- Email: [email protected]
PFKL axis in hepatocellular carcinoma
Biomedicine & Pharmacotherapy 119 (2019) 109402
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
125
I suppressed the Warburg effect viaregulating miR-338/PFKL axis in hepatocellular carcinoma Jiaping Zheng, Jun Luo, Hui Zeng, Liwen Guo, Guoliang Shao
T
⁎
Department of Interventional Radiology, Institute of Cancer Research and Basic Medical Sciences of Chinese Academy of Sciences, Cancer Hospital of University of Chinese Academy of Sciences, Zhejiang Cancer Hospital, No. 1 Banshan East Road, Hangzhou 310022, Zhejiang, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Hepatocellular carcinoma Warburg effect 125 I miR-338/PFKL axis
Objectives: Iodine-125 (125I) irradiation has been widely applied in the treatment of advanced multiple malignant tumors. However, the underlying mechanism of 125I exerted an anti-tumor effect on hepatocellular carcinoma (HCC) was largely unknown. Methods: In both HCCLM3 and SMMC-7721 cells, the effect of 125I irradiation on the glycolysis was detected. The mRNA in HCC tissues and cell lines were detected by RT-qPCR. Cell proliferation, invasion and migration, and apoptosis were examined by CCK-8, Transwell, wound healing assay and flow cytometry assay, respectively. The interaction between miR-338 and PFKL (6-phosphofructokinase) were verified by dual-luciferase reporter gene assay. Western blotting was used to detect the expression of glycolysis-related proteins. We also evaluated the effect of 125I seed implantation on the tumor growth and Warburg effect in vivo. Results: 125I irradiation significantly decreased the Warburg effect, cell proliferation, invasion and migration, and induced apoptosis of HCCLM3 and SMMC-7721 cells. miR-338 was upregulated in HCC cells treated with 125 I irradiation, which was a negative correlation with tumor size, tumor metastasis, and tumor development. Moreover, miR-338 directly interacted with PFKL and suppressed its expression. Mechanistically, 125I irradiation significantly decreased the Warburg effect and exhibited anti-tumorigenesis function through upregulating the inhibitory effect of miR-338 on PFKL expression. Conclusion: 125I irradiation upregulated the suppression of miR-338 on PFKL to downregulate the Warburg effect and anti-tumorigenesis in HCC and provided a new potential strategy for HCC clinical treatment.
1. Introduction Hepatocellular carcinoma (HCC) with high incidence and mortality rates, is one of the most common malignancies. New HCC cases in China account for about 55% of the total new cases worldwide every year. Meanwhile, it is the second leading cause of cancer death in China [1,2]. Moreover, the early stage of HCC has no specific symptoms, most patients are advanced at diagnosis and progressed rapidly with poor prognosis [3]. With the development of diagnosis and treatment skill, the efficiency and survival time of HCC have been improved, but many patients still have a poor progression. Fortunately, 125I radioactive seed implantation has been widely used in the clinical treatment of various kinds of solid tumors and achieved good curative effect because of its low emission pollution and liability to protection, such as head and
neck, chest, abdominal, pelvic and soft tissue malignant tumors [4,5]. And 125I seed implantation can still be used for cases of failure or recurrence of radiotherapy [6]. However, the underlying mechanism of 125 I radioactive seeds in the treatment of HCC progression is still unclear. Metabolic reprogramming is a hallmark of malignant tumors. Previous studies have reported that they could induce cancer cells to tolerate apoptosis, promote tumor invasion and metastasis, and mediate radiotherapy and chemotherapy resistance [7–9]. Interestingly, cancer cells preferentially utilize glucose by glycolysis rather than oxidative phosphorylation even under aerobic conditions, a common phenomenon known as “Warburg effect”. But whether the metabolic reprogramming such as Warburg effect, was involved in 125I treated HCC cells remains elusive. Moreover, accumulating evidence confirmed that
Abbreviations: CCK-8, cell counting kit-8; D90, 90% of the target volume; DCR, disease control rate; ECAR, extracellular acidification rate; GLUT1, glucose transporter of erythrocytes; HCC, hepatocellular carcinoma; HK2, hexokinase 2; 125I, Iodine-125; IC50, half maximal inhibitory concentration; OCR, oxygen consumption rate; PFA, paraformaldehyde; PFKL, 6-phosphofructokinase; PVDF, polyvinylidene fluoride ⁎ Corresponding author at: Department of Interventional Radiology, Zhejiang Cancer Hospital, No. 1 Banshan East Road, Hangzhou 310022, Zhejiang, China. E-mail addresses: [email protected] (J. Zheng), [email protected] (J. Luo), [email protected] (H. Zeng), [email protected] (L. Guo), [email protected] (G. Shao). https://doi.org/10.1016/j.biopha.2019.109402 Received 19 June 2019; Received in revised form 20 August 2019; Accepted 28 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Opti-MEM medium (Invitrogen Life Technologies, USA) in the light of the specification. The pcDNA-PFKL, miR-338 mimics/inhibitor and control (blank plasmid) were bought from Tolo Biotech (Shanghai, China).
inhibition of glycolysis was contributed to enhancing the inhibitory effect of radiotherapy on proliferation, invasion, and migration of cancer cells [10–12]. For example, Allen et al. found that X-ray treatment inhibited cell growth and induced apoptosis of lung cancer cells through downregulating Warburg effect [13]. Meanwhile, some studies have shown that the activation of a key enzyme in glycolysis was closely related to tumor progression, radiotherapy and chemotherapy resistance, such as hexokinase 2 (HK2), 6-phosphofructo-1-kinase (PFK1), glucose transporter of erythrocytes (GLUT1), pyruvate kinase M2 (PKM2) [14,15]. For example, Huang et al. showed that CD147 enhanced reprogramming of glucose metabolism and proliferation of HCC cells by upregulating PFKL [16]. However, 125I mediated HCC cells proliferation, invasion, migration, and apoptosis through regulating Warburg effect were remained obscure. Increasing evidence confirmed that 125I seed implantation inhibited the tumor growth and metastasis through regulating miRNAs [17]. For example, miR-338, a tumor suppressor gene, was upregulated in multiple malignant tumors when treated with radiotherapy [18,19]. Moreover, miR-338 targets a key enzyme in glycolysis to regulate the progression of HCC. For instance, miR-338-elevated inhibited the Warburg effect and the progression of HCC viatargeting PFLR expression [20]. Furthermore, the bioinformatic database showed that PFKL was one of the targeting genes of miR-338, but little studies confirmed the role of the miR-338/PFKL axis in HCC cells energy metabolism by treatment with 125I so far. In this study, the effect of 125I irradiation on the Warburg effect in HCC cells were investigated. The expression of miR-338 and PFKL in HCC tissues or cell lines and the targeted relationship between miR-338 and PFKL were determined, which could regulate the malignant biological behavior of HCC cells treated with 125I in vitro. Taken together, our study may provide vital theoretical evidence for explaining the role of the miR-338/PFKL axis in the glycolysis switch of HCC treated with 125 I in vitro and in vivo, and at the same time will provide a new biomarker for energy metabolism of HCC development.
2.3. HCCLM3 and SMMC-721 cells treated with
125
I irradiation
125
I seeds were provided by Beijing Zhongke Zhibo Medical Devices Co., Ltd. (Beijing, China). 125I seeds were seeded into an in vitroirradiation model, based on a previous paper [17]. The HCCLM3 and SMMC-721 cells were treated with 125I irradiation at a dose of 0, 2, 4, 6, 8 Gy, respectively. 2.4. RT-qPCR Total RNA was isolated from cultured tissues and cells with TRIzol reagent (QIAGEN, Germany) and reverse-transcribed into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Japan). RT-qPCR Master Mix (TaKaRa, Japan), the sequence of quantitative PCR primers of miRNAs, PFKL, β-actin and U6 were purchased from Shanghai GenePharma Co., Ltd (Shanghai, China), U6 and β-actin as the internal control. The primers used were shown in Table 1. The 2−ΔΔCt methods were applied to calculate the relative expression levels of miRNAs (miR-338, miR-205, miR-448, miR-29b, miR-365 and miR-370) and PFKL. The experiment for each group was repeated three times. 2.5. CCK-8 assay Cell counting kit-8 (CCK-8, Sigma, Japan) was used to detect the proliferation of HCCLM3 and SMMC-7721 cells. Cells were seeded in 96-well plates at 1 × 104 cells per well and treated with 125I at a different dose. Then, cells were cultured in 5% CO2 at 37 °C incubator for 2 h to adhere cells. After that, added 10 μL of the cell proliferation reagent CCK-8 to each well and mixed then incubated for 2 h in the incubator. Finally, the absorbance of cells was measured at 450 nm using a microplate reader (Beckman Coulter, USA). Each experiment was set up with three parallel repeats.
2. Materials and methods 2.1. Tissue or serum samples In this study, we collected two sets of clinical HCC patients’ samples. Firstly, a total of 35 HCC patients’ tissues and adjacent tissues were collected for this study. Secondly, Serum samples from 65 patients with hepatocellular carcinoma treated with 125I seed implantation and 25 patients without any treatment were collected. This study was approved by the Ethical Committee of Zhejiang Cancer Hospital and complied with the guidelines and principles of the Declaration of Helsinki. All participants signed written informed consent. Meanwhile, these samples were frozen in liquid nitrogen immediately and stored at −80 °C for subsequent experiments.
2.6. Colony formation assay The 0.25% Trypsin/0.02% EDTA solution was used to digest the HCCLM3 and SMMC-7721 cells at logarithmic phase. The HCCLM3 and SMMC-7721 cells density were 5 × 103 inoculated in six-well culture plates, and the culture medium was replaced every three days. Table 1 primer sequences for RT-qPCR.
2.2. Cell culture and transfection
Primer
Sequences (5’–3’)
U6
Forward: ACAGGCATCGTGATGGATTCT Reverse: CAGCAGTGGTGGTGAAGTTAT Forward: CATGTACGTTGCTATCCAGGC Reverse: CTCCTTAATGTCACGCACGAT Forward: CATCAGCAACAACGTCCCTG Reverse: GGCCAGGTAGCCACAGTAAC Forward: AACCGGTCCAGCATCAGTGATT Reverse: CAGTGCAGGGTCCGAGGT Forward: CCTCCCTAAATCCTCCATCC Reverse: TCTAGGAAGGACAGCCTCCA Forward: TTATTGCGATGTGTTCCTTATG Reverse: ATGCATGCCACGGGCATATACACT Forward: TGCGGTAGCACCATTTGAAAT Reverse: CCAGTGCAGGGTCCGAGGT Forward: CGTAATGCCCCTAAAAAT Reverse: GTGCAGGGTCCGAGGT Forward: GCCGAATTCTTGAACTAATTCAT Reverse: GCCGGATCCCGTCTCTGTGCCTG
β-actin
HCC cell lines (HepG2, MHCC97H, HCCLM3, and SMMC-7721), human hepatic epithelial cell line (THLE-3) and human embryonic kidney cell line HEK293T were purchased from the Shanghai Institutes for Biological Sciences of the Chinese Academy of Sciences. These cells were cultured in 10% fetal bovine serum (Hyclone, Logan, USA) and 1% PS (100 units/mL penicillin and 100 mg/mL streptomycin, Thermo Fisher Scientific, Shanghai, China) medium with GlutaMAX (DMEM, Gibco BRL, USA). Cells were habitually passaged every 3–4 days, incubated in an incubator with 5% CO2 at 37 °C. 24 h before transfection, HCCLM3 and SMMC-7721 cells were seeded in six-well plates with optimum density and then incubated overnight. miR-338 mimics/inhibitor, pcDNA-PFKL and blank plasmid were transfected into HCCLM3 and SMMC-7721 cells with Lipofectamine 3000 reagent (Invitrogen Life Technologies, USA) and
PFKL miR-338 miR-205 miR-448 miR-29b miR-365 miR-370
2
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
time points; and for OCR, oligomycin, the reversible inhibitor of oxidative phosphorylation FCCP (p-trifluoromethoxy carbonyl cyanide phenylhydrazone), and the mitochondrial complex I inhibitor rotenone plus the mitochondrial complex III inhibitor antimycin A (Rote/AA) were sequentially injected. Data obtained were analyzed by Seahorse XF Wave software.
Subsequently, methanol was used to immobilized cells, when HCCLM3 and SMMC-7721 cells were incubated for 14 days and stained with 0.5% crystal violet. Finally, Nikon Eclipse E600 microscope (Nikon Instruments, USA) was used to count visible colonies in randomly selected fields. The HCCLM3 and SMMC-7721 cells clone formation rate were calculated according to the following equation: cell clone formation rate = clone counts/seeded cell counts × 100%.
2.12. Western blotting 2.7. Flow cytometry analysis After transfection or 125I irritation, both HCC cells were washed with PBS, centrifuged at 800 × g for 6 min, suspended in ice-cold 70% ethanol/PBS, centrifuged at 800 × g for another 6 min, and suspended with PBS. Resuspended cells with 100 μL medium and added 5 μL of Annexin V and 1 μL of propidium iodide according to the manufacturer’s instructions of Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (#V13241, Thermo Fisher, USA), and incubated for 15 min at room temperature. The treated cells were analyzed using flow cytometry. Cell Quest Pro Software (BD Biosciences) was used to evaluate the cellular apoptosis.
Total protein was extracted for western blotting analysis. The PVDF (polyvinylidene fluoride) was incubated overnight at 4 °C with the primary rabbit anti-human PFKL (1:1000 dilution, #ab37583, Abcam, Cambridge, UK), HK2 (1:1000 dilution, #ab209847, Abcam, Cambridge, UK), PKM2 (1:500 dilution, #ab137852, Abcam, Cambridge, UK), GLUT1 (1:200 dilution, #ab652, Abcam, Cambridge, UK) and LDHA (1:1000 dilution, #ab101562, Abcam, Cambridge, UK), mouse anti-human β-actin (1:1000, #ab115777, Abcam, Cambridge, UK), and then with horseradish peroxidase-coupled secondary antibody (Abcam, Cambridge, UK). Signa was detected with chemiluminescence using an ECL kit (Bio-Rad, USA).
2.8. Transwell invasion assay
2.13. Dual-luciferase reporter gene assay
Briefly, 24-well Transwell plates (Corning, USA) were used for cell invasion assay. The upper chamber is pre-treated with 100 μL of Matrigel, the wells were pretreated with Matrigel (BD Biosciences, USA), and HCC cells (1 × 105 cells) in FBS free medium were seeded to the upper chamber. The lower chamber contained DMEM supplemented with 10% FBS. After that, the cells were incubated at 37 °C for 24 h. Moreover, the invasive cells were fixed with 4% paraformaldehyde and rinsed three times with PBS, then stained with 0.1% crystal violet for 10 min and rinsed three times with PBS. Random selection 5 fields of vision for cell count, observation and photography.
The cells were seeded in 24-well plates at a density of 60%. According to the manufacturer’s instructions, the reporter construct containing PFKL wild-type or mutant 3’UTR was co-transfected into cells with miR-338 using Lipofectamine 3000 reagent. After 48 h, the cells were collected and tested for luciferase by dual-luciferase assay system (Promega, USA). 2.14. Nude mice model Female BALB/c nude mice (4–5 weeks old) were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The model was approved by the Ethical Committee of Zhejiang cancer hospital. HCCLM3 and SMMC-7721 cells (1 × 107) were suspended in serum-free DMEM medium and then inoculated in (10 mice in each group) at 6–7 weeks old. After the successful construction of nude mice transplant tumor model, therapy group with a dose of 40 Gy through 125I seed with radioactivity of 0.6 mCi was implanted into the xenograft center of nude mice using an 18-Gauge implant needle. The control group contained no particles. Tumor growth was recorded every three days by measuring tumor length and width. After 4 weeks incubation, the mice were killed and the mice tumor tissues to be collected for further evaluated.
2.9. Wound healing assay HCCLM3 and SMMC-7721 cells (1 × 106 cells/well) were treated with different reagents, seeded in 6-well plates and cultured until they reached confluence. Wounds were made in the cell monolayer by making a scratch with a 20 μL pipette tip. Plates were washed once with fresh medium after 24 h in culture to remove non-adherent cells. Following this wash, plates were photographed. 2.10. Glucose consumption, lactate production and ATP generation assay The expression of glucose consumption, lactate production and ATP generation in supernatants of HCCLM3 and SMMC-7721 cells were evaluated using commercial assay kit (Glucose uptake colorimetric assay kit (#K924), Lactate colorimetric assay kit II (#K627), ATP colorimetric assay kit (#k345), BioVision, Milpitas, CA, USA) according to the manufacturer's protocol. For glucose consumption, after cells seeded, 100 mL Krebs-Ringer-Phosphate-HEPES buffer containing 2% BSA was added for 40 min, and then 10 mM 2-DG was added. For lactate and ATP assays, cells were homogenized in corresponding assay buffer offered by the kits and centrifuged at 4 °C.
2.15. Immunohistochemistry assay The xenograft tissues were collected and fixed with formalin neutral solution of 10% volume fraction, paraffin-embedded and then sectioned. Subsequently, the DAB horseradish peroxidase color development Kit (Beyotime, China) was applied to conjugated Ki-67 antibody (1:2000, #ab21700, Abcam, Cambridge, UK) staining at room temperature. The slides were dyed with hematoxylin for 30 s, dehydrated and fixed, and then sealed with neutral glue. In addition, all stained images were observed and photographed with a fluorescence microscope (Olympus, Japan).
2.11. Extracellular acidification and oxygen consumption rate assay Extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were real-time determined using Seahorse Bioscience XF extracellular flux analyzer (Seahorse Bioscience, North Billerica, MA, USA). And experiments were detected according to the manufacturer's protocol. Briefly, 1 × 104 cells/well was plated in a Seahorse XF cell culture microplate. After baseline measurements, for ECAR, glucose, the oxidative phosphorylation inhibitor oligomycin, and the glycolytic inhibitor 2-DG were sequentially injected into each well at indicated
2.16. Statistical analysis The experimental data and image preprocessing were analyzed by SPSS 20.0 statistical software (IBM, USA) and GraphPad Prism8.0 software (La Jolla, USA), respectively. Besides, student’s t-test was used to analyze the significant different between the two groups, and the different between multiple groups were compared by one-way ANOVA. Moreover, P < 0.05 or P < 0.01 was identified as statistically 3
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 1. 125I irradiation decreased the Warburg effect in HCC cells. A: CCK-8 was used to detect the cell viability in both HCCLM3 and SMMC-7721 cells; B: The glucose consumption in the supernatant was detected by glucose assay kit; C: The lactate production in supernatant was measured by lactate assay kit; D: The ATP generation in the supernatant was detected by ATP colorimetric assay kit. **P < 0.01, compared with the control group.
in xenograft tumor tissues (both P < 0.01, Fig. 2F, G). Besides, 125I therapy notably suppressed the lactate production in tumor masses (both P < 0.01, Fig. 2H). The above findings revealed that 125I irradiation significantly suppressed the proliferation, invasion, migration and induced apoptosis of HCC cells.
significant. 3. Results 3.1.
125
I irradiation decreased the Warburg effect in HCC cells
To explore the effect of 125I irradiation on the Warburg effect, the expression levels of glucose consumption, lactate production, and ATP biosynthesis were detected in both HCC cells (HCCLM3 and SMMC7721). CCK-8 assay results showed that 125I irradiation significantly decreased the viability of HCCLM3 and SMMC-7721 cells in a dosedependent manner (Fig. 1A). Meanwhile, the value of IC50 of 125Itreated HCC cells was respectively reached 4.387 and 3.861 Gy, and the dose of 4 Gy of 125I irradiation was chosen for the follow-up experiments. Moreover, the glucose consumption, lactate production, and ATP generation notably decreased in HCCLM3 and SMMC-7721 cells treated with 125I irradiation compared with the control group (all P < 0.01, Fig. 1B–D). Taken together, 125I-treated HCC cells with a dose of 4 Gy was downregulated the Warburg effect.
3.3. miR-338 downregulated in the
125
I-treated HCC cells
Previous studies confirmed that miRNA plays an important role in the malignant tumor cells treated with radiation including HCC [21–24]. To examine the expression levels of a screening of six miRNAs, which play an important role in regulating radiotherapy of HCC, in HCCLM3 and SMMC-7721 cells treated with 125I irradiation. RT-qPCR analysis results showed that six candidate pro-radiosensitivity miRNAs (miR-338, miR-205, miR-448, miR-29b, miR-365 and miR-370) was upregulated in 125I-treated cells, while miR-338 was the highest expressed in both HCC cells (P < 0.001, Fig. 3A). Moreover, we assessed the expression of miR-338 in HCC tissues and cell lines. The results revealed that miR-338 was downregulated in HCC tissues (n = 35) compared with corresponding noncancerous liver (CNL) tissues (n = 35) (P < 0.01, Fig. 3B). Similarly, the expression of miR-338 in HCC cell lines was lower than that in a human hepatic epithelial cell line (THLE-3) (P < 0.01, Fig. 3C). Collectively, these results suggest that the aberrant expression of miR-338 was associated with the progression of HCC and 125I irradiation, but its mechanism is still unclear.
3.2. 125I irradiation reduced the malignant biological behavior of HCC cells and xenograft tumor growth in vivo To investigate the effect of 125I irradiation on the proliferation, invasion, migration, and apoptosis of HCC cells. Colony formation assay demonstrated that the proliferation capacity of HCCLM3 and SMMC7721 cells treated 125I irradiation at 4 Gy were significantly decreased compared with the control group (all P < 0.01, Fig. 2A). Transwell assays and wound healing assay showed that 125I treatment markedly suppressed invasion and migration abilities of HCCLM3 and SMMC7721 cells compared with the control group (all P < 0.01, Fig. 2B, C). In addition, the Annexin V-FITC/PI double staining assay analyze results showed that 125I treatment was contributed to inducing apoptosis of HCCLM3 and SMMC-7721 cells (all P < 0.01, Fig. 2D). Furthermore, to explore the effect of 125I therapy on tumor growth and glycolysis in vivo. The results showed that the tumor volume and tumor weight of nude mice treated with 125I irradiation noticeably inhibited compared with the untreated group (Fig. 2E). Immunohistochemistry results demonstrated that 125I therapy decreased the expression of Ki-67
3.4. 125I irradiation decreased the Warburg effect through upregulating miR-338 expression To further examine whether upregulation of miR-338 was regulated the Warburg effect in HCCLM3 and SMMC-7721 cells treated with 125I irradiation at a dose of 4 Gy. The RT-qPCR results showed that both HCCLM3 and SMMC-7721 cells transfected with miR-338 mimics significantly enhanced the expression of miR-338 compared with NC group (all P < 0.001, Fig. 4A), while transfected with miR-338 inhibitor was decreased its expression (all P < 0.01, Fig. 4A). Moreover, miR-338-elevated or 125I irradiation markedly decreased the level of glucose consumption, lactate production and ATP generation (all P < 0.01, Fig. 4B–D). Of note, HCCLM3 and SMMC-7721 cells treated 4
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 2. 125I irradiation reduced the malignant biological behavior of HCC cells and Xenograft tumor growthin vivo. A: Colony formation assay was applied to detect cell proliferation capacity of HCCLM3 and SMMC-7721 cells; B: The number of invasion cell was detected by Transwell assay. C: Wound healing assay was used to evaluate the migration ability of HCCLM3 and SMMC-7721 cells; D: The percentage of apoptotic cell was measured by flow cytometry; E: The tumor size was obtained from nude mice, the tumor weight and tumor volume curve of nude mice treated with 125I therapy or untreated (control) were analyzed; F and G: The expression of Ki-67 was detected in tumor tissues by immunohistochemistry; H: The expression of lactate production in tumor tissues. *P < 0.05, **P < 0.01, ***P < 0.001, compared with control group. 5
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 3. miR-338 downregulated in the 125Itreated HCC cells. A: RT-qPCR was applied to detect the miRNAs expression; B and C: RT-qPCR was used to measure the expression of miR-338 in HCC tissues and cell lines. *P < 0.05, **P < 0.01, ***P < 0.001, compared with control group; ## P < 0.01, compared with CNL group; △ P < 0.05, △△P < 0.01, compared with THLE-3 cells.
with 125I after transfecting miR-338 inhibitor was downregulated the inhibitory effect of 125I irradiation on the Warburg effect (Fig. 4B–D). Furthermore, to further assess the effect of 125I-miR-338 on ECAR, which reflects overall glycolytic flux, as well as OCR, which an indicator of mitochondrial respiration, were evaluated by Seahorse XF extracellular flux analyzer. The results showed that upregulation of miR-338 or treatment with 125I significantly decreased the rate of glycolysis and glycolytic capacity of HCCLM3 and SMMC-7721 cells (all P < 0.01, Fig. 4E, F), while knockdown of miR-338 was rescued these effects. Taken together, these results confirmed that 125I irradiation decreased the Warburg effect viaupregulating miR-338 in HCCLM3 and SMMC-7721 cells.
Fig. 5E). In conclusion, these results suggested that PFKL was the direct target of miR-338 which was negatively regulated PFKL expression.
3.6. 125I therapy suppressed the Warburg effect by regulating miR-338/ PFKL axis To further determine the underlying mechanism by which 125I irradiation exerted anti-Warburg effect and decreased the malignant biological behavior of HCCLM3 and SMMC-7721 cells viaregulating miR-338/PFKL axis. Western blotting results showed that the expression of PFKL protein was significantly enhanced in HCCLM3 and SMMC-7721 cells transfected with pcDNA-PFKL compared with the NC group (all P < 0.01, Fig. 6A). However, co-transfected miR-338 mimics and pcDNA-PFKL was downregulated the level of PFKL protein (all P < 0.01, Fig. 6A). Moreover, the expression of glucose consumption, lactate production and ATP generation were increased in HCCLM3 and SMMC-7721 cells treated with 125I after transfecting with pcDNA-PFKL compared with only 125I treatment group (all P < 0.01, Fig. 6B–D). Whereas, there was no significant difference between 125I treatment group and miR-338+PFKL+125I group (Fig. 6B–D). In addition, overexpression of PFKL downregulated the inhibitory effect of 125I-treated on the proliferation, invasion, and migration of HCCLM3 and SMMC7721 cells (all P < 0.01, Fig. 6E–G). However, the upregulation effect of PFKL on the malignant biological behavior of HCCLM3 and SMMC7721 cells were reversed by co-transfecting with miR-338 mimics (Fig. 6E–G). Meanwhile, upregulation of PFKL decreased the 125I-induced apoptosis of HCCLM3 and SMMC-7721 cells (all P < 0.01, Fig. 6H). In contrast, co-transfected with miR-338 mimics and pcDNAPFKL was contributed to increasing 125I-induced the percentage of apoptotic cells (P < 0.01, Fig. 6H). These results suggested that 125I irradiation was suppressed the Warburg effect and malignant biological behavior of HCCLM3 and SMMC-7721 cells through mediating miR338/PFKL axis.
3.5. miR-338 directly targeted PFKL in HCC cells To further understand the mechanism underlying the effect of miR338 on the Warburg effect, we examined the expression levels of glycolysis-related proteins (HK2, PFKL, PKM2, GLUT1 and LDHA) in HCC cells transfected with miR-338 mimics. Western blotting results revealed that overexpression of miR-338 significantly decreased the expression of PFKL and GLUT1 proteins compared with NC group (all P < 0.01, Fig. 5A, B), but the expression of HK2, PKM2 and LDHA remained unchanged. In addition, we discovered that miR-338 may target PFKL directly from the starBase database (http://starbase.sysu. edu.cn/) (Fig. 5C). To further confirm that miR-338 was specifically binding to the 3’UTR region of PFKL mRNA to regulate the expression of PFKL by dual-luciferase reporter gene assay. The results showed that luciferase activity in PFKL-WT + miR-338 mimics group was lower than PFKL-WT + miR-NC group (P < 0.01, Fig. 5D), but there was no significant difference exist between miR-338 mimics or NC was transferred in the PFKL-MUT group (P > 0.05, Fig. 5D). At the same time, we used western blotting to test the expression level of PFKL when miR338 mimics was transfected into HCCLM3 and SMMC-7721 cells. The analysis results pointed out that overexpression of miR-338 significantly decreased the expression of PFKL protein (all P < 0.01, 6
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 4. 125I irradiation decreased the Warburg effect through upregulating miR-338 expression. A: The expression of miR-338 was detected by RT-qPCR; B: The glucose consumption in supernatant was detected by glucose assay kit; C: The lactate production in supernatant was measured by lactate assay kit; D: The ATP generation in supernatant was detected by ATP colorimetric assay kit; E and F: The extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were determined in HCCLM3 and SMMC-7721 cells. **P < 0.01, compared with NC group; ## P < 0.01, compared with the control group.
7
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 5. miR-338 directly targeted PFKL in HCC cells. A and B: Western blotting was used to detect the expression of HK2, PFKL, PKM2, GLUT1 and LDHA in HCCLM3 and SMMC-7721 cells; C: The bioinformatics analysis results showed that miR-338 had a binding site with PFKL; D: Dual-luciferase reporter gene assay was applied to verify the targeted relationship between miR-338 and PFKL; E: Western blotting was used to detect the expression of PFKL in HCCLM3 and SMMC-7721 cells. **P < 0.01, ***P < 0.001, compared with NC group.
with 125I (R2 = −0.516, P = 0.003, Fig. 7C). Thus, these data showed that 125I therapy promoted the inhibitory effect of miR-338 on PFKL expression may be beneficial to suppress the progression of HCC patients with this condition.
3.7. Correlation between the miR-338/PFKL axis and HCC progression in clinical patients The effect of the miR-338/PFKL axis on the prognosis of HCC patients treated with 125I seed implantation was further investigated. By comparing clinicopathological characteristics, disease control rate (DCR) of HCC patients treated with 125I seed implantation was significantly correlated with tumor size (P = 0.006), metastasis (P = 0.000), and dose received by 90% of the target volume (D90, P = 0.000) (Table 2). Besides, RT-qPCR results showed that miR-338 was upregulated in plasma of 125I seed implantation into HCC patients compared with the untreated group (P < 0.01, Fig. 7A), while decreased the mRNA expression of PFKL (P < 0.001, Fig. 7B). Moreover, Spearman's correlation analysis revealed that the expression of miR-338 was inversely correlated with PFKL expression in plasma of HCC treated
4. Discussion Multiple malignant tumors are threatening to the safety of our life and will damage our life over a long period of time. In this study, we discussed the molecular mechanism of 125I irradiation on the malignant biological behavior of HCC cells by regulating the Warburg effect. The glucose metabolism, cell proliferation, invasion and migration were inhibited in HCCLM3 and SMMC-7721 cells treated with 125I irradiation at a dose of 4 Gy, but enhanced the expression of miR-338. Moreover, miR-338-elevated significantly decreased the Warburg effect and 8
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 6. 125I therapy suppressed the Warburg effect by regulating miR-338/PFKL axis. A: Western blotting was used to detect the expression of PFKL; B: The glucose consumption in supernatant was detected by glucose assay kit; C: The lactate production in supernatant was measured by lactate assay kit; D: The ATP generation in supernatant was detected by ATP colorimetric assay kit; E: colony formation assay was applied to detect cell proliferation capacity of HCCLM3 and SMMC-7721 cells; F The number of invasion cell was detected by Transwell assay. G: Wound healing assay was used to evaluate the migration ability of HCCLM3 and SMMC-7721 cells; H: The percentage of apoptotic cell was measured by flow cytometry. △△P < 0.01, compared with PFKL overexpression group; **P < 0.01, compared with the control group; ##P < 0.01, compared with 125I irradiation group; ▲▲P < 0.01, compared with 125I irradiation + PFKL group.
growth and metastasis of HCC cells by targeting PFKL, which was induced by 125I irradiation. Besides, we found that the expression of miR338 was downregulated in HCC tissues and cell lines. Hence, 125I
irradiation significantly suppressed the HCC glycolysis and progression by regulating miR-338/PFKL axis and provided a new tool for target treatment of HCC patients. 9
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
acts as a tumor suppressor gene, was enhanced the radiosensitivity of malignant cancer cells by targeting 3’UTR of mRNA in human solid tumors, including esophageal squamous cell carcinoma [18], and glioblastoma [30]. Besides, the expression of miR-338 was upregulated in multiple tumors such as lung cancer [31], ovarian cancer [32], prostate cancer [33] and HCC [34]. In this study, we demonstrated that miR-338 was downregulated in HCC tissues compared with adjacent tissues. Moreover, previous studies found that miR-338 was a key regulator of energy metabolism [35,36]. For example, Nie et al. reported that miR-338 targets PKLR to decrease HCC progression by mediating the Warburg effect [20]. Our further in vitro and in vivo functional studies revealed that 125I irradiation suppressed the glucose metabolism and growth and metastasis of HCC cells by upregulating the inhibitory effect of miR-338 on PFKL expression. In addition, PFKL, which acts as a key player in glycolysis, was upregulated in cancer cells to promote cell proliferation and metastasis through activating Warburg effect [16,37,38]. Taken together, miR-338/PFKL axis plays an important in regulating glycolysis and the progression of HCC cells treated with 125I irradiation.
Table 2 Clinicopathological characteristics. Clinical feature
Gender Male Female Age ≤60 > 60 Tumor size (cm) ≤5 >5 125 I seed numbers ≤50 > 50 125 I distribution method Paris method Monte Carlo method Metastasis Lung Bone Lymphatic No D90 dose < 110 Gy ≥110 Gy
Number
DCR
65
54
60 5
49(81.67%) 5(100%)
44 21
36(81.82%) 18(85.71%)
54 11
48(88.89%) 6(54.55%)
51 14
45(88.24%) 9(64.29%)
29 36
22(75.86%) 32(88.89%)
28 16 13 8
23(82.14%) 14(87.50%) 9(69.23%) 8(100%)
P value
0.294
0.695
0.006
0.189
0.467
0.000
5. Conclusions 0.000
12 53
2(16.67%) 52(98.11%)
This study confirmed that miR-338 was downregulated in HCC tissues and cell lines and plays an important role in 125I-treated changes in glycolysis, proliferation, invasion and migration, and apoptosis of HCC cells by targeting PFKL. Moreover, our studies will provide insight into the molecular mechanism of glucose metabolism switch during HCC pathogenesis and open a new strategy for HCC treatment.
DCR: disease control rate; D90: dose received by 90% of the target volume.
Malignant tumor metabolism studies have shown that cancer cells could reprogram energy metabolism, including aerobic glycolysis, glutamine metabolic disorders, lipid synthesis and oxidative changes. Abnormal energy metabolism of cancer cells can cause malignant biological behavior, including rapid proliferation, anti-apoptotic, epithelial-mesenchymal transition, metastasis, angiogenesis, immune escape, radiotherapy resistance and chemotherapy resistance [25]. Warburg effect is an important manifestation of malignant tumor reprogramming energy metabolism and plays an important role in tumor growth, metastasis and recurrence [26,27]. For example, de Souza et al. confirmed that radiation therapy inhibited the progression of oral squamous cell carcinoma through downregulating Warburg effect [28]. Another study showed that X-ray irradiation significantly inhibited the viability of A549 and H1299 cells by altering Warburg effect [13]. A recent study reveals that 125I seed implantation reduced tumor growth viadecreasing Warburg effect in xenograft model of non-small cell lung cancer [29]. Our finding here confirmed that the cell viability, invasion, and migration, and glucose metabolism were decreased in HCC cells treated with 125I irradiation at a dose of 4 Gy. These data suggested that inhibition of the Warburg effect was contributed to enhancing the sensitivity of HCC cells to 125I, but its mechanism has yet been unclear. Increasing evidence suggested that miRNAs play an important role in biological behavior of cancer cells treated with radiotherapy, and they may serve as oncogenes or anti-oncogenes. For example, miR-338,
Funding This study was supported by the General Medicine and Health Funding Project of Zhejiang [grant number 2013KYB041]; General Medicine and Health Funding Project of Zhejiang [grant number 2016KYA043]; Funding for Cultivation of High-level Innovation Health Talents of Zhejiang [grant number 2012-241]. Authors’ contribution GS was the principal investigator; GS and JZ were involved in the formulation of the research hypotheses and study design, as well as data interpretation; JZ, JL, and HZ performed the experiments; HZ carried out the Western blotting analysis and proliferation assays; JL performed the migration and invasion assays; JL performed the Annexin V experiments; JZ, LG, and JL performed statistical and graphical analyses; JZ wrote the manuscript. All authors read and approved the final manuscript. Ethics approval and consent to participate This study was approved by the Ethics Committee of Zhejiang
Fig. 7. Correlation between miR-338/PFKL axis and HCC progression in clinical patients. A and B: RT-qPCR was used to detect the mRNA expression of miR-338 and PFKL in HCC tissues; C: The expression relationship between miR-338 and PFKL was evaluated by Spearman’s correlation analysis. **P < 0.01, ***P < 0.001, compared with the untreated group. 10
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Cancer Hospital (NO. IRB2015230).
[18] M. Park, H.J. Yoon, M.C. Kang, J. Kwon, H.W. Lee, MiR-338-5p enhances the radiosensitivity of esophageal squamous cell carcinoma by inducing apoptosis through targeting survivin, Sci. Rep. 7 (2017) 10932, https://doi.org/10.1038/ s41598-017-10977-9. [19] X. Liu, H. Cai, W. Sheng, H. Huang, Z. Long, Y. Wang, microRNAs expression profile related with response to preoperative radiochemotherapy in patients with locally advanced gastric cancer, BMC Cancer 18 (2018) 1048, https://doi.org/10.1186/ s12885-018-4967-4. [20] H. Nie, J. Li, X.M. Yang, Q.Z. Cao, M.X. Feng, F. Xue, L. Wei, W. Qin, J. Gu, Q. Xia, Z.G. Zhang, Mineralocorticoid receptor suppresses cancer progression and the Warburg effect by modulating the miR-338-3p-PKLR axis in hepatocellular carcinoma, Hepatology 62 (2015) 1145–1159, https://doi.org/10.1002/hep.27940. [21] R. Dutta, R.I. Mahato, Recent advances in hepatocellular carcinoma therapy, Pharmacol. Ther. 173 (2017) 106–117, https://doi.org/10.1016/j.pharmthera. 2017.02.010. [22] H. Li, X. Jin, B. Chen, P. Li, Q. Li, Autophagy-regulating microRNAs: potential targets for improving radiotherapy, J. Cancer Res. Clin. Oncol. 144 (2018) 1623–1634, https://doi.org/10.1007/s00432-018-2675-8. [23] B. Tomasik, J. Chalubinska-Fendler, D. Chowdhury, W. Fendler, Potential of serum microRNAs as biomarkers of radiation injury and tools for individualization of radiotherapy, Transl. Res. 201 (2018) 71–83, https://doi.org/10.1016/j.trsl.2018. 06.001. [24] Y. Shao, X. Song, W. Jiang, Y. Chen, Z. Ning, W. Gu, J. Jiang, MicroRNA-621 acts as a tumor radiosensitizer by directly targeting SETDB1 in hepatocellular carcinoma, Mol. Ther. 27 (2019) 355–364, https://doi.org/10.1016/j.ymthe.2018.11.005. [25] X. Zhai, Y. Yang, J. Wan, R. Zhu, Y. Wu, Inhibition of LDH-A by oxamate induces G2/M arrest, apoptosis and increases radiosensitivity in nasopharyngeal carcinoma cells, Oncol. Rep. 30 (2013) 2983–2991, https://doi.org/10.3892/or.2013.2735. [26] R.G. Shulman, D.L. Rothman, The glycogen shunt maintains glycolytic homeostasis and the warburg effect in cancer, Trends Cancer 3 (2017) 761–767, https://doi.org/ 10.1016/j.trecan.2017.09.007. [27] J. Lu, The Warburg metabolism fuels tumor metastasis, Cancer Metastasis Rev. 38 (2019) 157–164, https://doi.org/10.1007/s10555-019-09794-5. [28] M.G. de Souza, S.F. de Jesus, E.M. Santos, E.S.B. Gomes, A. de Paulo Santiago Filho, E.M.S. Santos, L.H. da Silveira, S.H.S. Santos, A.M.B. de Paula, L.C. Farias, A.L.S. Guimaraes, Radiation therapy reduced blood levels of LDH, HIF-1alpha, and miR-210 in OSCC, Pathol. Oncol. Res. (2018), https://doi.org/10.1007/s12253018-0517-2. [29] J. Zhang, Y. Zhu, M. Dong, J. Yang, W. Weng, L. Teng, Iodine-125 interstitial brachytherapy reduces tumor growth via Warburg effect inhibition in non-small cell lung cancer A549 xenografts, Oncol. Lett. 16 (2018) 5969–5977, https://doi.org/ 10.3892/ol.2018.9346. [30] A. Besse, J. Sana, R. Lakomy, L. Kren, P. Fadrus, M. Smrcka, M. Hermanova, R. Jancalek, S. Reguli, R. Lipina, M. Svoboda, P. Slampa, O. Slaby, MiR-338-5p sensitizes glioblastoma cells to radiation through regulation of genes involved in DNA damage response, Tumour Biol. 37 (2016) 7719–7727, https://doi.org/10. 1007/s13277-015-4654-x. [31] R. Chen, W. Xia, S. Wang, Y. Xu, Z. Ma, W. Xu, E. Zhang, J. Wang, T. Fang, Q. Zhang, G. Dong, W.C. Cho, P.C. Ma, G. Brandi, S. Tavolari, P. Ujhazy, G. Metro, H.H. Popper, R. Yin, M. Qiu, L. Xu, Long noncoding RNA SBF2-AS1 is critical for tumorigenesis of early-stage lung adenocarcinoma, Mol. Ther. Nucleic Acids 16 (2019) 543–553, https://doi.org/10.1016/j.omtn.2019.04.004. [32] R. Zhang, H. Shi, F. Ren, Z. Liu, P. Ji, W. Zhang, W. Wang, Down-regulation of miR338-3p and up-regulation of MACC1 indicated poor prognosis of epithelial ovarian cancer patients, J. Cancer 10 (2019) 1385–1392, https://doi.org/10.7150/jca. 29502. [33] Y. Zhang, D. Zhang, J. Lv, S. Wang, Q. Zhang, LncRNA SNHG15 acts as an oncogene in prostate cancer by regulating miR-338-3p/FKBP1A axis, Gene 705 (2019) 44–50, https://doi.org/10.1016/j.gene.2019.04.033. [34] T. Zhang, W. Liu, X.C. Zeng, N. Jiang, B.S. Fu, Y. Guo, H.M. Yi, H. Li, Q. Zhang, W.J. Chen, G.H. Chen, Down-regulation of microRNA-338-3p promoted angiogenesis in hepatocellular carcinoma, Biomed. Pharmacother. 84 (2016) 583–591, https://doi.org/10.1016/j.biopha.2016.09.056. [35] C. Jacovetti, A. Abderrahmani, G. Parnaud, J.C. Jonas, M.L. Peyot, M. Cornu, R. Laybutt, E. Meugnier, S. Rome, B. Thorens, M. Prentki, D. Bosco, R. Regazzi, MicroRNAs contribute to compensatory beta cell expansion during pregnancy and obesity, J. Clin. Invest. 122 (2012) 3541–3551, https://doi.org/10.1172/jci64151. [36] S. Nielsen, T. Akerstrom, A. Rinnov, C. Yfanti, C. Scheele, B.K. Pedersen, M.J. Laye, The miRNA plasma signature in response to acute aerobic exercise and endurance training, PLoS One 9 (2014) e87308, https://doi.org/10.1371/journal.pone. 0087308. [37] L. Li, L. Li, W. Li, T. Chen, Z. Bin, L. Zhao, H. Wang, X. Wang, L. Xu, X. Liu, D. Wang, B. Li, T.W. Mak, W. Du, X. Yang, P. Jiang, TAp73-induced phosphofructokinase-1 transcription promotes the Warburg effect and enhances cell proliferation, Nat. Commun. 9 (2018) 4683, https://doi.org/10.1038/s41467-018-07127-8. [38] J. Yang, J. Li, Y. Le, C. Zhou, S. Zhang, Z. Gong, PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer, Am. J. Cancer Res. 6 (2016) 473–485.
Declaration of Competing Interest The authors declare no competing interests. Acknowledgment Not Applicable. References [1] Z.X. Zhu, J.W. Huang, M.H. Liao, Y. Zeng, Treatment strategy for hepatocellular carcinoma in China: radiofrequency ablation versus liver resection, Jpn. J. Clin. Oncol. 46 (2016) 1075–1080, https://doi.org/10.1093/jjco/hyw134. [2] N.D. Parikh, S. Fu, H. Rao, M. Yang, Y. Li, C. Powell, E. Wu, A. Lin, B. Xing, L. Wei, A.S.F. Lok, Risk assessment of hepatocellular carcinoma in patients with hepatitis C in China and the USA, Dig. Dis. Sci. 62 (2017) 3243–3253, https://doi.org/10. 1007/s10620-017-4776-7. [3] C.M. Ho, H.L. Chen, R.H. Hu, P.H. Lee, Harnessing immunotherapy for liver recipients with hepatocellular carcinoma: a review from a transplant oncology perspective, Ther. Adv. Med. Oncol. 11 (2019), https://doi.org/10.1177/ 1758835919843463. [4] J. Wang, S. Chai, G. Zheng, Y. Jiang, Z. Ji, F. Guo, H. Zhuang, K. Zhang, Expert consensus statement on computed tomography-guided (125)I radioactive seeds permanent interstitial brachytherapy, J. Cancer Res. Ther. 14 (2018) 12–17, https://doi.org/10.4103/jcrt.JCRT_888_17. [5] L. Lin, L. Guo, W. Zhang, X. Cai, D. Chen, X. Wan, Novel silicone-coated 125I seeds for the treatment of extrahepatic cholangiocarcinoma, PLoS One 11 (2016) e0147701, https://doi.org/10.1371/journal.pone.0147701. [6] X. Ma, S. Wei, C. Yang, Y. Hua, J. Shen, Z. Cai, Gelfoam embolization or 125I seed implantation may be a more effective treatment than surgical treatment for giant benign sacral neurogenic tumors, World J. Surg. Oncol. 13 (2015) 247, https://doi. org/10.1186/s12957-015-0662-y. [7] J. Lin, L. Xia, J. Liang, Y. Han, H. Wang, L. Oyang, S. Tan, Y. Tian, S. Rao, X. Chen, Y. Tang, M. Su, X. Luo, Y. Wang, H. Wang, Y. Zhou, Q. Liao, The roles of glucose metabolic reprogramming in chemo- and radio-resistance, J. Exp. Clin. Cancer Res. 38 (2019) 218, https://doi.org/10.1186/s13046-019-1214-z. [8] M. Sciacovelli, C. Frezza, Metabolic reprogramming and epithelial-to-mesenchymal transition in cancer, FEBS J. 284 (2017) 3132–3144, https://doi.org/10.1111/febs. 14090. [9] H. Xie, M.C. Simon, Oxygen availability and metabolic reprogramming in cancer, J. Biol. Chem. 292 (2017) 16825–16832, https://doi.org/10.1074/jbc.R117.799973. [10] E. Leung, R.A. Cairns, N. Chaudary, R.N. Vellanki, T. Kalliomaki, E.H. Moriyama, H. Mujcic, B.C. Wilson, B.G. Wouters, R. Hill, M. Milosevic, Metabolic targeting of HIF-dependent glycolysis reduces lactate, increases oxygen consumption and enhances response to high-dose single-fraction radiotherapy in hypoxic solid tumors, BMC Cancer 17 (2017) 418, https://doi.org/10.1186/s12885-017-3402-6. [11] V. Gunda, J. Souchek, J. Abrego, S.K. Shukla, G.D. Goode, E. Vernucci, A. Dasgupta, N.V. Chaika, R.J. King, S. Li, S. Wang, F. Yu, T. Bessho, C. Lin, P.K. Singh, MUC1mediated metabolic alterations regulate response to radiotherapy in pancreatic cancer, Clin. Cancer Res. 23 (2017) 5881–5891, https://doi.org/10.1158/10780432.ccr-17-1151. [12] F. Lan, Q. Qin, H. Yu, X. Yue, Effect of glycolysis inhibition by miR-448 on glioma radiosensitivity, J. Neurosurg. (2019) 1–9, https://doi.org/10.3171/2018.12. jns181798. [13] K.T. Allen, H. Chin-Sinex, T. DeLuca, J.R. Pomerening, J. Sherer, J.B. Watkins 3rd, J. Foley, J.M. Jesseph, M.S. Mendonca, Dichloroacetate alters Warburg metabolism, inhibits cell growth, and increases the X-ray sensitivity of human A549 and H1299 NSC lung cancer cells, Free Radic. Biol. Med. 89 (2015) 263–273, https://doi.org/ 10.1016/j.freeradbiomed.2015.08.006. [14] M.I. Koukourakis, A. Giatromanolaki, Warburg effect, lactate dehydrogenase, and radio/chemo-therapy efficacy, Int. J. Radiat. Biol. 95 (2019) 408–426, https://doi. org/10.1080/09553002.2018.1490041. [15] J.T. Zhong, S.H. Zhou, Warburg effect, hexokinase-II, and radioresistance of laryngeal carcinoma, Oncotarget 8 (2017) 14133–14146, https://doi.org/10.18632/ oncotarget.13044. [16] Q. Huang, J. Li, J. Xing, W. Li, H. Li, X. Ke, J. Zhang, T. Ren, Y. Shang, H. Yang, J. Jiang, Z. Chen, CD147 promotes reprogramming of glucose metabolism and cell proliferation in HCC cells by inhibiting the p53-dependent signaling pathway, J. Hepatol. 61 (2014) 859–866, https://doi.org/10.1016/j.jhep.2014.04.035. [17] Y. Yang, Z.H. Ma, X.G. Li, W.F. Zhang, J. Wan, L.J. Du, G.J. Li, G.K. Yang, P. Lu, Iodine-125 irradiation inhibits invasion of gastric cancer cells by reactivating microRNA-181c expression, Oncol. Lett. 12 (2016) 2789–2795, https://doi.org/10. 3892/ol.2016.5033.
11
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
125
I suppressed the Warburg effect viaregulating miR-338/PFKL axis in hepatocellular carcinoma Jiaping Zheng, Jun Luo, Hui Zeng, Liwen Guo, Guoliang Shao
T
⁎
Department of Interventional Radiology, Institute of Cancer Research and Basic Medical Sciences of Chinese Academy of Sciences, Cancer Hospital of University of Chinese Academy of Sciences, Zhejiang Cancer Hospital, No. 1 Banshan East Road, Hangzhou 310022, Zhejiang, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Hepatocellular carcinoma Warburg effect 125 I miR-338/PFKL axis
Objectives: Iodine-125 (125I) irradiation has been widely applied in the treatment of advanced multiple malignant tumors. However, the underlying mechanism of 125I exerted an anti-tumor effect on hepatocellular carcinoma (HCC) was largely unknown. Methods: In both HCCLM3 and SMMC-7721 cells, the effect of 125I irradiation on the glycolysis was detected. The mRNA in HCC tissues and cell lines were detected by RT-qPCR. Cell proliferation, invasion and migration, and apoptosis were examined by CCK-8, Transwell, wound healing assay and flow cytometry assay, respectively. The interaction between miR-338 and PFKL (6-phosphofructokinase) were verified by dual-luciferase reporter gene assay. Western blotting was used to detect the expression of glycolysis-related proteins. We also evaluated the effect of 125I seed implantation on the tumor growth and Warburg effect in vivo. Results: 125I irradiation significantly decreased the Warburg effect, cell proliferation, invasion and migration, and induced apoptosis of HCCLM3 and SMMC-7721 cells. miR-338 was upregulated in HCC cells treated with 125 I irradiation, which was a negative correlation with tumor size, tumor metastasis, and tumor development. Moreover, miR-338 directly interacted with PFKL and suppressed its expression. Mechanistically, 125I irradiation significantly decreased the Warburg effect and exhibited anti-tumorigenesis function through upregulating the inhibitory effect of miR-338 on PFKL expression. Conclusion: 125I irradiation upregulated the suppression of miR-338 on PFKL to downregulate the Warburg effect and anti-tumorigenesis in HCC and provided a new potential strategy for HCC clinical treatment.
1. Introduction Hepatocellular carcinoma (HCC) with high incidence and mortality rates, is one of the most common malignancies. New HCC cases in China account for about 55% of the total new cases worldwide every year. Meanwhile, it is the second leading cause of cancer death in China [1,2]. Moreover, the early stage of HCC has no specific symptoms, most patients are advanced at diagnosis and progressed rapidly with poor prognosis [3]. With the development of diagnosis and treatment skill, the efficiency and survival time of HCC have been improved, but many patients still have a poor progression. Fortunately, 125I radioactive seed implantation has been widely used in the clinical treatment of various kinds of solid tumors and achieved good curative effect because of its low emission pollution and liability to protection, such as head and
neck, chest, abdominal, pelvic and soft tissue malignant tumors [4,5]. And 125I seed implantation can still be used for cases of failure or recurrence of radiotherapy [6]. However, the underlying mechanism of 125 I radioactive seeds in the treatment of HCC progression is still unclear. Metabolic reprogramming is a hallmark of malignant tumors. Previous studies have reported that they could induce cancer cells to tolerate apoptosis, promote tumor invasion and metastasis, and mediate radiotherapy and chemotherapy resistance [7–9]. Interestingly, cancer cells preferentially utilize glucose by glycolysis rather than oxidative phosphorylation even under aerobic conditions, a common phenomenon known as “Warburg effect”. But whether the metabolic reprogramming such as Warburg effect, was involved in 125I treated HCC cells remains elusive. Moreover, accumulating evidence confirmed that
Abbreviations: CCK-8, cell counting kit-8; D90, 90% of the target volume; DCR, disease control rate; ECAR, extracellular acidification rate; GLUT1, glucose transporter of erythrocytes; HCC, hepatocellular carcinoma; HK2, hexokinase 2; 125I, Iodine-125; IC50, half maximal inhibitory concentration; OCR, oxygen consumption rate; PFA, paraformaldehyde; PFKL, 6-phosphofructokinase; PVDF, polyvinylidene fluoride ⁎ Corresponding author at: Department of Interventional Radiology, Zhejiang Cancer Hospital, No. 1 Banshan East Road, Hangzhou 310022, Zhejiang, China. E-mail addresses: [email protected] (J. Zheng), [email protected] (J. Luo), [email protected] (H. Zeng), [email protected] (L. Guo), [email protected] (G. Shao). https://doi.org/10.1016/j.biopha.2019.109402 Received 19 June 2019; Received in revised form 20 August 2019; Accepted 28 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Opti-MEM medium (Invitrogen Life Technologies, USA) in the light of the specification. The pcDNA-PFKL, miR-338 mimics/inhibitor and control (blank plasmid) were bought from Tolo Biotech (Shanghai, China).
inhibition of glycolysis was contributed to enhancing the inhibitory effect of radiotherapy on proliferation, invasion, and migration of cancer cells [10–12]. For example, Allen et al. found that X-ray treatment inhibited cell growth and induced apoptosis of lung cancer cells through downregulating Warburg effect [13]. Meanwhile, some studies have shown that the activation of a key enzyme in glycolysis was closely related to tumor progression, radiotherapy and chemotherapy resistance, such as hexokinase 2 (HK2), 6-phosphofructo-1-kinase (PFK1), glucose transporter of erythrocytes (GLUT1), pyruvate kinase M2 (PKM2) [14,15]. For example, Huang et al. showed that CD147 enhanced reprogramming of glucose metabolism and proliferation of HCC cells by upregulating PFKL [16]. However, 125I mediated HCC cells proliferation, invasion, migration, and apoptosis through regulating Warburg effect were remained obscure. Increasing evidence confirmed that 125I seed implantation inhibited the tumor growth and metastasis through regulating miRNAs [17]. For example, miR-338, a tumor suppressor gene, was upregulated in multiple malignant tumors when treated with radiotherapy [18,19]. Moreover, miR-338 targets a key enzyme in glycolysis to regulate the progression of HCC. For instance, miR-338-elevated inhibited the Warburg effect and the progression of HCC viatargeting PFLR expression [20]. Furthermore, the bioinformatic database showed that PFKL was one of the targeting genes of miR-338, but little studies confirmed the role of the miR-338/PFKL axis in HCC cells energy metabolism by treatment with 125I so far. In this study, the effect of 125I irradiation on the Warburg effect in HCC cells were investigated. The expression of miR-338 and PFKL in HCC tissues or cell lines and the targeted relationship between miR-338 and PFKL were determined, which could regulate the malignant biological behavior of HCC cells treated with 125I in vitro. Taken together, our study may provide vital theoretical evidence for explaining the role of the miR-338/PFKL axis in the glycolysis switch of HCC treated with 125 I in vitro and in vivo, and at the same time will provide a new biomarker for energy metabolism of HCC development.
2.3. HCCLM3 and SMMC-721 cells treated with
125
I irradiation
125
I seeds were provided by Beijing Zhongke Zhibo Medical Devices Co., Ltd. (Beijing, China). 125I seeds were seeded into an in vitroirradiation model, based on a previous paper [17]. The HCCLM3 and SMMC-721 cells were treated with 125I irradiation at a dose of 0, 2, 4, 6, 8 Gy, respectively. 2.4. RT-qPCR Total RNA was isolated from cultured tissues and cells with TRIzol reagent (QIAGEN, Germany) and reverse-transcribed into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Japan). RT-qPCR Master Mix (TaKaRa, Japan), the sequence of quantitative PCR primers of miRNAs, PFKL, β-actin and U6 were purchased from Shanghai GenePharma Co., Ltd (Shanghai, China), U6 and β-actin as the internal control. The primers used were shown in Table 1. The 2−ΔΔCt methods were applied to calculate the relative expression levels of miRNAs (miR-338, miR-205, miR-448, miR-29b, miR-365 and miR-370) and PFKL. The experiment for each group was repeated three times. 2.5. CCK-8 assay Cell counting kit-8 (CCK-8, Sigma, Japan) was used to detect the proliferation of HCCLM3 and SMMC-7721 cells. Cells were seeded in 96-well plates at 1 × 104 cells per well and treated with 125I at a different dose. Then, cells were cultured in 5% CO2 at 37 °C incubator for 2 h to adhere cells. After that, added 10 μL of the cell proliferation reagent CCK-8 to each well and mixed then incubated for 2 h in the incubator. Finally, the absorbance of cells was measured at 450 nm using a microplate reader (Beckman Coulter, USA). Each experiment was set up with three parallel repeats.
2. Materials and methods 2.1. Tissue or serum samples In this study, we collected two sets of clinical HCC patients’ samples. Firstly, a total of 35 HCC patients’ tissues and adjacent tissues were collected for this study. Secondly, Serum samples from 65 patients with hepatocellular carcinoma treated with 125I seed implantation and 25 patients without any treatment were collected. This study was approved by the Ethical Committee of Zhejiang Cancer Hospital and complied with the guidelines and principles of the Declaration of Helsinki. All participants signed written informed consent. Meanwhile, these samples were frozen in liquid nitrogen immediately and stored at −80 °C for subsequent experiments.
2.6. Colony formation assay The 0.25% Trypsin/0.02% EDTA solution was used to digest the HCCLM3 and SMMC-7721 cells at logarithmic phase. The HCCLM3 and SMMC-7721 cells density were 5 × 103 inoculated in six-well culture plates, and the culture medium was replaced every three days. Table 1 primer sequences for RT-qPCR.
2.2. Cell culture and transfection
Primer
Sequences (5’–3’)
U6
Forward: ACAGGCATCGTGATGGATTCT Reverse: CAGCAGTGGTGGTGAAGTTAT Forward: CATGTACGTTGCTATCCAGGC Reverse: CTCCTTAATGTCACGCACGAT Forward: CATCAGCAACAACGTCCCTG Reverse: GGCCAGGTAGCCACAGTAAC Forward: AACCGGTCCAGCATCAGTGATT Reverse: CAGTGCAGGGTCCGAGGT Forward: CCTCCCTAAATCCTCCATCC Reverse: TCTAGGAAGGACAGCCTCCA Forward: TTATTGCGATGTGTTCCTTATG Reverse: ATGCATGCCACGGGCATATACACT Forward: TGCGGTAGCACCATTTGAAAT Reverse: CCAGTGCAGGGTCCGAGGT Forward: CGTAATGCCCCTAAAAAT Reverse: GTGCAGGGTCCGAGGT Forward: GCCGAATTCTTGAACTAATTCAT Reverse: GCCGGATCCCGTCTCTGTGCCTG
β-actin
HCC cell lines (HepG2, MHCC97H, HCCLM3, and SMMC-7721), human hepatic epithelial cell line (THLE-3) and human embryonic kidney cell line HEK293T were purchased from the Shanghai Institutes for Biological Sciences of the Chinese Academy of Sciences. These cells were cultured in 10% fetal bovine serum (Hyclone, Logan, USA) and 1% PS (100 units/mL penicillin and 100 mg/mL streptomycin, Thermo Fisher Scientific, Shanghai, China) medium with GlutaMAX (DMEM, Gibco BRL, USA). Cells were habitually passaged every 3–4 days, incubated in an incubator with 5% CO2 at 37 °C. 24 h before transfection, HCCLM3 and SMMC-7721 cells were seeded in six-well plates with optimum density and then incubated overnight. miR-338 mimics/inhibitor, pcDNA-PFKL and blank plasmid were transfected into HCCLM3 and SMMC-7721 cells with Lipofectamine 3000 reagent (Invitrogen Life Technologies, USA) and
PFKL miR-338 miR-205 miR-448 miR-29b miR-365 miR-370
2
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
time points; and for OCR, oligomycin, the reversible inhibitor of oxidative phosphorylation FCCP (p-trifluoromethoxy carbonyl cyanide phenylhydrazone), and the mitochondrial complex I inhibitor rotenone plus the mitochondrial complex III inhibitor antimycin A (Rote/AA) were sequentially injected. Data obtained were analyzed by Seahorse XF Wave software.
Subsequently, methanol was used to immobilized cells, when HCCLM3 and SMMC-7721 cells were incubated for 14 days and stained with 0.5% crystal violet. Finally, Nikon Eclipse E600 microscope (Nikon Instruments, USA) was used to count visible colonies in randomly selected fields. The HCCLM3 and SMMC-7721 cells clone formation rate were calculated according to the following equation: cell clone formation rate = clone counts/seeded cell counts × 100%.
2.12. Western blotting 2.7. Flow cytometry analysis After transfection or 125I irritation, both HCC cells were washed with PBS, centrifuged at 800 × g for 6 min, suspended in ice-cold 70% ethanol/PBS, centrifuged at 800 × g for another 6 min, and suspended with PBS. Resuspended cells with 100 μL medium and added 5 μL of Annexin V and 1 μL of propidium iodide according to the manufacturer’s instructions of Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (#V13241, Thermo Fisher, USA), and incubated for 15 min at room temperature. The treated cells were analyzed using flow cytometry. Cell Quest Pro Software (BD Biosciences) was used to evaluate the cellular apoptosis.
Total protein was extracted for western blotting analysis. The PVDF (polyvinylidene fluoride) was incubated overnight at 4 °C with the primary rabbit anti-human PFKL (1:1000 dilution, #ab37583, Abcam, Cambridge, UK), HK2 (1:1000 dilution, #ab209847, Abcam, Cambridge, UK), PKM2 (1:500 dilution, #ab137852, Abcam, Cambridge, UK), GLUT1 (1:200 dilution, #ab652, Abcam, Cambridge, UK) and LDHA (1:1000 dilution, #ab101562, Abcam, Cambridge, UK), mouse anti-human β-actin (1:1000, #ab115777, Abcam, Cambridge, UK), and then with horseradish peroxidase-coupled secondary antibody (Abcam, Cambridge, UK). Signa was detected with chemiluminescence using an ECL kit (Bio-Rad, USA).
2.8. Transwell invasion assay
2.13. Dual-luciferase reporter gene assay
Briefly, 24-well Transwell plates (Corning, USA) were used for cell invasion assay. The upper chamber is pre-treated with 100 μL of Matrigel, the wells were pretreated with Matrigel (BD Biosciences, USA), and HCC cells (1 × 105 cells) in FBS free medium were seeded to the upper chamber. The lower chamber contained DMEM supplemented with 10% FBS. After that, the cells were incubated at 37 °C for 24 h. Moreover, the invasive cells were fixed with 4% paraformaldehyde and rinsed three times with PBS, then stained with 0.1% crystal violet for 10 min and rinsed three times with PBS. Random selection 5 fields of vision for cell count, observation and photography.
The cells were seeded in 24-well plates at a density of 60%. According to the manufacturer’s instructions, the reporter construct containing PFKL wild-type or mutant 3’UTR was co-transfected into cells with miR-338 using Lipofectamine 3000 reagent. After 48 h, the cells were collected and tested for luciferase by dual-luciferase assay system (Promega, USA). 2.14. Nude mice model Female BALB/c nude mice (4–5 weeks old) were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The model was approved by the Ethical Committee of Zhejiang cancer hospital. HCCLM3 and SMMC-7721 cells (1 × 107) were suspended in serum-free DMEM medium and then inoculated in (10 mice in each group) at 6–7 weeks old. After the successful construction of nude mice transplant tumor model, therapy group with a dose of 40 Gy through 125I seed with radioactivity of 0.6 mCi was implanted into the xenograft center of nude mice using an 18-Gauge implant needle. The control group contained no particles. Tumor growth was recorded every three days by measuring tumor length and width. After 4 weeks incubation, the mice were killed and the mice tumor tissues to be collected for further evaluated.
2.9. Wound healing assay HCCLM3 and SMMC-7721 cells (1 × 106 cells/well) were treated with different reagents, seeded in 6-well plates and cultured until they reached confluence. Wounds were made in the cell monolayer by making a scratch with a 20 μL pipette tip. Plates were washed once with fresh medium after 24 h in culture to remove non-adherent cells. Following this wash, plates were photographed. 2.10. Glucose consumption, lactate production and ATP generation assay The expression of glucose consumption, lactate production and ATP generation in supernatants of HCCLM3 and SMMC-7721 cells were evaluated using commercial assay kit (Glucose uptake colorimetric assay kit (#K924), Lactate colorimetric assay kit II (#K627), ATP colorimetric assay kit (#k345), BioVision, Milpitas, CA, USA) according to the manufacturer's protocol. For glucose consumption, after cells seeded, 100 mL Krebs-Ringer-Phosphate-HEPES buffer containing 2% BSA was added for 40 min, and then 10 mM 2-DG was added. For lactate and ATP assays, cells were homogenized in corresponding assay buffer offered by the kits and centrifuged at 4 °C.
2.15. Immunohistochemistry assay The xenograft tissues were collected and fixed with formalin neutral solution of 10% volume fraction, paraffin-embedded and then sectioned. Subsequently, the DAB horseradish peroxidase color development Kit (Beyotime, China) was applied to conjugated Ki-67 antibody (1:2000, #ab21700, Abcam, Cambridge, UK) staining at room temperature. The slides were dyed with hematoxylin for 30 s, dehydrated and fixed, and then sealed with neutral glue. In addition, all stained images were observed and photographed with a fluorescence microscope (Olympus, Japan).
2.11. Extracellular acidification and oxygen consumption rate assay Extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were real-time determined using Seahorse Bioscience XF extracellular flux analyzer (Seahorse Bioscience, North Billerica, MA, USA). And experiments were detected according to the manufacturer's protocol. Briefly, 1 × 104 cells/well was plated in a Seahorse XF cell culture microplate. After baseline measurements, for ECAR, glucose, the oxidative phosphorylation inhibitor oligomycin, and the glycolytic inhibitor 2-DG were sequentially injected into each well at indicated
2.16. Statistical analysis The experimental data and image preprocessing were analyzed by SPSS 20.0 statistical software (IBM, USA) and GraphPad Prism8.0 software (La Jolla, USA), respectively. Besides, student’s t-test was used to analyze the significant different between the two groups, and the different between multiple groups were compared by one-way ANOVA. Moreover, P < 0.05 or P < 0.01 was identified as statistically 3
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 1. 125I irradiation decreased the Warburg effect in HCC cells. A: CCK-8 was used to detect the cell viability in both HCCLM3 and SMMC-7721 cells; B: The glucose consumption in the supernatant was detected by glucose assay kit; C: The lactate production in supernatant was measured by lactate assay kit; D: The ATP generation in the supernatant was detected by ATP colorimetric assay kit. **P < 0.01, compared with the control group.
in xenograft tumor tissues (both P < 0.01, Fig. 2F, G). Besides, 125I therapy notably suppressed the lactate production in tumor masses (both P < 0.01, Fig. 2H). The above findings revealed that 125I irradiation significantly suppressed the proliferation, invasion, migration and induced apoptosis of HCC cells.
significant. 3. Results 3.1.
125
I irradiation decreased the Warburg effect in HCC cells
To explore the effect of 125I irradiation on the Warburg effect, the expression levels of glucose consumption, lactate production, and ATP biosynthesis were detected in both HCC cells (HCCLM3 and SMMC7721). CCK-8 assay results showed that 125I irradiation significantly decreased the viability of HCCLM3 and SMMC-7721 cells in a dosedependent manner (Fig. 1A). Meanwhile, the value of IC50 of 125Itreated HCC cells was respectively reached 4.387 and 3.861 Gy, and the dose of 4 Gy of 125I irradiation was chosen for the follow-up experiments. Moreover, the glucose consumption, lactate production, and ATP generation notably decreased in HCCLM3 and SMMC-7721 cells treated with 125I irradiation compared with the control group (all P < 0.01, Fig. 1B–D). Taken together, 125I-treated HCC cells with a dose of 4 Gy was downregulated the Warburg effect.
3.3. miR-338 downregulated in the
125
I-treated HCC cells
Previous studies confirmed that miRNA plays an important role in the malignant tumor cells treated with radiation including HCC [21–24]. To examine the expression levels of a screening of six miRNAs, which play an important role in regulating radiotherapy of HCC, in HCCLM3 and SMMC-7721 cells treated with 125I irradiation. RT-qPCR analysis results showed that six candidate pro-radiosensitivity miRNAs (miR-338, miR-205, miR-448, miR-29b, miR-365 and miR-370) was upregulated in 125I-treated cells, while miR-338 was the highest expressed in both HCC cells (P < 0.001, Fig. 3A). Moreover, we assessed the expression of miR-338 in HCC tissues and cell lines. The results revealed that miR-338 was downregulated in HCC tissues (n = 35) compared with corresponding noncancerous liver (CNL) tissues (n = 35) (P < 0.01, Fig. 3B). Similarly, the expression of miR-338 in HCC cell lines was lower than that in a human hepatic epithelial cell line (THLE-3) (P < 0.01, Fig. 3C). Collectively, these results suggest that the aberrant expression of miR-338 was associated with the progression of HCC and 125I irradiation, but its mechanism is still unclear.
3.2. 125I irradiation reduced the malignant biological behavior of HCC cells and xenograft tumor growth in vivo To investigate the effect of 125I irradiation on the proliferation, invasion, migration, and apoptosis of HCC cells. Colony formation assay demonstrated that the proliferation capacity of HCCLM3 and SMMC7721 cells treated 125I irradiation at 4 Gy were significantly decreased compared with the control group (all P < 0.01, Fig. 2A). Transwell assays and wound healing assay showed that 125I treatment markedly suppressed invasion and migration abilities of HCCLM3 and SMMC7721 cells compared with the control group (all P < 0.01, Fig. 2B, C). In addition, the Annexin V-FITC/PI double staining assay analyze results showed that 125I treatment was contributed to inducing apoptosis of HCCLM3 and SMMC-7721 cells (all P < 0.01, Fig. 2D). Furthermore, to explore the effect of 125I therapy on tumor growth and glycolysis in vivo. The results showed that the tumor volume and tumor weight of nude mice treated with 125I irradiation noticeably inhibited compared with the untreated group (Fig. 2E). Immunohistochemistry results demonstrated that 125I therapy decreased the expression of Ki-67
3.4. 125I irradiation decreased the Warburg effect through upregulating miR-338 expression To further examine whether upregulation of miR-338 was regulated the Warburg effect in HCCLM3 and SMMC-7721 cells treated with 125I irradiation at a dose of 4 Gy. The RT-qPCR results showed that both HCCLM3 and SMMC-7721 cells transfected with miR-338 mimics significantly enhanced the expression of miR-338 compared with NC group (all P < 0.001, Fig. 4A), while transfected with miR-338 inhibitor was decreased its expression (all P < 0.01, Fig. 4A). Moreover, miR-338-elevated or 125I irradiation markedly decreased the level of glucose consumption, lactate production and ATP generation (all P < 0.01, Fig. 4B–D). Of note, HCCLM3 and SMMC-7721 cells treated 4
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 2. 125I irradiation reduced the malignant biological behavior of HCC cells and Xenograft tumor growthin vivo. A: Colony formation assay was applied to detect cell proliferation capacity of HCCLM3 and SMMC-7721 cells; B: The number of invasion cell was detected by Transwell assay. C: Wound healing assay was used to evaluate the migration ability of HCCLM3 and SMMC-7721 cells; D: The percentage of apoptotic cell was measured by flow cytometry; E: The tumor size was obtained from nude mice, the tumor weight and tumor volume curve of nude mice treated with 125I therapy or untreated (control) were analyzed; F and G: The expression of Ki-67 was detected in tumor tissues by immunohistochemistry; H: The expression of lactate production in tumor tissues. *P < 0.05, **P < 0.01, ***P < 0.001, compared with control group. 5
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 3. miR-338 downregulated in the 125Itreated HCC cells. A: RT-qPCR was applied to detect the miRNAs expression; B and C: RT-qPCR was used to measure the expression of miR-338 in HCC tissues and cell lines. *P < 0.05, **P < 0.01, ***P < 0.001, compared with control group; ## P < 0.01, compared with CNL group; △ P < 0.05, △△P < 0.01, compared with THLE-3 cells.
with 125I after transfecting miR-338 inhibitor was downregulated the inhibitory effect of 125I irradiation on the Warburg effect (Fig. 4B–D). Furthermore, to further assess the effect of 125I-miR-338 on ECAR, which reflects overall glycolytic flux, as well as OCR, which an indicator of mitochondrial respiration, were evaluated by Seahorse XF extracellular flux analyzer. The results showed that upregulation of miR-338 or treatment with 125I significantly decreased the rate of glycolysis and glycolytic capacity of HCCLM3 and SMMC-7721 cells (all P < 0.01, Fig. 4E, F), while knockdown of miR-338 was rescued these effects. Taken together, these results confirmed that 125I irradiation decreased the Warburg effect viaupregulating miR-338 in HCCLM3 and SMMC-7721 cells.
Fig. 5E). In conclusion, these results suggested that PFKL was the direct target of miR-338 which was negatively regulated PFKL expression.
3.6. 125I therapy suppressed the Warburg effect by regulating miR-338/ PFKL axis To further determine the underlying mechanism by which 125I irradiation exerted anti-Warburg effect and decreased the malignant biological behavior of HCCLM3 and SMMC-7721 cells viaregulating miR-338/PFKL axis. Western blotting results showed that the expression of PFKL protein was significantly enhanced in HCCLM3 and SMMC-7721 cells transfected with pcDNA-PFKL compared with the NC group (all P < 0.01, Fig. 6A). However, co-transfected miR-338 mimics and pcDNA-PFKL was downregulated the level of PFKL protein (all P < 0.01, Fig. 6A). Moreover, the expression of glucose consumption, lactate production and ATP generation were increased in HCCLM3 and SMMC-7721 cells treated with 125I after transfecting with pcDNA-PFKL compared with only 125I treatment group (all P < 0.01, Fig. 6B–D). Whereas, there was no significant difference between 125I treatment group and miR-338+PFKL+125I group (Fig. 6B–D). In addition, overexpression of PFKL downregulated the inhibitory effect of 125I-treated on the proliferation, invasion, and migration of HCCLM3 and SMMC7721 cells (all P < 0.01, Fig. 6E–G). However, the upregulation effect of PFKL on the malignant biological behavior of HCCLM3 and SMMC7721 cells were reversed by co-transfecting with miR-338 mimics (Fig. 6E–G). Meanwhile, upregulation of PFKL decreased the 125I-induced apoptosis of HCCLM3 and SMMC-7721 cells (all P < 0.01, Fig. 6H). In contrast, co-transfected with miR-338 mimics and pcDNAPFKL was contributed to increasing 125I-induced the percentage of apoptotic cells (P < 0.01, Fig. 6H). These results suggested that 125I irradiation was suppressed the Warburg effect and malignant biological behavior of HCCLM3 and SMMC-7721 cells through mediating miR338/PFKL axis.
3.5. miR-338 directly targeted PFKL in HCC cells To further understand the mechanism underlying the effect of miR338 on the Warburg effect, we examined the expression levels of glycolysis-related proteins (HK2, PFKL, PKM2, GLUT1 and LDHA) in HCC cells transfected with miR-338 mimics. Western blotting results revealed that overexpression of miR-338 significantly decreased the expression of PFKL and GLUT1 proteins compared with NC group (all P < 0.01, Fig. 5A, B), but the expression of HK2, PKM2 and LDHA remained unchanged. In addition, we discovered that miR-338 may target PFKL directly from the starBase database (http://starbase.sysu. edu.cn/) (Fig. 5C). To further confirm that miR-338 was specifically binding to the 3’UTR region of PFKL mRNA to regulate the expression of PFKL by dual-luciferase reporter gene assay. The results showed that luciferase activity in PFKL-WT + miR-338 mimics group was lower than PFKL-WT + miR-NC group (P < 0.01, Fig. 5D), but there was no significant difference exist between miR-338 mimics or NC was transferred in the PFKL-MUT group (P > 0.05, Fig. 5D). At the same time, we used western blotting to test the expression level of PFKL when miR338 mimics was transfected into HCCLM3 and SMMC-7721 cells. The analysis results pointed out that overexpression of miR-338 significantly decreased the expression of PFKL protein (all P < 0.01, 6
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 4. 125I irradiation decreased the Warburg effect through upregulating miR-338 expression. A: The expression of miR-338 was detected by RT-qPCR; B: The glucose consumption in supernatant was detected by glucose assay kit; C: The lactate production in supernatant was measured by lactate assay kit; D: The ATP generation in supernatant was detected by ATP colorimetric assay kit; E and F: The extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were determined in HCCLM3 and SMMC-7721 cells. **P < 0.01, compared with NC group; ## P < 0.01, compared with the control group.
7
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 5. miR-338 directly targeted PFKL in HCC cells. A and B: Western blotting was used to detect the expression of HK2, PFKL, PKM2, GLUT1 and LDHA in HCCLM3 and SMMC-7721 cells; C: The bioinformatics analysis results showed that miR-338 had a binding site with PFKL; D: Dual-luciferase reporter gene assay was applied to verify the targeted relationship between miR-338 and PFKL; E: Western blotting was used to detect the expression of PFKL in HCCLM3 and SMMC-7721 cells. **P < 0.01, ***P < 0.001, compared with NC group.
with 125I (R2 = −0.516, P = 0.003, Fig. 7C). Thus, these data showed that 125I therapy promoted the inhibitory effect of miR-338 on PFKL expression may be beneficial to suppress the progression of HCC patients with this condition.
3.7. Correlation between the miR-338/PFKL axis and HCC progression in clinical patients The effect of the miR-338/PFKL axis on the prognosis of HCC patients treated with 125I seed implantation was further investigated. By comparing clinicopathological characteristics, disease control rate (DCR) of HCC patients treated with 125I seed implantation was significantly correlated with tumor size (P = 0.006), metastasis (P = 0.000), and dose received by 90% of the target volume (D90, P = 0.000) (Table 2). Besides, RT-qPCR results showed that miR-338 was upregulated in plasma of 125I seed implantation into HCC patients compared with the untreated group (P < 0.01, Fig. 7A), while decreased the mRNA expression of PFKL (P < 0.001, Fig. 7B). Moreover, Spearman's correlation analysis revealed that the expression of miR-338 was inversely correlated with PFKL expression in plasma of HCC treated
4. Discussion Multiple malignant tumors are threatening to the safety of our life and will damage our life over a long period of time. In this study, we discussed the molecular mechanism of 125I irradiation on the malignant biological behavior of HCC cells by regulating the Warburg effect. The glucose metabolism, cell proliferation, invasion and migration were inhibited in HCCLM3 and SMMC-7721 cells treated with 125I irradiation at a dose of 4 Gy, but enhanced the expression of miR-338. Moreover, miR-338-elevated significantly decreased the Warburg effect and 8
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Fig. 6. 125I therapy suppressed the Warburg effect by regulating miR-338/PFKL axis. A: Western blotting was used to detect the expression of PFKL; B: The glucose consumption in supernatant was detected by glucose assay kit; C: The lactate production in supernatant was measured by lactate assay kit; D: The ATP generation in supernatant was detected by ATP colorimetric assay kit; E: colony formation assay was applied to detect cell proliferation capacity of HCCLM3 and SMMC-7721 cells; F The number of invasion cell was detected by Transwell assay. G: Wound healing assay was used to evaluate the migration ability of HCCLM3 and SMMC-7721 cells; H: The percentage of apoptotic cell was measured by flow cytometry. △△P < 0.01, compared with PFKL overexpression group; **P < 0.01, compared with the control group; ##P < 0.01, compared with 125I irradiation group; ▲▲P < 0.01, compared with 125I irradiation + PFKL group.
growth and metastasis of HCC cells by targeting PFKL, which was induced by 125I irradiation. Besides, we found that the expression of miR338 was downregulated in HCC tissues and cell lines. Hence, 125I
irradiation significantly suppressed the HCC glycolysis and progression by regulating miR-338/PFKL axis and provided a new tool for target treatment of HCC patients. 9
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
acts as a tumor suppressor gene, was enhanced the radiosensitivity of malignant cancer cells by targeting 3’UTR of mRNA in human solid tumors, including esophageal squamous cell carcinoma [18], and glioblastoma [30]. Besides, the expression of miR-338 was upregulated in multiple tumors such as lung cancer [31], ovarian cancer [32], prostate cancer [33] and HCC [34]. In this study, we demonstrated that miR-338 was downregulated in HCC tissues compared with adjacent tissues. Moreover, previous studies found that miR-338 was a key regulator of energy metabolism [35,36]. For example, Nie et al. reported that miR-338 targets PKLR to decrease HCC progression by mediating the Warburg effect [20]. Our further in vitro and in vivo functional studies revealed that 125I irradiation suppressed the glucose metabolism and growth and metastasis of HCC cells by upregulating the inhibitory effect of miR-338 on PFKL expression. In addition, PFKL, which acts as a key player in glycolysis, was upregulated in cancer cells to promote cell proliferation and metastasis through activating Warburg effect [16,37,38]. Taken together, miR-338/PFKL axis plays an important in regulating glycolysis and the progression of HCC cells treated with 125I irradiation.
Table 2 Clinicopathological characteristics. Clinical feature
Gender Male Female Age ≤60 > 60 Tumor size (cm) ≤5 >5 125 I seed numbers ≤50 > 50 125 I distribution method Paris method Monte Carlo method Metastasis Lung Bone Lymphatic No D90 dose < 110 Gy ≥110 Gy
Number
DCR
65
54
60 5
49(81.67%) 5(100%)
44 21
36(81.82%) 18(85.71%)
54 11
48(88.89%) 6(54.55%)
51 14
45(88.24%) 9(64.29%)
29 36
22(75.86%) 32(88.89%)
28 16 13 8
23(82.14%) 14(87.50%) 9(69.23%) 8(100%)
P value
0.294
0.695
0.006
0.189
0.467
0.000
5. Conclusions 0.000
12 53
2(16.67%) 52(98.11%)
This study confirmed that miR-338 was downregulated in HCC tissues and cell lines and plays an important role in 125I-treated changes in glycolysis, proliferation, invasion and migration, and apoptosis of HCC cells by targeting PFKL. Moreover, our studies will provide insight into the molecular mechanism of glucose metabolism switch during HCC pathogenesis and open a new strategy for HCC treatment.
DCR: disease control rate; D90: dose received by 90% of the target volume.
Malignant tumor metabolism studies have shown that cancer cells could reprogram energy metabolism, including aerobic glycolysis, glutamine metabolic disorders, lipid synthesis and oxidative changes. Abnormal energy metabolism of cancer cells can cause malignant biological behavior, including rapid proliferation, anti-apoptotic, epithelial-mesenchymal transition, metastasis, angiogenesis, immune escape, radiotherapy resistance and chemotherapy resistance [25]. Warburg effect is an important manifestation of malignant tumor reprogramming energy metabolism and plays an important role in tumor growth, metastasis and recurrence [26,27]. For example, de Souza et al. confirmed that radiation therapy inhibited the progression of oral squamous cell carcinoma through downregulating Warburg effect [28]. Another study showed that X-ray irradiation significantly inhibited the viability of A549 and H1299 cells by altering Warburg effect [13]. A recent study reveals that 125I seed implantation reduced tumor growth viadecreasing Warburg effect in xenograft model of non-small cell lung cancer [29]. Our finding here confirmed that the cell viability, invasion, and migration, and glucose metabolism were decreased in HCC cells treated with 125I irradiation at a dose of 4 Gy. These data suggested that inhibition of the Warburg effect was contributed to enhancing the sensitivity of HCC cells to 125I, but its mechanism has yet been unclear. Increasing evidence suggested that miRNAs play an important role in biological behavior of cancer cells treated with radiotherapy, and they may serve as oncogenes or anti-oncogenes. For example, miR-338,
Funding This study was supported by the General Medicine and Health Funding Project of Zhejiang [grant number 2013KYB041]; General Medicine and Health Funding Project of Zhejiang [grant number 2016KYA043]; Funding for Cultivation of High-level Innovation Health Talents of Zhejiang [grant number 2012-241]. Authors’ contribution GS was the principal investigator; GS and JZ were involved in the formulation of the research hypotheses and study design, as well as data interpretation; JZ, JL, and HZ performed the experiments; HZ carried out the Western blotting analysis and proliferation assays; JL performed the migration and invasion assays; JL performed the Annexin V experiments; JZ, LG, and JL performed statistical and graphical analyses; JZ wrote the manuscript. All authors read and approved the final manuscript. Ethics approval and consent to participate This study was approved by the Ethics Committee of Zhejiang
Fig. 7. Correlation between miR-338/PFKL axis and HCC progression in clinical patients. A and B: RT-qPCR was used to detect the mRNA expression of miR-338 and PFKL in HCC tissues; C: The expression relationship between miR-338 and PFKL was evaluated by Spearman’s correlation analysis. **P < 0.01, ***P < 0.001, compared with the untreated group. 10
Biomedicine & Pharmacotherapy 119 (2019) 109402
J. Zheng, et al.
Cancer Hospital (NO. IRB2015230).
[18] M. Park, H.J. Yoon, M.C. Kang, J. Kwon, H.W. Lee, MiR-338-5p enhances the radiosensitivity of esophageal squamous cell carcinoma by inducing apoptosis through targeting survivin, Sci. Rep. 7 (2017) 10932, https://doi.org/10.1038/ s41598-017-10977-9. [19] X. Liu, H. Cai, W. Sheng, H. Huang, Z. Long, Y. Wang, microRNAs expression profile related with response to preoperative radiochemotherapy in patients with locally advanced gastric cancer, BMC Cancer 18 (2018) 1048, https://doi.org/10.1186/ s12885-018-4967-4. [20] H. Nie, J. Li, X.M. Yang, Q.Z. Cao, M.X. Feng, F. Xue, L. Wei, W. Qin, J. Gu, Q. Xia, Z.G. Zhang, Mineralocorticoid receptor suppresses cancer progression and the Warburg effect by modulating the miR-338-3p-PKLR axis in hepatocellular carcinoma, Hepatology 62 (2015) 1145–1159, https://doi.org/10.1002/hep.27940. [21] R. Dutta, R.I. Mahato, Recent advances in hepatocellular carcinoma therapy, Pharmacol. Ther. 173 (2017) 106–117, https://doi.org/10.1016/j.pharmthera. 2017.02.010. [22] H. Li, X. Jin, B. Chen, P. Li, Q. Li, Autophagy-regulating microRNAs: potential targets for improving radiotherapy, J. Cancer Res. Clin. Oncol. 144 (2018) 1623–1634, https://doi.org/10.1007/s00432-018-2675-8. [23] B. Tomasik, J. Chalubinska-Fendler, D. Chowdhury, W. Fendler, Potential of serum microRNAs as biomarkers of radiation injury and tools for individualization of radiotherapy, Transl. Res. 201 (2018) 71–83, https://doi.org/10.1016/j.trsl.2018. 06.001. [24] Y. Shao, X. Song, W. Jiang, Y. Chen, Z. Ning, W. Gu, J. Jiang, MicroRNA-621 acts as a tumor radiosensitizer by directly targeting SETDB1 in hepatocellular carcinoma, Mol. Ther. 27 (2019) 355–364, https://doi.org/10.1016/j.ymthe.2018.11.005. [25] X. Zhai, Y. Yang, J. Wan, R. Zhu, Y. Wu, Inhibition of LDH-A by oxamate induces G2/M arrest, apoptosis and increases radiosensitivity in nasopharyngeal carcinoma cells, Oncol. Rep. 30 (2013) 2983–2991, https://doi.org/10.3892/or.2013.2735. [26] R.G. Shulman, D.L. Rothman, The glycogen shunt maintains glycolytic homeostasis and the warburg effect in cancer, Trends Cancer 3 (2017) 761–767, https://doi.org/ 10.1016/j.trecan.2017.09.007. [27] J. Lu, The Warburg metabolism fuels tumor metastasis, Cancer Metastasis Rev. 38 (2019) 157–164, https://doi.org/10.1007/s10555-019-09794-5. [28] M.G. de Souza, S.F. de Jesus, E.M. Santos, E.S.B. Gomes, A. de Paulo Santiago Filho, E.M.S. Santos, L.H. da Silveira, S.H.S. Santos, A.M.B. de Paula, L.C. Farias, A.L.S. Guimaraes, Radiation therapy reduced blood levels of LDH, HIF-1alpha, and miR-210 in OSCC, Pathol. Oncol. Res. (2018), https://doi.org/10.1007/s12253018-0517-2. [29] J. Zhang, Y. Zhu, M. Dong, J. Yang, W. Weng, L. Teng, Iodine-125 interstitial brachytherapy reduces tumor growth via Warburg effect inhibition in non-small cell lung cancer A549 xenografts, Oncol. Lett. 16 (2018) 5969–5977, https://doi.org/ 10.3892/ol.2018.9346. [30] A. Besse, J. Sana, R. Lakomy, L. Kren, P. Fadrus, M. Smrcka, M. Hermanova, R. Jancalek, S. Reguli, R. Lipina, M. Svoboda, P. Slampa, O. Slaby, MiR-338-5p sensitizes glioblastoma cells to radiation through regulation of genes involved in DNA damage response, Tumour Biol. 37 (2016) 7719–7727, https://doi.org/10. 1007/s13277-015-4654-x. [31] R. Chen, W. Xia, S. Wang, Y. Xu, Z. Ma, W. Xu, E. Zhang, J. Wang, T. Fang, Q. Zhang, G. Dong, W.C. Cho, P.C. Ma, G. Brandi, S. Tavolari, P. Ujhazy, G. Metro, H.H. Popper, R. Yin, M. Qiu, L. Xu, Long noncoding RNA SBF2-AS1 is critical for tumorigenesis of early-stage lung adenocarcinoma, Mol. Ther. Nucleic Acids 16 (2019) 543–553, https://doi.org/10.1016/j.omtn.2019.04.004. [32] R. Zhang, H. Shi, F. Ren, Z. Liu, P. Ji, W. Zhang, W. Wang, Down-regulation of miR338-3p and up-regulation of MACC1 indicated poor prognosis of epithelial ovarian cancer patients, J. Cancer 10 (2019) 1385–1392, https://doi.org/10.7150/jca. 29502. [33] Y. Zhang, D. Zhang, J. Lv, S. Wang, Q. Zhang, LncRNA SNHG15 acts as an oncogene in prostate cancer by regulating miR-338-3p/FKBP1A axis, Gene 705 (2019) 44–50, https://doi.org/10.1016/j.gene.2019.04.033. [34] T. Zhang, W. Liu, X.C. Zeng, N. Jiang, B.S. Fu, Y. Guo, H.M. Yi, H. Li, Q. Zhang, W.J. Chen, G.H. Chen, Down-regulation of microRNA-338-3p promoted angiogenesis in hepatocellular carcinoma, Biomed. Pharmacother. 84 (2016) 583–591, https://doi.org/10.1016/j.biopha.2016.09.056. [35] C. Jacovetti, A. Abderrahmani, G. Parnaud, J.C. Jonas, M.L. Peyot, M. Cornu, R. Laybutt, E. Meugnier, S. Rome, B. Thorens, M. Prentki, D. Bosco, R. Regazzi, MicroRNAs contribute to compensatory beta cell expansion during pregnancy and obesity, J. Clin. Invest. 122 (2012) 3541–3551, https://doi.org/10.1172/jci64151. [36] S. Nielsen, T. Akerstrom, A. Rinnov, C. Yfanti, C. Scheele, B.K. Pedersen, M.J. Laye, The miRNA plasma signature in response to acute aerobic exercise and endurance training, PLoS One 9 (2014) e87308, https://doi.org/10.1371/journal.pone. 0087308. [37] L. Li, L. Li, W. Li, T. Chen, Z. Bin, L. Zhao, H. Wang, X. Wang, L. Xu, X. Liu, D. Wang, B. Li, T.W. Mak, W. Du, X. Yang, P. Jiang, TAp73-induced phosphofructokinase-1 transcription promotes the Warburg effect and enhances cell proliferation, Nat. Commun. 9 (2018) 4683, https://doi.org/10.1038/s41467-018-07127-8. [38] J. Yang, J. Li, Y. Le, C. Zhou, S. Zhang, Z. Gong, PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer, Am. J. Cancer Res. 6 (2016) 473–485.
Declaration of Competing Interest The authors declare no competing interests. Acknowledgment Not Applicable. References [1] Z.X. Zhu, J.W. Huang, M.H. Liao, Y. Zeng, Treatment strategy for hepatocellular carcinoma in China: radiofrequency ablation versus liver resection, Jpn. J. Clin. Oncol. 46 (2016) 1075–1080, https://doi.org/10.1093/jjco/hyw134. [2] N.D. Parikh, S. Fu, H. Rao, M. Yang, Y. Li, C. Powell, E. Wu, A. Lin, B. Xing, L. Wei, A.S.F. Lok, Risk assessment of hepatocellular carcinoma in patients with hepatitis C in China and the USA, Dig. Dis. Sci. 62 (2017) 3243–3253, https://doi.org/10. 1007/s10620-017-4776-7. [3] C.M. Ho, H.L. Chen, R.H. Hu, P.H. Lee, Harnessing immunotherapy for liver recipients with hepatocellular carcinoma: a review from a transplant oncology perspective, Ther. Adv. Med. Oncol. 11 (2019), https://doi.org/10.1177/ 1758835919843463. [4] J. Wang, S. Chai, G. Zheng, Y. Jiang, Z. Ji, F. Guo, H. Zhuang, K. Zhang, Expert consensus statement on computed tomography-guided (125)I radioactive seeds permanent interstitial brachytherapy, J. Cancer Res. Ther. 14 (2018) 12–17, https://doi.org/10.4103/jcrt.JCRT_888_17. [5] L. Lin, L. Guo, W. Zhang, X. Cai, D. Chen, X. Wan, Novel silicone-coated 125I seeds for the treatment of extrahepatic cholangiocarcinoma, PLoS One 11 (2016) e0147701, https://doi.org/10.1371/journal.pone.0147701. [6] X. Ma, S. Wei, C. Yang, Y. Hua, J. Shen, Z. Cai, Gelfoam embolization or 125I seed implantation may be a more effective treatment than surgical treatment for giant benign sacral neurogenic tumors, World J. Surg. Oncol. 13 (2015) 247, https://doi. org/10.1186/s12957-015-0662-y. [7] J. Lin, L. Xia, J. Liang, Y. Han, H. Wang, L. Oyang, S. Tan, Y. Tian, S. Rao, X. Chen, Y. Tang, M. Su, X. Luo, Y. Wang, H. Wang, Y. Zhou, Q. Liao, The roles of glucose metabolic reprogramming in chemo- and radio-resistance, J. Exp. Clin. Cancer Res. 38 (2019) 218, https://doi.org/10.1186/s13046-019-1214-z. [8] M. Sciacovelli, C. Frezza, Metabolic reprogramming and epithelial-to-mesenchymal transition in cancer, FEBS J. 284 (2017) 3132–3144, https://doi.org/10.1111/febs. 14090. [9] H. Xie, M.C. Simon, Oxygen availability and metabolic reprogramming in cancer, J. Biol. Chem. 292 (2017) 16825–16832, https://doi.org/10.1074/jbc.R117.799973. [10] E. Leung, R.A. Cairns, N. Chaudary, R.N. Vellanki, T. Kalliomaki, E.H. Moriyama, H. Mujcic, B.C. Wilson, B.G. Wouters, R. Hill, M. Milosevic, Metabolic targeting of HIF-dependent glycolysis reduces lactate, increases oxygen consumption and enhances response to high-dose single-fraction radiotherapy in hypoxic solid tumors, BMC Cancer 17 (2017) 418, https://doi.org/10.1186/s12885-017-3402-6. [11] V. Gunda, J. Souchek, J. Abrego, S.K. Shukla, G.D. Goode, E. Vernucci, A. Dasgupta, N.V. Chaika, R.J. King, S. Li, S. Wang, F. Yu, T. Bessho, C. Lin, P.K. Singh, MUC1mediated metabolic alterations regulate response to radiotherapy in pancreatic cancer, Clin. Cancer Res. 23 (2017) 5881–5891, https://doi.org/10.1158/10780432.ccr-17-1151. [12] F. Lan, Q. Qin, H. Yu, X. Yue, Effect of glycolysis inhibition by miR-448 on glioma radiosensitivity, J. Neurosurg. (2019) 1–9, https://doi.org/10.3171/2018.12. jns181798. [13] K.T. Allen, H. Chin-Sinex, T. DeLuca, J.R. Pomerening, J. Sherer, J.B. Watkins 3rd, J. Foley, J.M. Jesseph, M.S. Mendonca, Dichloroacetate alters Warburg metabolism, inhibits cell growth, and increases the X-ray sensitivity of human A549 and H1299 NSC lung cancer cells, Free Radic. Biol. Med. 89 (2015) 263–273, https://doi.org/ 10.1016/j.freeradbiomed.2015.08.006. [14] M.I. Koukourakis, A. Giatromanolaki, Warburg effect, lactate dehydrogenase, and radio/chemo-therapy efficacy, Int. J. Radiat. Biol. 95 (2019) 408–426, https://doi. org/10.1080/09553002.2018.1490041. [15] J.T. Zhong, S.H. Zhou, Warburg effect, hexokinase-II, and radioresistance of laryngeal carcinoma, Oncotarget 8 (2017) 14133–14146, https://doi.org/10.18632/ oncotarget.13044. [16] Q. Huang, J. Li, J. Xing, W. Li, H. Li, X. Ke, J. Zhang, T. Ren, Y. Shang, H. Yang, J. Jiang, Z. Chen, CD147 promotes reprogramming of glucose metabolism and cell proliferation in HCC cells by inhibiting the p53-dependent signaling pathway, J. Hepatol. 61 (2014) 859–866, https://doi.org/10.1016/j.jhep.2014.04.035. [17] Y. Yang, Z.H. Ma, X.G. Li, W.F. Zhang, J. Wan, L.J. Du, G.J. Li, G.K. Yang, P. Lu, Iodine-125 irradiation inhibits invasion of gastric cancer cells by reactivating microRNA-181c expression, Oncol. Lett. 12 (2016) 2789–2795, https://doi.org/10. 3892/ol.2016.5033.
11