z.G., Ma, F.W., Xu, L.F., 2018. Melatonin limited ethylene production, softening and reduced physiology disorder in pear (Pyrus communis L.) fruit during senescence. Postharvest Biol. Technol. 139, 38–46. Zhang, L., Wang, J.W., Zhou, X., Shi, F., Fu, W.W., Ji, S.J., 2018. Effect of ATP treatment on enzymes involved in energy and lipid metabolisms accompany peel browning of ‘Nanguo’ pears during shelf life after low temperature storage. Sci. Hortic. 240, 446–452. Zhou, X., Dong, L., Zhou, Q., Wang, J.W., Chang, N., Liu, Z.Y., Ji, S.J., 2015. Effects of intermittent warming on aroma-related esters of 1-methylcyclopropene-treated ‘Nanguo’ pears during ripening at room temperature. Sci. Hortic. 185, 82–89. Zhu, L.Q., Zhou, J., Zhu, S.H., Guo, L.H., 2009. Inhibition of browning on the surface of peach slices by short-term exposure to nitric oxide and ascorbic acid. Food Chem. 114, 174–179.

Cheng, S.C., Wei, B.D., Zhou, Q., Tan, D.H., Ji, S.J., 2015. 1-methylcyclopropene alleviates chilling injury by regulating energy metabolism and fatty acid content in ‘Nanguo’ pears. Postharvest Biol. Technol. 109, 130–136. Chomkitichai, W., Chumyam, A., Rachtanapun, P., Uthaibutra, J., Saengnil, K., 2014. Reduction of reactive oxygen species production and membrane damage during storage of ‘Daw’ longan fruit by chlorine dioxide. Sci. Hortic. 170, 143–149. Dong, Y., Liu, L.Q., Zhao, Z., Zhi, H.H., Guan, J.F., 2015. Effects of 1-MCP on reactive oxygen species, polyphenol oxidase activity, and cellular ultra-structure of core tissue in ‘Yali’ Pear (Pyrus bretschneideri Rehd.) During storage. Hort. Environ. Biotechnol. 56, 207–215. Dou, H., Jones, S., Ritenour, M., 2005. Influence of 1-MCP application and concentration on post-harvest peel disorders and incidence of decay in citrus fruit. J. Hortic. Sci. Biotechnol. 80, 786–792. Du, L., Song, J., Palmer, L.C., Fillmore, S., Zhang, Z.Q., 2017. Quantitative proteomic changes in development of superficial scald disorder and its response to diphenylamine and 1-MCP treatments in apple fruit. Postharvest Biol. Technol. 123, 33–50. Establés-Ortiz, B., Romero, P., Ballester, A.R., González-Candelas, L., Lafuente, M.T., 2016. Inhibiting ethylene perception with 1-methylcyclopropene triggers molecular responses aimed to cope with cell toxicity and increased respiration in citrus fruits. Plant. Physiol. Bioch. 103, 154–166. Gao, H., Lu, Z.M., Yang, Y., Wang, D.N., Yang, T., Cao, M.M., Cao, W., 2018. Melatonin treatment reduces chilling injury in peach fruit through its regulation of membrane fatty acid contents and phenolic metabolism. Food Chem. 245, 659–666. Halusková, L., Valentovicová, K., Huttová, J., Mistrík, I., Tamás, L., 2009. Effect of abiotic stresses on glutathione peroxidase and glutathione S-transferase activity in barley root tips. Plant. Physiol. Biochem. 47, 1069–1074. He, X.M., Li, L., Sun, J., Li, C.B., Sheng, J.F., Zheng, F.J., Li, J.M., Liu, G.M., Ling, D.N., Tang, Y.Y., 2017. Adenylate quantitative method analyzing energy change in postharvest banana (Musa acuminate L.) fruits stored at different temperatures. Sci. Hortic. 219, 118–124. Huan, C., Jiang, L., An, X.J., Kang, R.Y., Yu, M.L., Ma, R.J., Yu, Z.F., 2016a. Potential role of glutathione peroxidase gene family in peach fruit ripening under combined postharvest treatment with heat and 1-MCP. Postharvest Biol. Technol. 111, 175–184. Huan, C., Jiang, L., An, X.J., Yu, M.L., Xu, Y., Ma, R.J., Yu, Z.F., 2016b. Potential role of reactive oxygen species and antioxidant genes in the regulation of peach fruit development and ripening. Plant. Physiol. Bioch. 104, 294–303. Huang, S.L., Li, T.T., Jiang, G.X., Xie, W.P., Chang, S.D., Jiang, Y.M., Duan, X.W., 2012. 1methylcyclopropene reduces chilling injury of harvested okra (Hibiscus esculentus L.). Pods. Sci. Hortic. 141, 42–46. Jin, P., Zhu, H., Wang, L., Shan, T., Zheng, Y.H., 2014. Oxalic acid alleviates chilling injury in peach fruit by regulating energy metabolism and fatty acid contents. Food Chem. 161, 87–93. Koh, C.S., Didierjean, C., Navrot, N., Panjikar, S., Mulliert, G., Rouhier, N., Jacquot, J.P., Aubry, A., Shawkataly, O., Corbier, C., 2007. Crystal structures of a poplar thioredoxin peroxidase that exhibits the structure of glutathione peroxidases: insights into redox-driven conformational changes. J. Mol. Biol. 370, 512–529. Kumar, S.K., Kayal, W.E., Sullivan, J.A., Paliyath, G., Jayasankar, S., 2018. Pre-harvest application of hexanal formulation enhances shelf life and quality of ‘Fantasia’ nectarines by regulating membrane and cell wall catabolism-associated genes. Sci. Hortic. 229, 117–124. Li, P.Y., Yin, F., Song, L.J., Zheng, X.L., 2016. Alleviation of chilling injury in tomato fruit by exogenous application of oxalic acid. Food Chem. 202, 125–132. Lin, Y.F., Chen, M.Y., Lin, H.T., Hung, Y.C., Lin, Y.X., Chen, Y.H., Wang, H., Shi, J., 2017a. DNP and ATP induced alteration in disease development of Phomopsis longanae Chiinoculated longan fruit by acting on energy status and reactive oxygen species production-scavenging system. Food Chem. 228, 497–505. Lin, Y.F., Lin, Y.X., Lin, H.T., Ritenour, M.A., Shi, J., Zhang, S., Chen, Y.H., Wang, H., 2017b. Hydrogen peroxide-induced pericarp browning of harvested longan fruit in association with energy metabolism. Food Chem. 225, 31–36. Lin, Y.F., Lin, Y.X., Lin, H.T., Chen, Y.Y., Wang, H., Shi, J., 2018. Application of propyl gallate alleviates pericarp browning in harvested longan fruit by modulating metabolisms of respiration and energy. Food Chem. 240, 863–869. Liu, H., Song, L.L., You, Y.L., Li, Y.B., Duan, X.W., Jiang, Y.M., Joyce, D.C., Ashraf, M., Lu, W.J., 2011. Cold storage duration affects litchi fruit quality, membrane permeability, enzyme activities and energy charge during shelf time at ambient temperature. Postharvest Biol. Technol. 60, 24–30. Liu, Z.L., Li, L., Luo, Z.S., Zeng, F.F., Jiang, L., Tang, K.C., 2016. Effect of brassinolide on energy status and proline metabolism in postharvest bamboo shoot during chilling stress. Postharvest Biol. Technol. 111, 240–246. Lum, G.B., Shelp, B.J., DeEll, J.R., Bozzo, G.G., 2016. Oxidative metabolism is associated with physiological disorders in fruits stored under multiple environmental stresses. Plant. Sci. 245, 143–152. Lurie, S., Watkins, C.B., 2012. Superficial scald, its etiology and control. Postharvest Biol. Technol. 65, 44–60. Mushtaq, M.N., Sunohara, Y., Matsumoto, H., 2013. Allelochemical l-DOPA induces quinoprotein adducts and inhibits NADH dehydrogenase activity and root growth of cucumber. Plant. Physiol. Bioch. 70, 374–378. Muzi, C., Camoni, L., Visconti, S., Aducci, P., 2016. Cold stress affects H+-ATPase and phospholipase D activity in Arabidopsis. Plant. Physiol. Bioch. 108, 328–336. Palma, F., Carvajal, F., Ramos, J.M., Jamilena, M., Garrido, D., 2015. Effect of putrescine application on maintenance of zucchini fruit quality during cold storage: contribution of GABA shunt and other related nitrogen metabolites. Postharvest Biol. Technol. 99, 131–140. Pan, Y.G., Yuan, M.Q., Zhang, W.M., Zhang, Z.K., 2017. Effect of low temperatures on chilling injury in relation to energy status in papaya fruit during storage. Postharvest Biol. Technol. 125, 181–187. Passaia, G., Fonini, L.S., Caverzan, A., Jardim-Messeder, D., Christoff, A.P., Gaeta, M.L.,

263