[14] Biochemical and NMR studies of RNA conformation with an emphasis on RNA pseudoknots

[ 14]

RNA PSEUDOKNOTS

323

[14] B i o c h e m i c a l a n d NMR S t u d i e s of RNA C o n f o r m a t i o n w i t h a n E m p h a s i s o n RNA P s e u d o k n o t s B y JOSEPH D . PUGLISI a n d J A C Q U E L I N E R . W Y A T T

Introduction Advances in NMR techniques have opened almost innumerable possibilities for structural studies of RNA. Unfortunately, the size limitation of NMR (ca. 20 kDa, approximately 65 nucleotides) requires a reductionist approach to study most biologically interesting RNAs and their interaction with ligands. The challenge is to develop a system for NMR study that recapitulates the essential features of the RNA of interest. Since little is known about the detailed conformations of RNA, model systems that concentrate on RNA folding motifs, such as hairpin loops, internal loops, base triples, and pseudoknots, should also be studied. The goal of NMR studies on either biological RNAs or model systems is usually the definition of the three-dimensional (3D) structure using NMR-derived constraints. This article concentrates on two general aspects of NMR studies of RNA conformation that are applicable to any system of interest. First, we describe the experimental procedures that we have used to develop RNA systems for study by NMR. We feel that the time spent before an RNA sample is placed in the magnet is crucial to the success of an NMR study of RNA. Second, we discuss how NMR can be used to probe RNA conformational equilibria. The authors' published work on RNA pseudoknots is emphasized, as many of the techniques were initially applied to the study of pseudoknots. Project Choice and Sequence Design Phylogenetic and biochemical analyses often highlight the sequence elements that are important for function and that are, therefore, of structural interest) If an RNA from a biological system is to be studied, then the sequence constraints due to function must be considered. The goal is to design a model oligonucleotide that mimics the structure of the RNA in its natural context. In studies of the HIV TAR RNA, which forms a bulged stem-loop structure, the biological sequence was almost completely conserved in the 31-nucleotide model oligonucleotide;2 however, base pairs 1 R. R. Gutell, Cur. Opin. Struct. Biot 3, 313 (1993).

2j. D. Puglisi,R. Tan,B. J. Calnan,A. D. Frankel,and J. R. Williamson,Science 257,76 (1992). METHODS IN ENZYMOLOGY,VOL. 261

Copyright © 1995 by AcademicPress, Inc. All rightsof reproductionin any form reserved.

324

DNA AND RNA STRUCTURE

[141

that were not involved in function were changed to stabilize the structure and facilitate transcription. The 31-nucleotide R N A bound to the HIV Tat protein with the same affinity and specificity as longer mRNA-derived transcripts. 3-5 Thus, the short oligonucleotide mimics both the conformation and function of the biological RNA. Many N M R studies of R N A focus on model-folding domains and not R N A sequences of direct biological function. In these cases, biological sequence constraints are relaxed. The oligonucleotide sequence is designed to form the desired structure under the conditions of the NMR experiment. Before investing a large amount of time and effort, it is critical to show that the structure of interest is adopted. Our studies of R N A pseudoknots illustrate the important aspects of sequence design. Initially, we showed that oligonucleotides could form pseudoknot structures at low R N A concentrations (/zM) using chemical and enzymatic probing experiments; 6 however, the sequences initially studied formed dimeric structures at the millimolar R N A concentrations required for NMR. Thus, careful consideration in the design stage of whether an oligonucleotide can form a dimeric structure can save valuable time. Oligonucleotides that can form hairpin loop structures are particularly susceptible to dimerization, especially if the loop sequence has some self-complementarity. Several factors should be considered in sequence design. First, for an R N A oligonucleotide of 15 nucleotides or longer, the requirements for efficient transcription from a D N A template by T7 polymerase should be satisfied (discussed next). Second, if possible,5'YpA 3' steps in singlestranded regions of the R N A structure should be avoided. These sequence elements are hot spots for hydrolysis of the R N A 7 and can be a major source of long-term chemical instability of an NMR sample. Hydrolysis rates are significantly increased in the presence of divalent cations so that YpA sequences should be particularly avoided in oligonucleotides that must be studied in buffers containing divalent ions. Finally, biochemical or functional assays and molecularity determination must show that the structure of interest is adopted at the R N A and salt concentrations to be used in the NMR study. 3 M. G. Cordingley, R. L. LaFemina, P. L. Callahan, J. H. Condra, V. V. Sardana, D. J. Graham, T. M. Nguyen, K. LeGrow, L. Gotlib, A. J. Schlabach, and R. J. Colonno, Proc. Natl. Acad. Sci. U.S.A. 87, 8985 (1990). 4 C. Dingwall, I. Ernberg, M. J. Gait, S. M. Green, S. Heaphy, J. Karn, A. D. Lowe, M. Singh, M. A. Skinner, and R. Varerio, Proc. Natl. Acad. Sci. U.S.A. 86, 6925 (1989). 5 K. M. Weeks and D. M. Crothers, Cell 66, 577 (1991). 6 j. D. Puglisi, J. R. Wyatt, and I. Tinoco, Jr., Nature 331, 283 (1988). 7 A. C. Dock-Bregeon and D. Moras, Cold Spring Harb. Symp. Quant. Biol. 52, 113 (1987).

[ 14]

RNA PSEUDOKNOTS

325

Combining NMR and Biochemical Methods: RNA Pseudoknots as an Example To understand the conformation and thermodynamic stability of R N A pseudoknots, we applied both biochemical and biophysical techniques. Portions of these studies 8,9 are summarized here to illustrate the usefulness of the combined biochemical/biophysical approach. A number of R N A oligonucleotides that were designed to form pseudoknots were characterized biochemically. Enzymatic and chemical probes were used to determine whether the two stem regions characteristic of a pseudoknot were formed. We assayed at least 20 different sequences before finding a sequence for which (1) probing data suggested a pseudoknot conformation, (2) gel filtration and UV melting experiments demonstrated a monomeric conformation at high R N A concentrations, and (3) the R N A was chemically stable under the conditions where a pseudoknot conformation was favored (high Mg2+). The resulting sequence (PK5; Fig. 1) was then studied in detail using N M R spectroscopy. The ideal solution conditions for NMR characterization of an RNA oligonucleotide should be determined before detailed conformational analysis. Most studies on R N A oligonucleotides are performed in phosphate buffer, which lacks proton resonances, has a pK near neutral pH, and a small temperature dependence of pK. A pH slightly below neutral (pH 6.5) was chosen for most of our R N A studies, as the lower pH decreases the base catalyzed exchange of imino protons. In addition, the low pH of the sample increases the overall lifetime of the RNA, since base-catalyzed hydrolysis is decreased. For each oligonucleotide, a range of pH values should be tested using biochemical methods and then NMR, since R N A interactions may involve protonated bases. For example, an R N A hairpin that contained a protonated A-C base pair gave spectra with sharp resonances only below pH 6.5.1° We generally assay pH between 5.5 and 7.5. Many RNAs require the presence of monovalent or divalent salt ions to form stable secondary or tertiary structure. For the oligonucleotide in Fig. 1, the pseudoknot conformation was not favored in 50 mM NaC1, 10 mM Na phosphate pH 6.5 in the absence of MgZ+; the conformational equilibrium was driven toward the pseudoknot form by the addition of 5 mM Mg 2÷. Preliminary assay for a requirement for divalent ions can be done using chemical and enzymatic probes. For example, both S1 nuclease cleavage and DEP modification in the absence of Mg 2+ clearly showed that s j. D. Puglisi, J. R. Wyatt, and I, Tinoco, Jr., J. Mol. Biol. 214, 437 (1990). 9 j. R. Wyatt, J. D. Puglisi, and I. Tinoco, Jr., J. Mol. Biol. 214, 455 (1990). 10 j. D. Puglisi, J. R. Wyatt, and I. Tinoco, Jr., Biochemistry 29, 4215 (1990).

326

DNA AND RNA STRUCTURE 1

I I

[ 14]

~x\~'\\\\~'~\\x\\'~\

#x x \ \ ~ x \ \ \ \ \ \ \ \ \ ~ . , q

GCGAUUUCUGACCGCUUUUUUGUCAG3' b,\\X\ \\\\\N\\\\N-~-X

I N \ \ \ \ \ % X\ \ ~ . . \ \ \ \ ~ , \ 1

~

5' STEM I

LOOP 2.

STEM 2

,,! 5'

LOOP I U U U U

FIG. 1. Sequence (top) and folding (bottom) for the RNA oligonucleotidePK5 that was designed to form a pseudoknot conformation. Stem and loop regions in the pseudoknot are indicated. Stem 1 is shaded solid black and stem 2 is hatched. the purported stem 1 region of PK5 was single stranded. Where possible, Mg 2+ should be avoided because added Mg 2+ increases the rate of degradation of an NMR sample. The conformations of small hairpin loops, bulges, and internal loops have been shown to have little dependence on divalent cation concentration. Synthesis of Milligram Quantities of RNA In vitro transcription with synthetic D N A templates and phage T7 R N A polymerase is currently the method of choice for the large-scale production of R N A oligonucleotides between 15 and 60 nucleotides. This section discusses the practical aspects of R N A synthesis using T ' / R N A polymerase for the preparation of milligram quantities of R N A (see also Batey et al., Chapter [13]). The source of T7 polymerase for large-scale transcription is usually in-house overproduced and purified enzyme. The cost of commercial T7 R N A polymerase is prohibitive for applications to NMR sample preparation. If T7 R N A polymerase is purchased for small scale synthesis, the high concentration enzyme (>80 units//xL) is required for transcription of short synthetic D N A templates.

[ 14]

RNA PS~UOOrCNOXS

327

The polymerase can be overproduced and purified using any of several published protocols. 11 E. coli strain BL21 harboring the plasmid pAR1219, which contains the gene for T7 RNA polymerase and ampicillin resistance, can be obtained from Dr. W. Studier (Brookhaven National Laboratories, Upton NY 11713). Purification of T7 polymerase is not discussed here; however, two aspects of any purification protocol are important for preparation of NMR quantities of RNA. First, the polymerase must be sufficiently concentrated as a stock solution (>10 mg/ml). This is necessary since high concentrations of polymerase are required in transcription reactions and since this increases the life time of active polymerase upon long-term storage. Second, the purification protocol used must be relatively free of nuclease activity. A nuclease-free polymerase preparation will give much higher yields of full-length RNA. Nuclease activity of polymerase preparations can be easily assayed using a full-length, end-labeled RNA and incubating the transcript for 4 hours in the presence of polymerase. The amount of degradation can be determined by gel electrophoresis and autoradiography.

Sequence Limitations on Synthesis Using 77 Polymerase Oligonucleotides ranging in length from 9 to 43 nucleotides have been synthesized in our laboratory in milligram amounts using T7 polymerase. Yields are template-dependent (see Table I) and vary from 0.03 to 0.2 milligram of pure RNA per mL of transcription reaction. Although overall yield of full-length RNA depends on the sequence of the entire transcript, the nucleotides at the 5'-end of the oligonucleotide are especially important. Certain limitations in sequence variability are inherent in this method of RNA synthesis since transcripts from strong promoters in the bacteriophage genome begin with the sequence 5'GGGAGA3'. Although the weaker bacteriophage promoters vary, pyrimidines are not observed in the first five positions. 12 Attempts have been made to correlate yields with template s e q u e n c e . 13A4 Of the sequences listed in Table I, the transcript with purines in each of the first six positions was synthesized well. However, a transcript of only 10 nucleotides was synthesized in highest yield, and only three of the first six positions are purines. Prediction of yield based on similarity to the wild-type promoter

11 j. R. Wyatt, M. Chastain, and J. D. Puglisi, Biotechniques U , 764 (1991). 12j. j. Dunn and F. W. Studier, J. Mol. Biol. 166, 477 (1983). ~3D. E. Draper, S. A. White, and J. M. Kean, this series, Vol. 164, p. 221, 14 j. F. Milligan, D. R. Groebe, G. W. Witherell, and O. C. Uhlenbeck, Nucleic Acids Res. 15, 8793 (1987).

328

DNA AND RNA STRUCTURE

[14]

TABLE I COMPARISONOF RELATIVEYIELDS OF TRANSCRIPTIONREACTIONS

Sequence

Relative yield a

5'GGAGAAGGAAAGCCCCCUUUCCUUCUCC3' 5'GGGAGCUGAAGAUGGCUGAUAGCCAGAAACCAGGUCCUCCC3' 5'GGGAGUUUGCGGCUUCCCUUUUCCGC3' 5'GGGGCGGCG3' 5'GAGUUACGGCGCCUAGCCG3' 5'GGCUUACGGCGCCUAGCCG3' 5'GGCUACGGCGCCUUAGCCG3' 5'GGCUGACCGCUUUUUUGUCAG3' 5'GCUGACCGCUUUUUUGUCAG3' 5'GCGCCGCCCC3' 5'GCGCUGACCGCUUUUUUGUCAG3' 5'GCGACUGACCGCUUUUUUGUCAG3' 5'GCGAUUCUGACCGCUUUUUUGUCAG3' 5'GCGUUUCUGACCGCUUUUUUGUCAG3' 5'GCGUUUCUGACCGCC3'

4.5 3.5 3.5 3.0 4.5 7.5 4.5 2.0 3.0 10.0 2.0 3.0 1.5 1.5 3.0

a

Yields are based on incorporation of [a-3Ep]GTP in 40/zl transcription reaction volumes. Yields are relative; a value of 10 equals approximately 6 A260 units of RNA from a 1 ml transcription reaction.

sequence appears to be impossible due to the dependence on downstream sequence. There is one absolute sequence requirement for efficient transcription using T7 polymerase: the first nucleotide should be a G. This is a serious limitation of the T7 polymerase method and can be circumvented using chemical synthesis of RNA. The polymerase will prime transcription with a dinucleotide, 5'NG3';15J6 however, low yields and cost of the dinucleotide generally make this prohibitive on large scale.

Transcription Conditions For each new R N A sequence, a new D N A template oligonucleotide must be synthesized, which also contains the promoter region for T7 polymerase. A template for one oligonucleotide is shown in Fig. 2. The "top strand," complementary to the template strand in the promoter region, is the same for each template. Generally, we prepare the top strand on a 15 /xmole scale and purify using gel electrophoresis. This yields top strand for 15 C. Pitulle, R. G. Kleineidam, B. Sproat, and G. Krupp, Gene 112, 101 (1992). 16 V. D. Axelrod and F. R. Kramer, Biochemistry 24, 5716 (1985).

[141

RNA PSEUDOKNOTS top strand

329

+1 y

5'

TAATACGACTCACTATAG 3' ATTATGCTGAGTGATATCGCUAAAGACUGGCGAAAAAACAGUCs' template strand

I

T7 RNA polymer~e

I

s' pppGCGAUI~CUGACCGCUUUUUUGUCAGy FIG. 2. Synthesis of an oligonucleotide using synthetic DNA templates (top) with a doublestranded promoter and single-stranded template region using T7 RNA polymerase. The template strand, beginning at the + 1 position in the double-stranded region is complementary to the RNA oligonucleotide (bottom).

many large-scale transcription reactions. The template strand is synthesized on a 1 /zmole scale and purified by gel electrophoresis to yield enough D N A for several large-scale transcription reactions. The transcription conditions that we have used are essentially those of Milligan et al. 14 and are shown in Table II. Before attempting a large-scale preparation of RNA, these conditions should be optimized using smallscale (50/zl) pilot reactions, incorporating o?ap-NTP. We have found that the optimal concentrations of NTPs and Mg 2+ depend strongly on the template sequence. The range of optimal NTP concentration can be between i and 5 mM of each nucleoside triphosphate. The yield of full-length product is strongly dependent on free Mg 2÷ concentration. The Mg 2+ binds to the phosphate groups of NTPs to create the proper geometry to be used in the active site of the enzyme. We have found that optimal MgZ+/NTP ratio can vary between 0.8 and 4.0 depending on template and polymerase TABLE II REACTIONCONDITIONSFOR TRANSCRIPTIONUSINGT7 RNA POLYME'RASE 40 mM Tris, pH 8.1 1 mM Spermidine (use as 10× buffer) 0.01% (v/v) Triton X-100 5 mM DTT 80 mg/mL Polyethylene glycol (8000 MW) (from 500 mg/mL stock solution) 4 mM each NTP (adjust stock solution to pH 8.1 using ca. 1 M NaOH) 5 mM GMP (optional) (for synthesis of transcripts beginning with monophosphate) 36 mM MgCI2 (if GMP is not used, lower to 28 mM (want about 0.88-1.75 : 1 Mg 2÷ : NTP; optimize)) 300 nM DNA (template and top strand) (must be optimized) 30 U//zL T7 RNA polymerase (optimize)

330

DNA AND RNA STRUCrVRZ

[14]

preparation. The optimum is very sharp, and at higher or lower ratios, the yield of full-length RNA can drop precipitously.

Products of Transcription Using 77 Polymerase An autoradiogram of the products of a typical transcription reaction is shown in Fig. 3. In addition to the product of the desired length, longer and shorter molecules are synthesized. Most of the nucleotide triphosphates

add-ons

fun-length product

failedsequences

aborts

FIo. 3. Autoradiogram of the products of a T7 R N A polymerase transcription reaction separated by polyacrylamide gel electrophoresis, Transcripts are internally labeled with a32P-CTP. Longer transcripts are at the top of the page. The various types of products of the reaction, described in the text, are indicated. The full-length transcript is 26 nt.

[ 141

RNA PSEUDOKNOTS

331

are incorporated into RNAs of eight nucleotides or less. These abortive transcripts are synthesized immediately after initiation when dissociation of the e n z y m e - D N A - R N A complex competes significantly with elongation. Once the polymerase enters elongation phase on long double-stranded D N A templates, it is highly processive. However, with shorter, singlestranded D N A templates, intermediate length fragments are observed that are due either to polymerase dissociation or specific hydrolysis of the R N A product. In addition to shorter fragments, bands slightly longer than the expected product are also observed. Transcripts containing one additional nucleotide at the 3'-end are often synthesized in approximately equimolar amount to the correct length transcript. The identity of this n + 1 nucleotide is usually either A or C. TM Occasionally, bands one nucleotide shorter than the expected product are also observed. Since the most intense band on a gel may not be the most intense product, sequencing and length determination of the isolated transcript are necessary. Transcripts much longer than the expected full-length product are also observed, sometimes in high yield. 17 This heterogeneity makes it critical that the desired band be identified by either sequencing (using either RNases or chemicals) or by 3'-end identification. Product heterogeneity at the 5'- and 3'-end is a serious problem in the preparation of R N A for NMR. T7 polymerase will preferentially initiate transcription with GMP. TM We have found that the efficiency of incorporation of GMP ranges from 60-90%. One reason a 5'-monophosphate is desirable for NMR is that a 5'-triphosphate hydrolyzes over a period of time, leading to a change in the NMR spectrum. Unfortunately, initiating transcription with GMP leads to an additional set of products that must be resolved during the purification step. Thus, a general transcription reaction with GMP present will yield n and n + 1 products of both GMPprimed and GTP-primed RNAs. Care must be taken in purifying products of transcription primed with GMP.

Large-Scale Transcription Reactions Once reaction conditions have been optimized using small-scale (50-100 /~1) reactions, the following standard procedure can be used for largevolume (1-75 mL) transcription reactions. Transcription reactions, under optimized conditions, normally yield between 1 and 5 A26o units/ml (0.030.2 mg/mL). Usually, a 1.0 mL reaction yields sufficient R N A to perform 17 G. Krupp, Nucleic Acids Res. 17, 3032 (1989). 18j. R. Sampson and O. C. Uhlenbeck, Proc. Natl. Acad. Sci. U.S.A. 85~ 1033 (1988).

332

DNA AND RNA STRUCTURE

[14]

optical spectroscopy and any radioactive characterizations (see next section). For NMR quantities 0zmole amounts), larger volume (15-75 mL) reactions are required. Reactions in less than 1.5 mL volume are performed in 1.5 mL Eppendoff tubes. Larger scale reactions require screw-top polypropylene tubes (phenol resistant). All reagents are added before the addition of the polymerase. The reaction mixture is incubated at 37 ° for the desired time (optimized, between 1.5 and 5h). The reaction mixture generally becomes cloudy as magnesium pyrophosphate, generated by the NTP hydrolysis, precipitates. The reaction is quenched by the addition of 0.5 M EDTA for a final EDTA concentration of 50 raM. Chelation of the Mg2+ causes the solution to become clear as the pyrophosphate dissolves. The reaction mixture is then extracted once with an equal volume of distilled phenol (pre-equilibrated with 100 mM Tris, pH 8.1 after extraction three times with an equal volume of 100 mM Tris, pH 8.1). The phenol partitions the polymerase from the reaction mixture. Separation of the phases can be facilitated by brief centrifugation. The aqueous phase (top layer at this pH, but be careful since the relative densities switch at lower pH) is removed using a glass pipet (a Pipetman should not be used with organic solvents). The remaining phenol phase is extracted with about 1/10 volume of 100 mM Tris, pH 8.1. The combined aqueous phase is then extracted with 24/1 chloroform/ isoamyl alcohol to remove the traces of phenol from the aqueous layer. The aqueous phase is adjusted to a sodium acetate concentration of 0.3 M with 3 M sodium acetate, pH 5.2 and precipitated (using 2.5 volumes of ethanol) for at least 4 h at -20 °. The RNA is pelleted by centrifuging at 12,000 x g for 0.5 h.

Purification of the RNA The pellet contains all of the sequences transcribed by the polymerase, including the large amount of abortive transcripts. For purification, we recommend denaturing gel electrophoresis. Gel electrophoresis gives greater resolution than column chromatography and minimizes contamination by the G-rich abortive transcripts in the purified product. Size exclusion chromatography (G-10) may be used to remove the remaining nucleotides and salt after extraction and before electrophoresis, although we do not find this necessary. The pellet should be resuspended in about 1.0 mL of 7 M urea per 10-15 mL of transcription reaction. The large size of the pellet is in part due to EDTA, and it may be difficult to redissolve; heating at 37° and vortexing will speed the process. The gels used for purification contain 20% polyacrylamide (19 : 1, acrylamide : BIS), 7 M urea. Gel dimensions are 35 cm wide by 43 cm long and

[ 14]

RNA PSEUDOKNOTS

333

gels are 3 mm thick (we use adjustable gel apparatus from Owl Scientific). R N A from one 15 mL transcription reaction (in 1 mL of 7 M urea) can be loaded into a single well of about 12 cm. Due to the salt and nucleotides present, one should not run gels at constant voltage as the temperature of the gel will change radically during the course of electrophoresis. The gels should be run at constant power (50 Watts for the gel size given earlier); this results in a high, but uniform, running temperature in the gel that facilitates denaturation of the R N A and improves the resolution of the gels. The product band should be run as close as possible to the bottom of the gel. This high resolution is often needed to separate n and n + i product bands. If GMP is used to prime transcription, additional product bands will be observed on the gel. The 3 mm thick gels give poorer resolution than the thin analytical gels; therefore, bands that were resolved on an analytical gel may co-migrate on a preparative gel. This becomes an acute problem for transcripts longer than 20 nucleotides. The bands are visualized by shadowing the gel with UV light over a fluorescent thin layer chromatography plate and cutting the product bands from the gel. R N A or D N A can be efficiently eluted from gel slices using an Elutrap (Schleicher & Schuell) electroelution apparatus. The gel slices from half of a preparative gel can be loaded into an Elutrap and eluted using TBE as running buffer. To avoid heating, elutions are performed at 4°. Generally, oligonucleotides were eluted into 500/zL volume. After 1-1.5 h at 250 volts, the solution is removed and an additional 500 tzL is added and the process repeated for another 1-1.5 h. We have isolated oligonucleotides of 15 nucleotides or longer in greater than 90% yield. There is significant loss of shorter oligonucleotides. The advantage of electroelution is that only R N A is isolated in the final buffer; in contrast, gravity elution methods ("crush and soak") give significantly lower yields of RNA and have problems of contamination of partially polymerized acrylamide, which is observed in NMR spectra. The purified R N A is then ethanol-precipitated at - 2 0 ° as described previously. The R N A product should be exhaustively dialyzed to remove the remaining salt and any contaminants from the gel. A microdialysis system (Bethesda Research) is ideal for this application. This apparatus consists of a set of eight chambers, which can each hold up to 2.0 mL of sample. The chambers are separated by a piece of dialysis membrane from the buffer, which is circulated through the apparatus by a peristaltic pump. Nominal 1000 molecular weight cut-off dialysis tubing is used for applications with R N A oligonucleotides. This tubing should be well rinsed with H20 to remove the sodium azide preservative. The recommended dialysis sequence for a newly synthesized R N A oligonucleotide follows:

334

DNA AND RNA STRUCTURE

[ 14]

1. 10 mM sodium phosphate, pH 6.4, 5 mM E D T A for 12 h 2. 10 mM sodium phosphate, pH 6.4, 0.1 mM EDTA for 12 h 3. doubly distilled H 2 0 for 24 h Following dialysis, the sample is lyophilized to dryness, resuspended in the desired buffer, and dialyzed versus this buffer for 12 h. Dialysis should be continued until residual acetate from the precipitation is removed, as monitored by the disappearance of the strong acetate peak in the NMR spectrum. Biochemical Assays of RNA Structure Enzymatic and chemical probes provide a powerful methodology for the study of R N A structure 19 and allow direct comparison of small oligonucleotides with large, biologically active RNAs. The reactivity of each nucleotide in an R N A toward either nucleases or chemical reagents can be monitored across a range of temperature and solution conditions that are relevant to NMR conditions. Although chemical probes do not provide structural details at the atomic level, they do allow insight into folding of RNAs at nucleotide resolution. We have extensively used three enzymatic probes, RNases TI and VI and nuclease $I, and two chemical probes, dimethyl sulfate and diethylpyrocarbonate, for structure mapping. Here, we discuss the general properties of these probes and conditions for use. Results of enzymatic and chemical mapping experiments must be interpreted with caution as the sequence and/or structural specificity of the probes are not completely understood. In addition, since the enzymatic probes are either single-strand- or doublestrand specific, they may shift the equilibrium between potential R N A conformations. Higher order R N A structure may stericaIly prevent cleavage by the enzyme and complicate interpretation. The enzymatic structural probes are large, with molecular weights on the order of the R N A oligonucleotides studied. Chemical probes are small relative to the R N A and thus have the potential to give more detailed structural information than enzymatic probes. In mapping experiments, it is critical that the structure probed is that of the conformation adopted by oligonucleotides that have not been cleaved or modified. Since cleavage or modification at a particular position may alter the structure of the RNA, a second cleavage or modification may not monitor the native structure. In practice, secondary cleavage is eliminated by limiting the extent of reaction. The reaction times and amounts of 19 C. Ehresmann, F. Baudin, M. Mougel, P. Romby, J.-P. Ebel, and B. Ehresmann, Nucleic Acids Res. 15, 9019 (1987).

[ 14]

RNA PSEUDOKNOTS

335

enzyme were chosen so that at least 70% of the molecules remained unreacted. Nuclease S1

Nuclease S1 hydrolyzes D N A and R N A in single-stranded regions and is widely used to probe nucleic acid structure. Nuclease $1 shows no sequence specificity, as cleavage of oligonucleotides under denaturing conditions results in uniform cleavage. More than one unstacked nucleotide appears to be required for recognition and cleavage. In tRNA Phe, only the anticodon loop is susceptible to cleavage by S1,2° as tertiary interactions sterically block cleavage by S1 in other regions of the tRNA. The structure of R N A molecules can be probed as a function of temperature using nuclease S1. 9'21 Reaction times and amount of enzyme specified in Table III were adjusted to give approximately the same extent of cleavage of the control molecule 5'AAAAAAC3'. Nuclease S1 digestion at 85 ° in low salt (10 mM NaC1, 5 mM MES, pH 6.3), denaturing conditions, yields a relatively uniform hydrolysis ladder. Cleavage leaves fragments with 5'phosphate and 3'-hydroxyl groups. The ladder of bands generated by S1 digestion under denaturing conditions is used for assignment of bands due to digestion by RNase V1 and nuclease S1 under native conditions. RNase T1

RNase T1 cleaves after single-stranded guanosines. Like nuclease $1, T1 can be used in the presence or absence of Mg 2+ across a range of temperatures. The fragments that result from T1 cleavage, like those generated by alkaline hydrolysis, terminate in 3'-phosphates. As the mobility difference between fragments with 3'-phosphates and 3'-hydroxyl groups is noticeable for fragments containing less than 10 nucleotides, an alkaline hydrolysis cleavage reaction is useful for assignment of nuclease T1 cleavage products. RNase V1

RNase V1 cleaves in helical regions of R N A structure, either base paired duplex or stacked single strands. The specificity of RNase V1 cleavage is not clear, as the intensity of cleavage varies even within duplex regions. No simple sequence specificity is apparent; cleavage may be influenced by groove width or conformational flexibility of a helical region. Although 20 p. Wrede, R. Wurst, J. Voumakis, and A. Rich, J. Biol. Chem. 254, 9608 (1979). 21 A. van Belkum, P. Verlaan, J. B. Kun, C. Pleij, and L. Bosch, Nucleic Acids Res. 16, 1931 (1988).

336

D N A AND R N A STRUCTURE

[141

TABLE III CONDITIONSFORUSE OFBIOCHEMICALPROBES FORRNA STRUCTUREa Temperature (°C)

Time (rain)

Amount

RNase Vl

4 22 37 55

5 3 2 2

0.1 units 0.1 units 0.1 units 0.1 units

5 3 2 1 1

15 units 10 units 10 units 10 units 5 units

5 2 1 0.5

0.003 units 0.003 units 0.003 units 0.003 units

5 2 1 0.5

0.001 units 0.001 units 0.001 units 0.001 units

Nudease S1

4 22 37 55 85 RNase T1 (Mg z+ present)

4 22 37 55 SNase T1 (Mg 2+ absent)

4 22 37 55 DEP 4

22 37 45 55 60 65 70 85

135 105 50 30 30 25 20 10 10

20/~L 20/zL 20/xL 20/xL 10/.~L 10/~L 10/~L 10/zL 10/zL

a Buffer conditions are specified in the text. R N a s e Wl is useful for that R N a s e V1 cleaves of the helix; t h e r e f o r e , cleavage patterns. F o r activity, R N a s e

i d e n t i f y i n g possible helical regions, we have f o u n d helical r e g i o n s well a b o v e the m e l t i n g t e m p e r a t u r e great care m u s t b e used in i n t e r p r e t i n g R N a s e V1 V1 r e q u i r e s b o t h N a + a n d Mg 2+ in low c o n c e n t r a -

[14]

RNA PSEUDOKYOTS

337

tions. Both ions are inhibitory at higher concentrations: Na + above 100 mM and Mg 2+ above 1 mM. 2z The enzyme is active from 4 to 60°. For RNase V1, reaction times and amount of enzyme shown in Table III were adjusted to give about 30% cleavage of the duplex formed by rCGCGCG. Band assignments are done relative to an S1 digestion under denaturing conditions. Chemical Probes

We have used dimethyl sulfate (DMS) modification of guanosine N7 and diethylpyrocarbonate (DEP) modification of adenosine N7 to probe oligonucleotide conformation. The reactivity of an N7 position in R N A depends on the surface accessibility as well as electrostatic factors. Taking both factors into account, 23 the quantitative modification of yeast tRNA Phe can be explained. Chemical probing experiments can be carried out under essentially any buffer condition or temperature; however, chemical probes have an essential disadvantage. Due to the slow rate of reaction (modifications are carried out over many minutes; Table III), chemical reagents give information about average accessibility of a probed position. A pattern of modification may not arise from a single conformation but from multiple conformations in fast equilibrium. Experimentally, the method used for structure mapping of oligonucleotides involves modification of 3'-32p-labeled oligonucleotide. Strand scission is caused by aniline-induced/3-elimination at the site of the modification. Aniline-induced strand scission results in fragments with 5' phosphate and a 3' terminus of unknown but heterogeneous structure. 24 Oligonucleotides mapped with DEP or DMS are radioactively labeled at their 3' termini. RNase V1 digestion of the 3'-end labeled oligonucleotide generates an appropriate ladder for band assignment. Nuclease S1 cleavage of 3'-end labeled fragments does not result in a clean ladder, apparently due to heterogeneity generated at the 5'-termini during cleavage. Wrede et al. 2° found that the presence of the cytosine added during 3'3zp labeling affects the conformation of both yeast tRNA ehe and E. coli tRNA2 c~u. Since the modified R N A is stable before strand scission, labeling may be performed following modification. Postlabeling of oligonucleotides may be necessary if other evidence suggests that the nucleotide added during 3'-end labeling affects the conformation of the RNA. 22 H. B. Lowman and D. E. Draper, J. Biol. Chem. 261, 5396 (1986). 23 S. Furois-Corbin and A. Pullman, Biophys. Chem. 22, 1 (1985). 24 N. K. Kochetkov and E. I. Budovskii, "Organic Chemistry of Nucleic Acids, Part B." Plenum Press, London, 1973.

338

DNA AND RNA STRUCTURE

[ 141

Diethylpyrocarbonate DEP carboxyethylates the N7 position of adenosine. 25 The N7 of adenine is located within the major groove in double-stranded regions, and adenines involved in base pairing are normally not reactive. The carboxyethylation reaction is also sensitive to stacking, z6 Even adenines in hairpin loops are often protected from reactionY ,z7 To determine the amount of D E P and the incubation times required at the reaction temperatures shown in Table III, the oligonucleotide 5'AAAAAAC*pC 3' was used as a control. The incubation time was adjusted to give the same percentage modification of the 5'-terminal adenine at each temperature. At low temperature, the internal adenines were much less reactive than at higher temperatures, presumably due to stacking. The percent modification at each adenine in oligonucleotides can be determined as a function of temperature, and the stability of individual regions of a structure can be estimated. 9'21

Dimethyl Sulfate (DMS) DMS has been used in numerous studies to probe the N7 position of guanine and the N3 position of cytosine. 19 We have used DMS exclusively as a probe for the structure at guanosines. Following DMS treatment, the R N A is treated with sodium borohydride, which results in aniline-induced cleavage after methylated guanosines. The reaction of DMS with guanine at the N7 position is not as sensitive to stacking as is the DEP reaction at the analogous position of adenine.

Experimental Methods R N A used in enzymatic mapping experiments was labeled with 32p at the 5'-end using [T-32p]ATP and T4 polynucleotide kinase. R N A probed with chemical reagents was 3'-end labeled using T4 R N A ligase and cytidine 3',5'[5'-32P]biphosphate ([5'32p]pCP) and then dephosphorylated using calf intestinal phosphatase. The 3' terminal phosphate was removed following 3'-end labeling since this resulted in less heterogeneity in product bands on electrophoresis. Approximately 1 pmol of R N A was labeled for each mapping reaction. Labeled R N A was purified from a denaturing 20% polyacrylamide gel and ethanol precipitated with 3 tzg of unfractionated yeast tRNA per mapping reaction as carrier. The dried R N A was resuspended in a volume equal to 5 tzL times the total number of reactions. Each 25 D. A. Peattie, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980). 16 p. Romby, E. Westhof, R. Toukifimpa, R. Mache, J.-P. Ebel, C. Ehresmann, and B. Ehresmann, Biochemistry 27, 4721 (1988). 27 p. Romby, D. Moras, P. Dumas, J.-P. Ebel, and R. Giege, J. Mol. Biol. 195, 193 (1987).

[14]

RNA PSEUDOKNOTS

339

mapping reaction contained 5 /xL of this stock solution of labeled RNA and carrier RNA, buffer from a 10x stock and water. Each reaction was heated at 90° for 1 min in buffer, cooled, then incubated at least 2 min at the appropriate temperature before addition of enzyme or reagent. RNase V1, nuclease S1, and DEP were replaced approximately every 4 months. Digestions of 5'-32p labeled RNA with RNase V1 (Pharmacia) were carried out in 20/~L of 60 mM NaC1, 5 mM MgCI2, 5 mM Tris, pH 8.1. Nuclease S1 (Pharmacia) and RNase T1 (CalBiochem) digestions were carried out in 20/xL of 60 mM NaC1, 5 mM MES, pH 6.3, with or without 5 mM MgCI:. A ladder for RNase V1 and nuclease S1 band assignments was generated using 5 units of nuclease S1 at 85° for 1 min in 20 ~L of 10 mM NaC1, 5 mM MES, pH 6.3. Ladders for band assignments for RNase T1 were generated by partial alkaline hydrolysis of labeled RNA at 85° for 20 min in 1 mM EDTA, 50 mM sodium carbonate, pH 9.2. Incubation times, temperatures, and amounts of enzymes are listed in Table III. Reactions were stopped by addition of 15 txL of 9 M urea, 0.1% xylene cyanol in 1× TBE (50 mM Tris, 50 mM boric acid, 1 mM EDTA), and freezing at - 7 0 °. In practice, conditions were also varied slightly depending on the extent and stability of structure adopted by the RNA oligonucleotide probed. Reactions of 3'-32p labeled RNA with DEP were carried out in 100/xL of 60 mM sodium cacodylate, pH 7.0 with or without 5 mM MgC12 unless otherwise specified. For each temperature, the amount of DEP (CalBiochem) and incubation time are listed in Table III. Reaction mixtures were vortexed every 15 min throughout the incubation. Following DEP treatment, 50/xL of 1.5 M sodium acetate, pH 4.5, 6/xg of tRNA and 500/zL of ethanol were added and reactions were precipitated for 30 min to 1 hour at - 7 0 °. After pelleting, RNA was reprecipitated from 100/xL of 0.3 M sodium acetate, pH 4.5 and 300/xL ethanol. Strand scission was induced by incubation of dried RNA with 20/~L aniline : acetic acid (1 : 1, vol/vol) for 20 min at 55 ° or 60°. Aniline was purchased from Aldrich and distilled twice; aniline obtained from Fluka (puriss. grade) was used without further purification. Samples were dried by lyophilization, twice redissolved in 20 ~L water, and dried in the speed-vac, then resuspended in 15/xL 9 M urea in 1× TBE. Ladders for band assignments were generated using RNase V1 cleavage of 3'-32p labeled RNA at 60°. All structure-mapping reactions were analyzed using 20% polyacrylamide denaturing gel electrophoresis and autoradiography. Autoradiograms were typically exposed 10 h. DEP modification results were quantitated by excising bands from gels and determining amount of radioactivity in each band using an LKB-Wallac model 1209 scintillation counter. Alternatively a phosphorimager can be used for quantitation. Radioactivity per

340

DNA AND RNA STRUCTURE

[14]

band was converted to percent modification by dividing the counts per minute (cpm) in the band of interest by the sum of the cpms in the band corresponding to unmodified RNA and in bands corresponding to fragments longer than and including the band of interest and multiplying by 100.28

Gel Filtration Chromatography It is important to ascertain whether the oligonucleotides are forming unimolecular, bimolecular, or aggregated structures at the RNA and salt concentrations that will be used for the NMR experiment. Gel filtration chromatography is useful for determination of the molecularity of the structures formed under a range of conditions. The resin of the gel filtration column is porous; large molecules are excluded from the pores and elute from the column before smaller molecules, which are retained in the pores. Monomeric and dimeric structure can be distinguished by comparing the retention time of the molecule of interest to the retention times of RNA molecules of known size. Both native gel electrophoresis29'3° and UV absorbance melting31 can also be used to determine the molecularity of RNA interactions. The dependence of the mid-point, Tin, of the UV melting transition can be used to determine whether the structure formed is monomolecular or bimolecular. The chromatographic and electrophoresis methods have the advantage of physically resolving the species; however, they are limited by the range of RNA and salt concentrations that can be monitored by native gels. The Bio-Rad Bio-Sil SEC 125-5 size exchJsion column contains a hydrophilic silica-based matrix with 125/~ pore size (use of a guard column is recommended). This pore size separates macromolecules in the molecular weight range of 5000-100,000 (from 10 to several hundred nucleotides). The column can operate over a pH range from 2 to 12 and a temperature range from 4 to 80°. The running buffer should be adjusted to reflect the desired NMR solvent, for example, 50 mM NaCl, I0 mM sodium phosphate, pH 6.4 and either 5 mM MgCl2 or 0.1 mM EDTA. By changing sample injection volume and/or the range of the absorbance scale of the detector, the monomer-dimer equilibrium over a range of RNA concentrations could be determined. Kinetics or temperature dependence of dimerization can 2sL. Fairall, D. Rhodes, and A. Klug,J. Mol. Biol. 192, 577 (1986). 29C. Hashimotoand J. A. Steitz, Nucleic Acids Res. 12, 3283 (1984). 30E. Henderson, C. C. Hardin, S. K. Wolk, I. Tinoco, Jr., and E. H. Blackburn, Cell 51, 899 (1987). 31j. D. Puglisiand I. Tinoco,Jr., this series, Vol. 180, p. 304.

[ 14]

R N A PSEUDOKNOTS

341

also be monitored by pre-incubating samples for a required amount of time or at a particular temperature.

Sequence Variants A combination of N M R and biochemical methods can allow the rapid assay of a number of sequence variants in an R N A system of interest. For example, the conformation of one pseudoknot oligonucleotide was characterized in detail, s and biochemical and physical measurements were shown to agree. To investigate the sequence requirements for pseudoknot formation and stability, a large number of variants of this original sequence were synthesized. 9 Oligonucleotides were analyzed for pseudoknot formation using chemical and enzymatic probing experiments. Variants that gave intriguing results in these experiments were then synthesized in large quantities and studied by NMR. Prior assignment of the NMR spectrum of the "wild-type" pseudoknot sequence greatly facilitates the interpretation of the variant oligonucleotide spectra.

Analysis of Conformational Equilibria Using NMR Equilibrium between conformations is a central feature of R N A function, and NMR provides a powerful tool for monitoring conformational changes. Changes in the NMR spectrum can be monitored as solution conditions are changed or a binding ligand, such as a protein, is added. The conformations of the R N A in the absence and presence of a ligand can be compared using standard NMR methods. In addition, NMR techniques can be used to measure the thermodynamic and kinetic parameters of a simple conformational change, for example a two-state equilibrium. The complexity of the NMR spectrum prevents practical analysis of more complicated equilibria. Dipolar interactions induce transitions between two states because the fluctuations occur at approximately the frequency of the transition. Even in the absence of such interactions, magnetization can still be transferred through chemical kinetic processes. If a spin can exist in two environments (specific chemical shifts vA and v~) due to a structural transition, the rate of this exchange process is manifested in several ways in the NMR experiment. The rate constant kf and kr determine how fast magnetization at site A will be transferred to site B. Three different exchange regimes depend on the ratio between the rate constant (k) and the frequency difference between the spins at the two sites (VA -- VB):

342

DNA AND RNA STRUCTURE

[14]

1. Slow exchange: In this case the exchange rate is much slower than the frequency difference between the two resonances kox ~ 2,r(v,, - ~ ) .

Since the exchange is slow, two resonances corresponding to spins at both sites (VA and vB) of exchange are observed. With a chemical shift difference of about 1 ppm, this regime encompasses time constants >50 ms. If the system reaches equilibrium before the acquisition time of the experiment (less than a second), the relative peak areas reflect the relative concentration of species at site A and B, and thus equilibrium constants can be measured. 2. Fast exchange: The exchange rate is much faster than the frequency difference between the two sites kex -> 2rr(~A - ,,~).

Since the exchange is fast compared to the time scale of the NMR experiment, the spins are observed in an average environment. There is just a single resonance at the population-weighted average frequency of site A (vA) and site B (vB). The time scale of these exchange processes is generally less than 1 ms. These fluctuations can manifest themselves in the spectral density terms, especially if they occur on the time scale r ~ 1/o, where c0 is the Larmor frequency for the nucleus. 3. Intermediate exchange: The exchange rate is the same order of magnitude as the frequency difference kox ~- 2rr(,,A - ,'B).

Intermediate exchange conditions lead to broadening of the resonances. The broadening can be minor, or resonances can be broadened into the baseline. The time scale for intermediate exchange processes is 1-50 ms, depending on chemical shift differences. All of these exchange regimes are observed in studies of RNA structure. RNA duplexes are generally in slow exchange with single strands well below their melting temperature. Near the melting temperature, intermediate or fast exchange may occur. For many intramolecular RNA structures, the spectra generally broadened at about 10-15 ° below the Tm and eventually sharpened into a fast exchange regime. Fast exchange during the melting transition is the basis for monitoring melting curves with chemical shift. 9'32 As the structure melts, the weighted average chemical shift of a resonance moves from its value in the double-stranded state toward that in the singlestranded state. Intermediate and slow exchange can occur well below the 32y. T. van den Hoogen, C. Erkelens, G. van der Marel, J. H. van Boom, and C. Altona, Eur. J. Biochem. 173, 295 (1988).

[ 14]

RNA PSZUDOKNOTS

343

melting temperature for exchange between various base paired structures; the high activation energy of breaking many base pairs will slow down a kinetic process. Both slow and fast exchange processes are amenable to quantitative study by NMR.

Fast Exchange Measurements We monitored the melting transition of the pseudoknot oligonucleotide PK5 using the nonexchangeable proton NMR spectrum. On formation of a stacked, base paired duplex, ring current effects will shift the H6, H8, and H2 protons upfield 0.2-1.2 ppm relative to the chemical shift in the single-stranded structure. If the rate of exchange between the two states is fast on the NMR time scale (kex ~> 2trAy), then one observes a single resonance at a chemical shift that is the weighted average of the chemical shift in the single- and double-stranded state: ~obs = f" ~nat -/" (1 - f ) . ~coil, where f = the fraction of native RNA structure and 8obs, ~nat, and 8coil are the observed chemical shift and the chemical shift of the completely native and coil forms, respectively. From the chemical shift as a function of temperature, thermodynamic parameters can be derived as for UV melting data. The advantage of this method is that the melting of individual portions of the RNA molecule can be monitored independently. If separate portions of the molecule have different stabilities, their chemical shift profiles will not be superimposable. Fig. 4 shows spectra of the nonexchangeable protons of pseudoknot PK5 in Mg2+ as a function of temperature. The spectrum shows very little change between 10.0 and 38.0°. Slight upfield and downfield shifts of several resonances are due to slight changes in structure with temperature, possibly due to unstacking, and can be compared to the sloping baselines observed in UV melting experiments. Between 38.0 and 53.0 °, certain resolved resonances (An(H8), Clz(H6), G26(H8), and A25(H2)) broaden. The time scale of exchange between the native and denatured states has reached the intermediate exchange regime. This region of broadening corresponds to the end of the lower baseline (native state) in the UV melting experiment. Not all the resonances of PK5 broaden, since the extent of broadening depends not only on the exchange rate, but also on the frequency difference between the resonance in the two forms. Fortunately, the C12(H6) resonance does not broaden completely into the baseline; therefore, its chemical shift can be monitored as a function of temperature. This shift profile as a function of temperature is shown in Fig. 5; the sigmoidal shape of the NMR melting curve closely resembles the curves obtained when the transition

344

DNA AND RNA STRUCTURE

70"c

[141

L

53"C

~

1

8"C

I

22°C M A4(2) ~ G,(S) i ^/-

10OC A,(S)

~ U~6(6) "~,~ ! %(6) c~(6) c~8) A~(2)

I

I

I

8.4

8.0

7.6

PPM

I

7.2

FIG.4. NMR spectraof the nonexchangeablebaseprotons of PK5 as a functionof temperature in 5 mM MgC12,50 mM NaCI, 10 mM Na phosphate,pH 6.4. Individualresonancesare labeled with their assignments. is monitored by UV or by modification with DEP. The thermodynamic parameters derived from a van't Hoff plot agree closely with the optical melting data. The Tm of the transition is 63.0 ° by NMR versus 63.5° by UV melting; the transition enthalpy is - 5 4 kcal/mol by NMR versus - 5 0 kcal/ mol by UV melting. These differences are within the experimental error.

Slow Exchange Measurements The presence of Mg z+ stabilizes the pseudoknot conformation. In the absence of Mg z+, alternate conformations of similar stability are observed. Any pseudoknot sequence has the potential to form two stable stem-loop structures that we call the 5'- and 3'-hairpins. In the absence of Mg 2÷, a second set of resonances are observed for the oligonucleotide PK5 (Fig. 6). This second set of peaks becomes more intense as the temperature is increased and corresponds to the 5'-hairpin conformation. The assignment

[ 14]

RNA PSEUDOKNOTS 8,2

" 4'+

8.0

345

++

+

+

++-1-4-++4+

A4(H2) Cls(tI6) C12(H6)

-

7.8~3 7.6,•

A A

•

•

•

•AA"

• A A a A A

to

•

o

o

o

•oto

D t

7.4. Q

o •

O

7.2 0

2t)

40

60

80

100

Temperature (oc) FIG. 5. Chemical shift versus temperature profiles for select resonances in PK5 (from the data in Fig. 4). The data for C12(H6) were converted into fraction double strands versus temperature data, which in turn were analyzed to give thermodynamic parameters for the coil-to-helixtransition. of the second set of resonances to the 5'-hairpin was confirmed by synthesis of an oligonucleotide that can only adopt the 5'-hairpin form. Using these assignments, the transition between pseudoknot and 5'hairpin was analyzed. Since two sets of resonances are observed, the pseudoknotted and 5'-hairpin structures are in slow exchange on the N M R time scale (k~x ~ 27rAv). As the temperature was raised, the resonances corresponding to the 5'-hairpin became more intense, whereas those corresponding to the pseudoknot disappeared. One must be wary of interpreting these results in terms of populations of the various structures at high temperatures. Exchange of the imino protons with solvent at temperatures higher than 35 ° will affect resonance intensities. The relative intensities of the imino resonances at lower temperatures (<25 °) can be converted into an equilibrium constant for the transition between pseudoknot and 5'-hairpin. This type of analysis is normally performed on nonexchangeable resonances, 33 but the nonexchangeable spectrum of PK5 in equilibrium between hairpin and pseudoknot is crowded as the number of resonances are approximately doubled. Two possible problems arise when the intensities of imino proton resonances are analyzed quantitatively: (1) the excitation profile in a 1-3-3-1 experiment (or any 33 D. E. Wemmer, S. H. Chou, D. R. Hare, and B. R. Reid, Nucleic Acids Res. 13, 3755 (1985).

346

D N A AND R N A STRUCTURE

. . . . 3' Stem

s~

!

l i

1

[141

!

5' Hairpin

t I

INCREASING Temperature

stem 5 1 ~

Pseudol~ot

i

!

14.4

13.6

PPM

|

i

12.8

12.0

Fio. 6. Temperature dependence of the NMR spectra of the exchangeable imino protons of PK5 in the absence of Mg2+ (50 mM NaCI, 10 mM Na phosphate, pH 6.4, 0.5 mM EDTA) as a function of temperature. As the temperature is raised, the molecule undergoes a transition from pseudoknot conformation to a second structural form with resonances indicated by the arrows. These resonances correspond to 5'-hairpin conformation.

selective excitation experiment) is not uniform, 34 and (2) solvent exchange broadening can affect resonance intensities. These are minor problems in this case. The 1-3-3-1 sequence yields a relatively uniform excitation profile in the region of the excitation maximum (11-14 ppm); therefore, all the imino resonances are relatively equally excited. The resonances for both forms remain relatively sharp during the transition. The ratio of the intensities was converted into an equilibrium constant for pseudoknot formation from 5'-hairpin: PK ~ 5 ' H P K = (PK)/(5'HP). A transition enthalpy can be estimated from a plot of InK versus 1/T. The enthalpy of pseudoknot formation from 5'-hairpin is - 1 8 _ 5 kcal/mol.

Determining Rate Constants by NMR A number of N M R methods can be used for determining the rate constants of chemical processes. For pseudoknots, we were interested in 34p. j. Hore, J. Magn. Reson. 55, 283 (1983).

[ 141

RNA PSEUDOKNOTS

347

determining rate constants in the slow-exchange range. The theory and methodology used is analogous to that used for determining cross-relaxation rates. Consider the exchange process between two sites, A and B: the change in magnetization at spin A as a function of time can be simplified to the following equation, assuming that (1) the spins A and B are not close in space and are therefore not dipolar coupled, and (2) spin B is saturated instantaneously at time t = 035:

dMA(t) dt

kfMA(0).

The initial approach back to equilibrium involves only transfer of magnetization from site A to site B, which initially has zero net magnetization. The initial build-up of this negative "exchange NOE" is governed by the previous equation. The initial rate of build-up is simply - k t . This equation only holds at short times after the initiation of saturation. 36 At longer irradiation times, magnetization at site A is no longer at its equilibrium value, so that spin-lattice (7"1) relaxation occurs and the build-up of exchange NOE is no longer linear. The experimental protocol for determining the two-site exchange rate has two steps. First, the resonances belonging to the exchange partners must be identified. Because of the analogy to NOE, this can be done using 2-D NOESY 37 or ROESY, 38 which has the advantage that exchange crosspeaks are of opposite sign to NOE cross-peaks. Second, the exchange rate must be determined for the exchange partners using the method described previously. The saturation build-up method involves the measurement of exchange NOEs for a proton at one site upon saturation for various times of a resonance corresponding to a proton in the other site. The NOEs are plotted versus irradiation time, and the initial slope gives the rate constant. The exchange partners to be used for the rate determination should be delineated by the following criteria. First, at least one should be reasonably resolved to allow fairly selective irradiation; this is a problem in crowded RNA spectra since slow exchange will double the number of resonances. Second, the partner resonances should be separated by as large a chemical shift as possible. Exchange partners resonate in the same region; therefore, that they are often not separated by more than 1 ppm. The separation is crucial for selective irradiation. If peaks are closer than 150 Hz (0.3 ppm at 500 MHz), saturation of one exchange partner can lead to partial irradia32 I. D. Campbell, C. M. Dobson, R. G. Ratcliffe, and R. J. P. Williams, J. Magn. Reson. 29,

397 (1978). 36 S. Forsen and R. A. Hoffman, J. Chem. Phys. 39, 2892 (1963). 37 j. Jeener, B. H. Meier, P. Bachmann, and R. R. Ernst, 3. Chem. Phys. 71, 4546 (1979). 38 A. Bax and D. G. Davis, J. Magn. Reson. 65, 355 (1985).

348

DNA AND RNA STRUCTURE

[ 141

tion of the exchange partner (decoupler spillover). This manifests itself as apparent N O E intensity. The proton chosen should have a long T1 in both sites, which means it will relax more slowly, and, thus, the build-up curve will remain linear for longer irradiation times. AH2 protons usually have the longest T1 values in RNA. Once exchange partners are chosen, the major experimental parameter to be chosen is the decoupler power. The exchange experiments we describe were performed on the Bruker AM-500 using a dedicated 1H probe. The decoupler power was adjusted to give a minimum power required for complete saturation in 40 ms. Although instantaneous saturation was assumed, in practice the spins will not be saturated instantaneously, but will oscillate as a function of irradiation time until saturation is achieved. 39 For the exchange rates observed, little magnetization transfer occurred in 40 ms. Build-up curves were obtained by acquiring NOE difference spectra with up to 15 different irradiation times. The relaxation delay time was set to 3 s, which allowed for nearly complete relaxation. The choice of irradiation times depends on the exchange rate to be studied. For exchange rates of ca. 2 s -~, irradiation times were concentrated between 40 and 100 ms. For slower exchange rates (0.5 s-l), the build-up curves were linear up to 200-250 ms. Irradiation times were spread through these regions, and the exchange rate was determined by a simple least squares fit of the linear portion of the build-up data. The temperature was varied over a range where significant amounts of both structural forms exist. Temperature ranges are often restricted since, as the temperature is raised, the exchange rates may become too fast, resulting in intermediate exchange broadening. Fig. 7 shows the result of a saturation transfer experiment at a number of irradiation times. The All(H2) resonance in the 5'-hairpin form (8.07 ppm) was irradiated, and an exchange NOE to the All(H2) in the pseudoknot form was observed. The magnitude of the NOE was calculated from the ratio of the area of the NOE peak in the difference spectrum to the area of the resolved C~2(H6) resonance in the control spectrum. The exchange NOE build-up curve (Fig. 7) has a fairly linear portion out to about 100 ms. At short irradiation times (short compared to the time scale of exchange), the build-up should be linear as a function of irradiation time. There appears to be a short induction period at less than 50 ms. Since the saturation is not instantaneous, initially, the NOE does not increase with the proper slope. Thus, only points greater than 50 ms were used for the calculation of the slope. This was only a problem at highest temperature where the exchange rate was most rapid. At longer irradiation times, the 39 G. Wagner and K. Wtithrich, J. Magn. Reson. 33, 675 (1979).

[141

R N A PSEUDOKNOTS

349

0.5

0.4

I

0.3 A Mz

•

•

kf =

0.2

2.90 s "1

////~o

0.1

0.0

a

0.0

0.I

'

Irradiation

I

0.2

,

0.3

0.4

T i m e (s)

FIG, 7. Exchange build-up curve of the magnetization transfer to the An(H2) in the pseudoknot conformation at irradiation of An(H2) in the 5'-hairpin conformation. Exchange transfer intensity (AMz) is plotted versus irradiation time; the initial slope is indicated by the straight line with slope kf and was estimated from a linear least squares fit of the data up to 100 ms. The solution conditions were 2.5 mM MgC12, 50 mM NaC1, 10 mM Na phosphate, pH 6.3 at 29°.

magnetization at A n ( H 2 ) in the p s e u d o k n o t form is considerably perturbed f r o m its equilibrium value, spin-lattice relaxation occurs, and the build-up is no longer linear. T h e build-up at 29.2 ° corresponds to an exchange rate of 2.90 s -1. The activation energy for the exchange between pseudoknot and 5'hairpin can be determined from the t e m p e r a t u r e dependence of the rate constant. The Arrhenius equation relates this dependence to the activation energy (Ea):

dlnk d(1/T)

Ea g '

where R is the universal gas constant. The rate constants for the pseudoknot --->5'-hairpin reaction were determined at five different temperatures using the saturation transfer method. For this particular reaction, approximately the lowest t e m p e r a t u r e that can be p r o b e d with this m e t h o d is 19 ° . A t lower temperature, the rate constant approaches 1/T1, so that the initial build-up is not linear. The Arrhenius plot of the reaction rates is linear, giving an activation energy of about +42 kcal/mol.

350

DNA AND RNA STRUCTURE

[I 5]

Concluding Remarks N M R studies of R N A and RNA-protein interactions are still hindered by real or imagined problems of sample preparation and misbehaving RNAs (aggregation, hydrolysis). Hopefully, the combined biochemical and biophysical approach outlined here will aid in improved design of N M R studies of R N A structure, stability, and dynamics.

Acknowledgments We would like to thank Professor Ignacio Tinoco, Jr., in whose laboratory many of the experiments described here were performed, and who was our inspiration for studying RNA structure.

[ 15] Multidimensional Heteronuclear NMR Experiments for S t r u c t u r e Determination of Isotopically Labeled RNA By ARTHUR PARDI Introduction The application of multidimensional heteronuclear N M R techniques has revolutionized solution structure determinations of proteins, a-3 The enormous increase in resolution afforded by the 3D and 4D heteronuclear N M R experiments accelerates the resonance assignment process and allows structure determinations of much larger proteins. Ready access to uniformly 13C and/or 15N labeled proteins 4 inspired the development of a plethora of heteronuclear N M R experiments for studies of isotopically labeled proteins. However, difficulties in generating isotopically labeled nucleic acids has meant that heteronuclear N M R studies of nucleic acids have trailed behind studies on isotopically labeled proteins. This has changed in the last few years with advances in methods for synthesis of isotopically labeled R N A

1S. W. Fesik and E. R. P. Zuiderweg, Q. Rev. Biophys. 23, 97 (1990). z G. M. Clore and A. M. Gronenborn, Science 252, 1390 (1991). 3 G. M. Clore and A. M. Gronenborn, in "NMR of Proteins" (G. M. Clore and A. M. Gronenborn, eds.), p. 1. CRC Press, Boca Raton, 1993. 4L. P. Mcintosh and F. W. Dahlquist, Q. Rev. Biophys. 23, 1 (1990).

METHODS IN ENZYMOLOGY, VOL. 261

Copyright © 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.