- Email: [email protected]
16S rRNA-targeted probes for specific detection of Thermoanaerobacterium spp., Thermoanaerobacterium thermosaccharolyticum, and Caldicellulosiruptor spp. by fluorescent in situ hybridization in biohydrogen producing systems
international journal of hydrogen energy 33 (2008) 6082–6091
Available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/he
16S rRNA-targeted probes for specific detection of Thermoanaerobacterium spp., Thermoanaerobacterium thermosaccharolyticum, and Caldicellulosiruptor spp. by fluorescent in situ hybridization in biohydrogen producing systems Sompong O-Thonga,b, Poonsuk Prasertsanc, Dimitar Karakasheva, Irini Angelidakia,* a
Department of Environmental Engineering, Technical University of Denmark, Bygningstorvet Bg 115, DK-2800, Kgs Lyngby, Denmark Department of Biology, Faculty of Science, Thaksin University, Patthalung 93110, Thailand c Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat-Yai, Songkhla 90112, Thailand b
article info
abstract
Article history:
16S rRNA gene targeted oligonucleotide probes for specific detection of genera Thermoanaer-
Received 9 June 2008
obacterium (Tbm1282), Caldicellulosiruptor (Ccs432), and specie Thermoanaerobacterium thermo-
Received in revised form
saccharolyticum (Tbmthsacc184) were designed and used to monitor the spatial distribution of
26 July 2008
hydrogen producing bacteria in sludge and granules from anaerobic reactors. The designed
Accepted 27 July 2008
probes were checked for their specificity and then validated using fluorescence in situ
Available online 20 September 2008
hybridization with target microorganisms and non-target microorganisms. Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. were detected with the
Keywords:
probes designed with coverage of 75%, 100% and 93%, respectively. Thermophilic (60 C)
Fluorescent in situ hybridization
hydrogen producing reactors, one fed with sucrose and another, fed with palm oil mill effluent
16S rRNA gene oligonucleotide
comprised of following major groups of hydrogen producers: Thermoanaerobacterium spp. (49%
probe
and 36%), T. thermosaccharolyticum (16% and 10%), phylum Firmicutes (low GþC) gram positive
Thermoanaerobacterium spp.
bacteria (15% and 27%). Extreme-thermophilic (70 C) hydrogen producing reactors, one fed
T. thermosaccharolyticum
with xylose and another, fed with lignocellulosic hydrolysate comprised of following major
Caldicellulosiruptor spp.
groups of hydrogen producers: Caldicellulosiruptor spp. (40.5% and 20.5%), phylum Firmicutes
Thermophilic and extreme-thermo-
(low GþC) gram positive bacteria (17% and 20%), Archaea (7% and 8.5%), and Thermoanaer-
philic reactor systems
obacterium spp. (0% and 5%). Results obtained, showed good applicability of the probes Tbm1282, Tbmthsacc184 and Ccs432 for specific detection and quantification of thermophilic and extreme-thermophilic hydrogen producers in complex environments. Crown Copyright ª 2008 Published by Elsevier Ltd on behalf of International Association for Hydrogen Energy. All rights reserved.
1.
Introduction
Hemoheterotrophic (‘‘dark’’) fermentation of carbohydratebased substrates is a promising application for biological
hydrogen production, compared with photosynthetic (light driven) or chemical applications [1]. Production of hydrogen by dark fermentation is a process that can achieve two simultaneous objectives: the production of bioenergy and
* Corresponding author. Tel.: þ45 4525 1429; fax: þ45 4593 2850. E-mail address: [email protected] (I. Angelidaki). 0360-3199/$ – see front matter Crown Copyright ª 2008 Published by Elsevier Ltd on behalf of International Association for Hydrogen Energy. All rights reserved. doi:10.1016/j.ijhydene.2008.07.094
international journal of hydrogen energy 33 (2008) 6082–6091
reduction of environmental pollution [2]. Dark fermentation process has low energy demands, no oxygen limitation problems, and low capital costs for at least small-scale production facilities compared to light driven processes (100–1000 l H2/h) [3–5]. Hydrogen yields from dark fermentative process can be improved by directing hydrogen production towards acetate formation, and decreasing or preventing butyrate end product formation. Fermentation with thermophiles or extremethermophiles, operating at temperatures higher than 60 C is a way to accomplish high hydrogen yields [6]. Thus, higher temperatures result in higher conversion reactions and hydrogen yields due to more favourable thermodynamics conditions [7]. Thermophilic and extreme-thermophilic microorganisms have a high potential as hydrogen producers [8–11]. A large number of microbial species, including Clostridia, Thermotoga, Thermoanaerobacterium and Caldicellulosiruptor species are efficient producers of hydrogen under thermophilic and extreme-thermophilic conditions during degradation of various types of carbohydrates [12–15]. Thermoanaerobacterium represents anaerobic spore forming thermophilic microorganisms previously found in thermophilic hydrogen producing reactors [9,13–16]. Genus Thermoanaerobacterium especially Thermoanaerobacterium thermosaccharolyticum is capable of hydrogen production from various types of substrate under thermophilic conditions [17–19]. Thermotoga and Caldicellulosiruptor species are extreme-thermophiles that have been tested for hydrogen production from glucose, xylose and paper sludge hydrolysate [7,12,19–23]. However, thermophilic and extreme-thermophilic dark fermentation process still requires further improvement for industrial application. General environmental engineering approaches for hydrogen production are often performed in open systems with mixed microflora with a high species diversity which usually constitutes a challenge for stable system operation. Knowledge of the microbial composition of the major hydrogen producing microorganisms would result in efficient and optimal operation of fermentative hydrogen producing systems (effective control of the start-up and operation) [24]. Therefore, tools for identification of the microbes present in the hydrogen production process are necessary. Fluorescence in situ hybridization (FISH) is a well-established technique for detection and quantification of specific microbial populations in natural and engineered environments [25]. Oligonucleotides targeting the 16S rRNA gene of phylum Firmicutes (LGC 354A, B and C) at various taxonomic levels have previously been published [26], although the percentage coverage of target group Firmicutes was only 45% [27]. However, there was no general 16S rRNA gene probe specific for Thermoanaerobacterium spp. and Caldicellulosiruptor spp., apart from LGC354A, B and C probes that are specific for most of phylum Firmicutes (gram positive bacteria with low GþC content) [28]. Probe LGC354, commonly used for targeting microorganisms from Firmicutes, was found to give unsatisfied results for the identification of hydrogen producing bacteria [13,29,30]. The LGC354 probe was also found not to be specific for order Clostridiales including family Synthophomonadaceae and family Thermoanaerobacteriaceae within phylum Firmicutes [13,29]. The majority of representative thermophilic and extreme-thermophilic hydrogen producing bacteria cannot be detected by LGC354 probes, emphasizing the
6083
need for a probe that covers the Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. The dearth of adequate probes, however, has largely precluded the application of FISH to thermophilic dark fermentative hydrogen producing ecosystems. To remedy this situation, we designed and evaluated genus and specie level 16S rRNA oligonucleotide probes for in situ specific detection and quantification of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp., major phylogenetic groups of microorganisms found in thermophilic and extreme-thermophilic hydrogen producing reactor systems.
2.
Materials and methods
2.1.
Pure and mixed microbial cultures
Bacterial strains were obtained either from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ, Braunschweig, Germany) or isolated directly from thermophilic hydrogen producing bacterial sludge. The following pure cultures were obtained from DSMZ and use as target bacteria (positive controls) in FISH. Thermoanaerobacterium saccharolyticum DSM7060, Thermoanaerobacterium aotearoense DSM8692 for genus specific probe Tbm1282 and T. thermosaccharolyticum DSM571 for both Tbm1282 and specie specific probe Tbmthsacc184, Caldicellulosiruptor saccharolyticus DSM8903, Caldicellulosiruptor acetigenus DSM7040 and Caldicellulosiruptor owensensis DSM13100 for genus specific probe Ccs432. T. thermosaccharolyticum strain PSU-2 isolated from thermophilic hydrogen producing reactor fed with palm oil mill effluent (POME) [19] was used to test both Tbm1282 and Tbmthsacc184. Caldicellulosiruptor spp. isolated from extreme-thermophilic hydrogen producing reactor fed with household solid waste (manuscript in preparation) was also used to test Ccs432. Desulfotomaculum alkaliphilum DSM12257, Geobacillus stearothermophilus DSM2313 and Clostridium thermocellum DSM1237 were used as non-target bacteria (negative controls) for probe Tbm1282 and Ccs432. T. aotearoense DSM8692 was used as negative control for Tbmthsacc184. All microbial strains were cultured according to DSMZ. Aliquots of actively growing pure cultures were immediately fixed for FISH in 4% paraformaldehyde (PFA) [31]. Probes were also tested in mixed cultures to confirm their specificity and applicability in natural and engineered thermophilic anaerobic environments. As sources for the mixed cultures, sludge samples from following reactor system were used: lab-scales thermophilic (60 C) upflow anaerobic sludge blanket reactor (UASB, total volume 0.25 L, liquid volume 0.2) fed with sucrose, operated at HRT 1 h, pH 5.5 and organic loading rate of 46.8 mmol sucrose/L/h; thermophilic intermittent mixed feeding anaerobic sequencing batch reactor (ASBR total volume 3 L, liquid volume 2 L) fed with palm oil mill effluent (POME), operated at HRT 2 d, pH 5.5 and organic loading rate of 60 g COD/L/d; extreme-thermophilic (70 C) UASB (total volume 0.25 L, liquid volume 0.2) fed with xylose, operated at HRT 1 d, pH 6.5 and organic loading of 1 g xylose/l/h; and extreme-thermophilic continuously stirred tank reactor (CSTR, total volume 1 L, liquid volume 0.75) fed with lignocellulosic hydrolysate, operated at HRT 1 d, 70 C, pH 5.5 and organic loading rate of 20 g COD/l/d.
6084
international journal of hydrogen energy 33 (2008) 6082–6091
2.2. 16S rRNA gene phylogenetic analysis and probe design Oligonucleotide probes were designed and evaluated using PRIMROSE as described previously [32]. The 16S rRNA gene databases of Michigan State University [33] and BLAST program of National Center for Biotechnology Information (NCBI) were searched for a specific sequence testing the probe specificity [34]. The database ProbeBase was used for information on oligonucleotide probes known to date [28]. Criteria for the sequence of oligonucleotide probes were 18 bases and no self-complementary structures [35]. The secondary structure of 16S rRNA was also taken to consideration to confirm the potential target is within the single stranded region of the native ribosome. Designed probes were tested using the probe match function of the Ribosomal Database Project (RDP) software package version 9 [36]. The probes were named according to the nomenclature proposed by the Oligonucleotide Probe Database (OPD) [37]. In addition, probes were named with a short name representing the species and a number corresponding to the 50 end position of the probe target region using Escherichia coli 16S rRNA numbering as a reference. Oligonucleotide probe sequences are listed in Table 1 and are available at ProbeBase [28]. Phylogenetic trees based on comparative analysis of the 16S rRNA genes were constructed using distance, parsimony and maximum likelihood methods in Clustal X [38].
2.3.
Probe evaluation
To evaluate the specificity of developed FISH probes, speciesspecific (Tbmthsacc184), genus-specific (Tbm1282 and Ccs432) and domain-specific (LGC354A, B and C) probes were hybridized with target and non-target reference strains. Labeling efficiency, or relative probe fluorescence, was expressed as a ratio (in %) between the probe-conferred fluorescence intensity with the probe-hybridized cells and the fluorescence intensity obtained with the DAPI staining cells. This
parameter is calculated to assess the in situ accessibility of the designed probes by determining the fluorescence intensity of each probe relative to that of DAPI staining cells. This mode of calculation derives from the work of Fuchs et al. [39] that has underlined the importance of the accessibility of the probes to their target sites for the 16S rRNA of E. coli. Specificity of the newly designed probes were also tested with spiked samples (inoculating reference bacteria into methanogenic sludge samples) as described in Gunasekara et al. [40], the latter to confirm probe stringency in a more complex environment. Methanogenic samples were obtained from a potato factory (Kruiningen, Netherlands). The methanogenic sludge samples (10 mL) were then spiked with reference target bacteria (10 mL exponentially grown cells, OD660 ¼ 0.5) for each probe to verify the ability of the selected probes to detect the target species against a background of non-target cells and to estimate the detection limit of the method in mixed cultures environments.
2.4.
Fluorescence in situ hybridization (FISH)
FISH was performed as described by Amann et al. [31], using paraformaldehyde as a fixative and probes listed in Table 1. Oligonucleotide probes were commercially synthesized as 50 labeled oligonucleotides with fluorescein isothiocyanate (FITC) and the indocyanine dye Cy3 (Thermo Electron Biopolymers, Ulm, Germany). For each probe, whole cell hybridization conditions (stringency) were optimized using cultures of target microorganisms and the non-target microorganisms with the lowest number of mismatches to the probes. For elucidation of the hybridization conditions for the probes, hybridization temperature was kept constant at 46 C. The formamide concentration for optimum probe stringency was empirically determined by performing a series of FISH experiments at 5% formamide increments starting at 0% formamide up to a concentration of 50% formamide. Probe stringency experiments were performed in triplicate in order to confirm the result of each probe optimization. The
Table 1 – The optimal formamide and percentage of coverage of target group of 16S rRNA-targeted oligonucleotide probes used in this study Probe name
OPD code
Tbm1282 S-G-Tbm-1282-a-A-18 Tbmthsacc184 S-S-Tbmthsacc-0184a-A-18 Ccs432 S-G-Ccs-0432-a-A-18 ARC915 S-D-Arch-0915-a-A-20 EUB338 I S-D-Bact-0338-a-A-18 EUB338 II S-*-BactP-0338-a-A-18 EUB 338 III S-*-BactV-0338-a-A-18 LGC354A S-*-Lgc-0354-a-A-18 LGC354B LGC354C Ttoga660
Sequence (50 _30 )
TGGGACCTGTTTTCTGGG GCGATGCCGCTTCTCGAC
Target organisms
Genus Thermoanaerobacterium Thermoanaerobacterium thermosaccharolyticum CTCCCCGTCCAAAGAGGT Genus Caldicellulosiruptor GTGCTCCCCCGCCAATTCCT Archaea GCTGCCTCCCGTAGGAGT Most bacteria GCAGCCACCCGTAGGTGT Planctomycetales GCTGCCACCCGTAGGTGT Verrucomicrobiales TGGAAGATTCCCTACTGC Firmicutes (low GþC) gram positive bacteria S-*-Lgc-0354-b-A-18 CGGAAGATTCCCTACTGC Firmicutes (low GþC) gram positive bacteria S-*-Lgc-0354-c-A-18 CCGAAGATTCCCTACTGC Firmicutes (low GþC) gram positive bacteria S-*-Ttoga-0660-a-A-18 GTTCCGTCTCCCTCTACC Thermotogales
Coverage Formamide of target (%) group (%)
Reference
78 –
35 35
Present study Present study
93 – 90 69 93 7
30 30 0–50 0–50 0–50 35
Present study [46] [47] [42] [42] [26]
21
35
[26]
17
35
[26]
48
20
[48]
international journal of hydrogen energy 33 (2008) 6082–6091
optimum formamide concentration recommended in Table 1 corresponds to the highest concentration where the probes hybridize to the target microorganisms (positive control) with the strongest signal intensity and where the non-target microorganisms (negative control) did not hybridize [41]. Newly designed probes were hybridized together with mixture of EUB338 I, II and III probe [42]. DAPI was used for total microbial cell quantification. All hybridizations were performed as simultaneous dual color hybridizations where the EUB338 probe served the role of a general counter stain for all bacteria. Images were acquired with an epifluorescence microscope (Nikon Corporation, Japan) equipped with a 100 W mercury lamp, a 100/1.25 an oil objective and appropriate filter sets for FITC (Croma Technology Corp. USA) and Cy3 (Nikon Corporation, Japan).
2.5. Detection and quantification of the thermophilic and extreme-thermophilic hydrogen producing microorganisms by FISH The newly designed probes were used to quantify Thermoanaerobacterium spp, T. thermosaccharolyticum and Caldicellulosiruptor spp. in hydrogen producing sludge samples. The probes were tested separately and also combined together to verify the possibility of using them in combination in future studies. In addition, the microbial composition of hydrogen producing sludge was determined by FISH with two domain specific oligonucleotide probes (EUB338 targeting Bacteria and ARC915 targeting Archaea), one phylum specific oligonucleotide probes (LGC354 targeting Firmicutes (low GþC) gram positive bacteria), three genus specific oligonucleotide probes (Ccs432 targeting Caldicellulosiruptor, Tbm1282 targeting Thermoanaerobacterium and Ttoga660 targeting Thermotogales) and one species specific oligonucleotide probes (Tbmthsacc184 targeting T. thermosaccharolyticum) covering the main phylogenetic groups of thermophilic and extreme-thermophilic hydrogen producers. Prior to hybridization, sludge samples were dispersed by mild ultrasonic treatment (0.5 min pulsed) for 2 min and suspended in PBS buffer ethanol to final concentration of 50% ethanol [43]. For quantitative analyses, the percentage of area coverage of signals from the probes was calculated using the QuantimentQ500 W (Lecia, Cambridge, England) image analysis system. The abundances of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. were calculated as the ratio of area covered by biomass stained simultaneously with both probes and DAPI to the area covered by DAPI stained biomass alone. For each sample, 25 microscopic fields (92 92 mm) were analyzed. Signal intensity was quantified indirectly as the percentage of cells whose brightness exceeded the visual detection limit [43].
3.
Results and discussion
3.1.
Probe design and specificity
16S rRNA gene sequences of phylum Firmicutes from RDP databases were phylogenetically analyzed and previously published oligonucleotides were evaluated for target group accuracy. A survey of 16S rRNA gene sequence diversity of
6085
phylum Firmicutes was carried out. The genus Thermoanaerobacterium and Caldicellulosiruptor were found clearly separated from hydrogen producing Clostridium spp. (data not shown). Based on the alignment of 16S rRNA sequence of 54 members of Thermoanaerobacterium group, signatures were confirmed by the in silico specificity with the genus targeted. The best signature region specific for whole genus Thermoanaerobacterium was found in region around position 1282–1300 (according E. coli numbering). This signature matched with 16S rRNA gene sequences of Thermoanaerobacterium spp. The probe Tbm1282 specifically designed to target genus Thermoanaerobacterium was completely matched to 16S rRNA gene sequence of 10 cultured species of Thermoanaerobacterium group and 11 non-cultured Thermoanaerobacterium with 75% coverage of Thermoanaerobacterium group. Outside the target group, there is no sequence complementary to Tbm1282. The cultured specie with the lowest number of mismatches (three positions) to the probe sequence was Desulfotomaculum alkaliphilum. Closely related thermophilic genera such as Desulfotomaculum, Geobacillus and Clostridium had more than three mismatches. A useful oligonucleotide probe contains one or more mismatches to non-target sequences [44], while Tbm1282 probe had more than three mismatches indicating its suitability for FISH. According to models of rRNA secondary structure [39], the accessibility of Tbm1282 probe was predicted to be class IV, equaled to class IV accessibility for the probe LGC354. The best signature region specific for species T. thermosaccharolyticum was found in region around position 184. The probe specific for T. thermosaccharolyticum strain, namely Tbmthsacc184, had more than three mismatches within genus Thermoanaerobacterium with exception of T. aotearoense JW/SL-NZ613T which had one mismatch. The accessibility of Tbmthsacc184 was rated class II and it was 100% specific to T. thermosaccharolyticum. Outside target group, no sequence complementary to Tbmthsacc184 was observed. From alignment results of 28 members of genus Caldicellulosiruptor and probes evaluation with in silico method, the best signature specific for whole genus Caldicellulosiruptor was found around position 432. The probe specific for genus Caldicellulosiruptor (Ccs432) was completely matched to 16S rRNA sequence of 16 cultured species of Caldicellulosiruptor and 9 non-cultured Caldicellulosiruptor with 93% coverage of Caldicellulosiruptor. The accessibility of Ccs432 probe was rated class III, compared to class IV accessibility for probe LGC354 targeting phylum Firmicutes. Tbm1282, Tbmthsacc184 and Ccs432 probes covered 75%, 100% and 93% of their target group, respectively. As a consequence of continuously growing sequence databases, coverage and specificity of any probes may change over the time. For instance, probes LGC354A, B and C, were previously applied for Firmicutes [26]. Though originally well designed, it now covers only 45% of target sequence known.
3.2. Evaluations of the specificity of designed oligonucleotide probes Evaluation of probes specificity of Tbm1282, Tbmthsacc184 and Ccs432 probes for Thermoanaerobacterium spp., species T. thermosaccharolyticum and Caldicellulosiruptor spp., respectively,
6086
international journal of hydrogen energy 33 (2008) 6082–6091
were carried out by hybridization of probes with target and non-target microorganisms. The qualitative results for three probes showed that hybridization occurred with target microorganisms and not with non-target microorganisms, demonstrating the specificity of probes designed in silico. Tbm1282 probe was tested against Thermoanaerobacterium spp. isolated from thermophilic hydrogen producing sludge and other strains obtained from culture collections. All probes were hybridized at stringencies between 0% and 50% formamide similarly to other studies performed for specific detection of Bacteria and Archaea (Table 1). The optimal stringencies usually are taken at the highest formamide concentration before specific hybridization signal was lost [45]. The optimal stringency for probes Tbm1282 and Tbmthsacc184 was 35% formamide in the hybridization buffer (Table 1). Cells detection was found to decline when the formamide concentration in hybridization buffer exceeded 35–40%. At optimal stringency, both probes were found to be sufficiently discriminating against non-target microorganisms, while avoiding a loss of signal in target microorganism. As predicted
DAPI binding cells (cells area)
A
from the alignment of the sequence in the target area, the probe hybridized with all the target bacteria tested at optimal stringencies. Tbmthsacc184 probe have one mismatch to sequence of T. aotearoense. This probe showed high specificity towards T. thermosaccharolyticum and did not hybridize with T. aotearoense at optimal stringency. The optimal stringencies for Ccs432 probe were 30% formamide in the hybridization buffer (Table 1). Cells detection decreased when the formamide concentration in the hybridization buffer exceeded 30–35%. At optimal stringencies, Ccs432 probe discriminated well against a non-target organisms, but still fully detected cells of target organisms. Labeling efficiency or relative probe fluorescence, assessed against the DAPI staining cells for each designed probes is presented in Fig. 1. The hybridization percentage was greater than 95% for all three probes tested. Moreover, we noted that all reference strains of the Firmicutes failed to hybridize with LGC354A, B and C. To aid in their meaningful application, newly designed probes should both coverage and specificity be maximized, i.e., to detect most sequences within their target taxon,
250000
B
200000
R2 = 0.97
150000 100000 50000 0 0
50000
100000 150000 200000 250000
C
DAPI binding cells (cells area)
Tbm1282 bindig cells (cells area) 200000
D R2 = 0.91
150000
100000
50000
0
0
50000
100000
150000
200000
E
DAPI binding cells (cells area)
Tbmthsacc184 bindig cells (cell area) 60000
F
40000
R2 = 0.93
20000
0 0
20000
40000
60000
Ccs432 probe binding cells (cells area) Fig. 1 – Epifluorescence microscopic images of pure culture of reference strain (T. thermosaccharolyticum) after FISH with FITC labeled probe Tbm1282 (A), Tbmthsacc184 (C) and (C. saccharolyticus) Ccs432 (E) and correlation between cells counts by DAPI and counts by Tbm1282 (B), correlation between cells counts by DAPI and counts by Tbmthsacc184 (D) and correlation between cells counts by DAPI and counts by Ccs432 (F).
international journal of hydrogen energy 33 (2008) 6082–6091
Table 2 – Average number of cells, hybridized with designed probes, before and after spiking with methanogenic sludgeb Probe Tbm1282 Tbmthsacc184 Ccs432
Before spiking (cells/mL SD)a
After spiking (cells/mL SD)
4.26 0.30 104 5.5 0.35 104 4.75 0.40 104
4.3 0.25 104 5.6 0.22 104 4.9 0.25 104
a SD represents standard deviations from triplicate sampling analysis. b Total microbial number obtained by DAPI staining before and after spiking were 1.76 0.35 109 and 1.8 0.32 109, respectively.
while hybridizing with only a minimum number of non-target sequences [43]. Thus, methanogenic sludge samples were spiked with positive reference bacteria for each probes and hybridized with Tbm1282, Tbmthsacc184 and Ccs432 probes. To distinguish between Thermoanaerobacterium spp., species T. thermosaccharolyticum and Caldicellulosiruptor spp. in complex
6087
mixed culture environment. Methanogenic sludge samples had initial low levels of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. (less than 0.6% measured with the present method). FISH assay specifically detected Thermoanaerobacterium spp., species T. thermosaccharolyticum and Caldicellulosiruptor spp. in sludge samples containing a background of other bacteria. Results obtained (Table 2) demonstrated that probes Tbm1282, Tbmthsacc184 and Ccs432 allowed detection of added T. thermosaccharolyticum and C. saccharolyticus cells in expected amounts. Thus, our newly designed oligonucleotides are suitable for practical application as probes in whole-cell FISH analyses.
3.3. Microbial composition of thermophilic and extremethermophilic hydrogen producing sludge The microbiology of any biological reactor is an important issue in terms of bacterial species composition and viable cell counts, i.e., qualitative and quantitative measurements of bacterial community. The FISH techniques appeared to be an
Fig. 2 – Fluorescence image of sludge samples from thermophilic biohydrogen producing systems stained with DAPI (A and C), green Thermoanaerobacterium spp. detected by Tbm1282 probe labeled with FITC (B) and red T. thermosaccharolyticum detected by Tbmthsacc184 probe with Cy3 (D). Fluorescence images of sludge samples from extreme-thermophilic system stained with DAPI (E) and red Caldicellulosiruptor spp. detected by Ccs432 probe labeled with Cy3 (F).
6088
international journal of hydrogen energy 33 (2008) 6082–6091
effective quantitative tool to obtain knowledge for microbial community structure and its actual contribution to hydrogen production. In addition to optimizing the biohydrogen reactor design, Levin et al. [1] also suggested that further research on dark fermentation should aim at the microbial identification. Therefore, 16S rRNA targeted oligonucleotide probes specific for Thermoanaerobacterium spp. (Tbm1282), T. thermosaccharolyticum (Tbmthsacc184) and Caldicellulosiruptor spp. (Ccs432) were used to monitor and understand microbial ecology in thermophilic (Fig. 2 A–D) and extreme-thermophilic biohydrogen producing reactors (Fig. 2 E and F). DAPI staining was applied on sludge samples and combined with EUB338 mixed probe (EUB338I, EUB338II and EUB338III) covering Eubacteria domain. Together with the probes ARC915, EUB338, LGC354 mixed (LGC354A, B and C) and Ttoga660 (Table 1), many major groups of bacteria known to inhabit thermophilic and extreme-thermophilic dark fermentative hydrogen producing systems were quantified (Fig. 3). Main part of microbial community in the thermophilic (60 C) sludge belonged to Eubacteria with 87–88% of total DAPI binding cells (Fig. 3). Hybridization using probes targeting the Archaea domain also showed few positive cells in all samples with 2–3% of total DAPI binding cells. Thermophilic biohydrogen producing reactors, one fed with sucrose and other, fed with POME were dominated by Thermoanaerobacterium spp. (49% and 36%, respectively) and T. thermosaccharolyticum (16% and 10%, respectively). The majority of bacteria that existed in thermophilic sludge samples was found to be affiliated to Thermoanaerobacterium spp., which could be the predominant hydrogen producing microorganism in thermophilic dark fermentative reactors. The predominant phylogenetic groups of Thermoanaerobacterium spp. detected by FISH in thermophilic hydrogen producing systems were found to be similar to those previously detected by DGGE [9,14–17]. Extreme-thermophilic (70 C) biohydrogen reactors, one fed with xylose and other, fed with lignocellulosic hydrolysate were dominated by Caldicellulosiruptor spp. Microbial
community of both reactors comprised of following major groups of hydrogen producers: Caldicellulosiruptor spp. (40.5% and 20.5%, respectively) and phylum Firmicutes (low GþC) gram positive bacteria (17% and 20%, respectively). High numbers of non-identified bacteria were found in the extreme-thermophilic reactors (21.5% for reactor fed with xylose and 34.8% for reactor fed with lignocellulosic hydrolysate). Most reasonable explanation is that the set of probes used in this study did not cover some extreme-thermophilic hydrogen producing bacteria such as Caldoanaerobacter spp. and Caloramator spp. [22]. Higher amounts of Archaea (7–8.5%) detected at extreme-thermophilic conditions compared to Archaea numbers (2–3%) at thermophilic conditions can be explained with previously documented extreme-thermophilic hydrogen production due to archaeon Thermococcus kodakaraensis KOD1 [10]. Use of probe LGC354, which is commonly used for detection of low-GþC content Gram-positive microorganisms (Firmicutes) such as Clostridium, Streptococcus, Bacillus, and Dialister, resulted in non-satisfactory identification of hydrogen producing bacteria as previously reported in Ref. [29]. As shown in Fig. 4, instead of detecting the spore forming Thermoanaerobacterium, only the thermophilic non-spore forming bacteria were hybridized positive with LGC354. Thus, the application of FISH technique using probe Tbm1282, Tbmthsacc184 and Ccs432 for monitoring hydrogen producing bacteria under thermophilic and extreme-thermophilic conditions would be useful for reactor control due to its accuracy and time savings compared to molecular fingerprinting methods such as DGGE. The genus Thermoanaerobacterium and Caldicellulosiruptor, which is largely missed by the phylum-specific probe LGC354 [26], is well covered by Tbm1282 and Ccs432, with almost identical stringency requirements. Thus, Tbm1282 and Ccs432 can serve as a supplement to LGC354 to extend its coverage. Newly designed probes can successfully provide insight into microbial ecology of thermophilic and extreme-thermophilic dark fermentative hydrogen producing systems.
Cells area (% of tatol DAPI binding cells area)
100 EUB338 mixed 90
ARC915 Ccs432
80
Tbm1282
70
Tbmthsacc184 60
LGC354 mixed Ttoga660
50
not identified
40 30 20 10 0 Thermo-sucrose
Thermo-POME
Extreme-xylose
Extreme-hydrolysate
Hydrogen producing sludge samples Fig. 3 – Microbial community composition of sludge samples from thermophilic hydrogen producing reactors (fed with sucrose and POME) and extreme-thermophilic biohydrogen producing reactors (fed with xylose and lignocellulosic hydrolysate) quantified by FISH. The error bars indicate the standard deviations from a triplicate sampling analysis.
6089
international journal of hydrogen energy 33 (2008) 6082–6091
A
B
Sporulated cells
Fig. 4 – Image of hydrogen producing sludge collected from thermophilic UASB reactor using DAPI staining (A), sporulated cells are indicated with arrows, and FISH with LGC354 mixed probes (B).
4.
Conclusions
Three 16S rRNA gene oligonucleotide probes targeting Thermoanaerobacterium spp. (Tbm1282), T. thermosaccharolyticum (Tbmthsacc184) and Caldicellulosiruptor spp. (Ccs432) were designed and validated by FISH. Tbm1282, Tbmthsacc184 and Ccs432 showed high specificity with 75%, 100% and 93% coverage of target groups, respectively. The three new probes were applied for the assessment of the microbial composition of thermophilic and extreme-thermophilic biohydrogen reactors in association with seven group- and genus-specific probes targeting the main predominant groups of the hydrogen producing bacteria. Results obtained showed the applicability of Tbm1282, Tbmthsacc184 and Ccs432 for specific detection and monitoring of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. in mixed cultures environments such as thermophilic and extreme-thermophilic hydrogen producing systems. The sludge samples from thermophilic biohydrogen reactor contained high amounts of Thermoanaerobacterium spp., 26–59% and T. thermosaccharolyticum, 10–16% from the total population, while sludge samples from extreme-thermophilic biohydrogen producing reactor contained high amount of Caldicellulosiruptor spp., 20.5–40.5% from the total population. Probes Tbm1282, Tbmthsacc184 and Ccs432 will be useful in the future studies to assess and monitoring the presence of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. in hydrogen producing systems, particularly in relation with process control and optimization. Knowledge of the microbial ecology in reactor systems can find application in optimization of thermophilic and extremethermophilic biohydrogen process.
Acknowledgements This work was financial support by Danish Research Council STVF Project No. 2058-03-0020 and the Commission on Higher
Education, Research Group for Development of Microbial Hydrogen Production Process from Biomass (Thailand). Prawit Klongjan is gratefully acknowledged for delivery of extremethermophilic sludge samples.
references
[1] Levin DB, Pitt L, Love M. Biohydrogen production: prospects and limitations to practical application. Int J Hydrogen Energy 2004;29:173–85. [2] Angenent LT, Karim K, Al-Dahhan M, Wrenn BA, Espinosa RD. Production of bioenergy and biochemicals from industrial and agricultural wastewater. Trends Biotechnol 2004;22:476–85. [3] Hawkes FR, Dinsdale R, Hawkes DL, Hussy I. Sustainable fermentative hydrogen production: challenges for process optimization. Int J Hydrogen Energy 2002;27:1339–47. [4] Ustak S, Havrland B, Munoz JOJ, Fernandez EC, Lachman J. Experimental verification of various methods for biological hydrogen production. Int J Hydrogen Energy 2007;32:1736–41. [5] Hawkes FR, Hussy I, Kyazze G, Dinsdale R, Hawkes DL. Continuous dark fermentative hydrogen production by mesophilic microflora: principles and progress. Int J Hydrogen Energy 2007;32:172–84. [6] van Niel EWJ, Claassen PAM, Stams AJM. Substrate and product inhibition of hydrogen production by the extreme thermophile, Caldicellulosiruptor saccharolyticus. Biotechnol Bioeng 2003;81:254–62. [7] Kadar Z, De Vrijek T, van Noorden GE, Budde MAW, Szengyel Z, Reczey K, et al. Yields from glucose, xylose, and paper sludge hydrolysate during hydrogen production by the extreme thermophile Caldicellulosiruptor saccharolyticus. Appl Biochem Biotech 2004;113:497–508. [8] Liu H, Zhang T, Fang HHP. Thermophilic hydrogen production from a cellulose-containing wastewater. Biotechnol Lett 2003;25:365–9. [9] Ahn Y, Park EJ, Oh YK, Park S, Webster G, Weightman AJ. Biofilm microbial community of a thermophilic trickling biofilter used for continuous biohydrogen production. FEMS Microbiol Lett 2005;249:31–8. [10] Kanai T, Imanaka H, Nakajima A, Uwamori K, Omori Y, Fukui T, et al. Continuous hydrogen production by the
6090
[11]
[12]
[13]
[14]
[15]
[16] [17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
international journal of hydrogen energy 33 (2008) 6082–6091
hyperthermophilic archaeon, Thermococcus kodakaraensis KOD1. J Biotechnol 2005;16:271–82. Islam R, Cicek N, Sparling R, Levin D. Effect of substrate loading on hydrogen production during anaerobic fermentation by Clostridium thermocellum 27405. Appl Microbiol Biotechnol 2006;72:576–83. van Niel EWJ, Budde MAW, de Haas GG, van de Wal FJ, Claassen PAM, Stams AJM. Distinctive properties of high hydrogen producing extreme thermophiles, Cadicellulosiruptor saccharolyticus and Thermotoga elfii. Int J Hydrogen Energy 2002;27:1391–8. Zhang T, Liu H, Fang HHP. Biohydrogen production from starch in wastewater under thermophilic condition. J Environ Manage 2003;69:149–56. Shin HS, Youn JH, Kim HS. Hydrogen production from food waste in anaerobic mesophilic and thermophilic acidogenesis. Int J Hydrogen Energy 2004;29:1355–63. O-Thong S, Prasertsan P, Intrasungkha N, Dhamwichukorn S, Birkeland NK. Improvement of biohydrogen production and pollution reduction from palm oil mill effluent with nutrient supplementation at thermophilic condition using an anaerobic sequencing batch reactor. Enzyme Microb Technol 2007;41:583–90. Shin HS, Youn JH. Conversion of food waste into hydrogen by thermophilic acidogenesis. Biodegradation 2005;16:33–44. Ueno Y, Haruta S, Igarashi Y. Microbial community in anaerobic hydrogen producing microflora enriched from sludge compost. Appl Microbiol Biotechnol 2001;57:555–62. Ueno Y, Sasaki D, Fukui H, Haruta S, Ishii M, Igarashi Y. Changes in bacterial community during fermentative hydrogen and acid production from organic waste by thermophilic anaerobic microflora. J Appl Microbiol 2006;101: 331–43. O-Thong S, Prasertsan P, Karakashev D, Angelidaki I. Thermophilic fermentative hydrogen production by the newly isolated Thermoanaerobacterium thermosaccharolyticum PSU-2. Int J Hydrogen Energy 2008;33:1204–14. van Ooteghem SA, Beer SK, Paul CY. Hydrogen production by thermophilic bacteria Thermotoga neapolitana. Appl Biochem Biotech 2002;98–100:177–89. de Vrije T, Mars AE, Budde MAW, Lai MH, Dijkema C, de Waard P, et al. Glycolytic pathway and hydrogen yield studies of the extreme thermophile Caldicellulosiruptor saccharolyticus. Appl Microbiol Biotechnol;74:1358–67. Yokoyama H, Moriya N, Ohmori H, Waki M, Ogino A, Tanaka Y. Community analysis of hydrogen producing extreme thermophilic anaerobic microflora enriched from cow manure with five substrates. Appl Microbiol Biotechnol 2007;77:213–22. de Vrije T, de Haas GG, Tan GB, Keijsers ERP, Classen PAM. Pretreatment of Miscanthus for hydrogen production by Thermotoga elfii. Int J Hydrogen Energy 2002;27:1381–90. Jen JC, Chou CH, Hsu PC, Yu SJ, Chen WE, Lay JJ, et al. FlowFISH analysis and isolation of clostridial strains in an anaerobic semi-solid bio-hydrogen producing system by hydrogenase gene target. Appl Microbiol Biotechnol 2007;74: 1126–34. Amann R, Glo¨ckner FO, Neef A. Modern methods in subsurface microbiology – in situ identification of microorganisms with nucleic acid probes. FEMS Microbiol Rev 1997;20:191–200. Meier H, Amann R, Ludwig W, Schleifer KH. Specific oligonucleotide probes for in situ detection of a major group of gram-positive bacteria with low DNA GþC content. Syst Appl Microbiol 1999;22:186–96. Loy A, Horn M, Wagner M. ProbeBase: an online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res 2003;31:514–6.
[28] Loy A, Maixner F, Wagner M, Horn M. probeBase – an online resource for rRNA-targeted oligonucleotide probes: new features 2007. Nucleic Acids Res 2007;35:800–4. [29] Hung HC, Cheng CH, Cheng LH, Liang CM, Lin CY. Application of Clostridium-specific PCR primers on the analysis of dark fermentation hydrogen-producing bacterial community. Int J Hydrogen Energy 2008;33:1586–92. [30] Hung HC, Lee KS, Cheng LH, Huang YH, Lin PJ, Chang JS. Quantitative analysis of a high-rate hydrogen producing microbial community in anaerobic agitated granular sludge bed bioreactors using glucose as substrate. Appl Microbiol Biotechnol 2007;75:693–701. [31] Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143–69. [32] Ashelford KE, Weightman AJ, Fry JC. PRIMROSE: a computer program for generating and estimating the phylogenetic range of 16S rRNA oligonucleotide probes and primers in conjunction with the RDP-II database. Nucleic Acids Res 2002;30:3481–9. [33] Cole JR, Chai B, Marsh TL, Farris RJ, Wang Q, Kulam SA, et al. The ribosomal database project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res 2003;1:442–3. [34] Altschul SF, Gish W, Miller W, Myers E, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. [35] Stender H, Fiandaca M, Hyldig-Nielsen JJ, Coull J. PNA for rapid microbiology. J Microbiol Methods 2002;48:1–17. [36] Maidak BL, Cole JR, Lilburn TG, Parker Jr CT, Saxman PR, Farris RJ, et al. The RDP-II (ribosomal database project). Nucleic Acids Res 2001;29:173–4. [37] Alm EW, Oerther DB, Larsen N, Stahl DA, Raskin L. The oligonucleotide probe database. Appl Environ Microbiol 1996; 62:3557–9. [38] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673–80. [39] Fuchs BM, Wallner G, Beisker W, Schwippl I, Ludwig W, Amann R. Flow cytometric analysis of the in situ accessibility of Escherichia coli 16S rRNA for fluorescently labeled oligonucleotide probes. Appl Environ Microbiol 1998;64:4973–82. [40] Gunasekera TS, Dorsch MR, Slade MB, Veal DA. Specific detection of Pseudomonas spp. in milk by fluorescence in situ hybridization using ribosomal RNA directed probes. Appl Microbiol 2003;94:936–45. [41] Schmid M, Twachtmann U, Klein M, Strous M, Juretschko S, Jetten M, et al. Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Syst Appl Microbiol 2000;23:93–106. [42] Daims H, Bruhl A, Amann R, Schleifer KH, Wagner M. The domain-specific probe EUB338 is insufficient for the detection of all bacteria: development and evaluation of a more comprehensive probe set. Syst Appl Microbiol 1999; 22:434–44. [43] Rusch A, Amend JP. Order-specific 16S rRNA-targeted oligonucleotide probes for (hyper) thermophilic archaea and bacteria. Extremophiles 2004;8:357–66. [44] Hugenholtz P, Tyson GW, Blackall LL. Design and evaluation of 16S rRNA-targeted oligonucleotide probes for fluorescence in situ hybridization. In: Methods in Molecular Biology (Gene Probes). Humana Press; 2001. p. 29–42. [45] Manz W, Amann R, Ludwig W, Wagner M, Schleifer K-H. Phylogenetic oligonucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst Appl Microbiol 1992;15:593–600.
international journal of hydrogen energy 33 (2008) 6082–6091
[46] Stahl DA, Amann R. Development and application of nucleic acid probes. In: Stackebrandt E, Goodfellow M, editors. Nucleic acid techniques in bacterial systematics. Chichester, UK: John Wiley & Sons Ltd.; 1991. p. 205–48. [47] Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA. Combination of 16S rRNA-targeted oligonucleotide
6091
probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 1990;56:1919–25. [48] Harmsen H, Prieur D, Jeanthon C. Group-specific 16S rRNAtargeted oligonucleotide probes to identify thermophilic bacteria in marine hydrothermal vents. Appl Environ Microbiol 1997;63:4061–8.
Available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/he
16S rRNA-targeted probes for specific detection of Thermoanaerobacterium spp., Thermoanaerobacterium thermosaccharolyticum, and Caldicellulosiruptor spp. by fluorescent in situ hybridization in biohydrogen producing systems Sompong O-Thonga,b, Poonsuk Prasertsanc, Dimitar Karakasheva, Irini Angelidakia,* a
Department of Environmental Engineering, Technical University of Denmark, Bygningstorvet Bg 115, DK-2800, Kgs Lyngby, Denmark Department of Biology, Faculty of Science, Thaksin University, Patthalung 93110, Thailand c Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat-Yai, Songkhla 90112, Thailand b
article info
abstract
Article history:
16S rRNA gene targeted oligonucleotide probes for specific detection of genera Thermoanaer-
Received 9 June 2008
obacterium (Tbm1282), Caldicellulosiruptor (Ccs432), and specie Thermoanaerobacterium thermo-
Received in revised form
saccharolyticum (Tbmthsacc184) were designed and used to monitor the spatial distribution of
26 July 2008
hydrogen producing bacteria in sludge and granules from anaerobic reactors. The designed
Accepted 27 July 2008
probes were checked for their specificity and then validated using fluorescence in situ
Available online 20 September 2008
hybridization with target microorganisms and non-target microorganisms. Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. were detected with the
Keywords:
probes designed with coverage of 75%, 100% and 93%, respectively. Thermophilic (60 C)
Fluorescent in situ hybridization
hydrogen producing reactors, one fed with sucrose and another, fed with palm oil mill effluent
16S rRNA gene oligonucleotide
comprised of following major groups of hydrogen producers: Thermoanaerobacterium spp. (49%
probe
and 36%), T. thermosaccharolyticum (16% and 10%), phylum Firmicutes (low GþC) gram positive
Thermoanaerobacterium spp.
bacteria (15% and 27%). Extreme-thermophilic (70 C) hydrogen producing reactors, one fed
T. thermosaccharolyticum
with xylose and another, fed with lignocellulosic hydrolysate comprised of following major
Caldicellulosiruptor spp.
groups of hydrogen producers: Caldicellulosiruptor spp. (40.5% and 20.5%), phylum Firmicutes
Thermophilic and extreme-thermo-
(low GþC) gram positive bacteria (17% and 20%), Archaea (7% and 8.5%), and Thermoanaer-
philic reactor systems
obacterium spp. (0% and 5%). Results obtained, showed good applicability of the probes Tbm1282, Tbmthsacc184 and Ccs432 for specific detection and quantification of thermophilic and extreme-thermophilic hydrogen producers in complex environments. Crown Copyright ª 2008 Published by Elsevier Ltd on behalf of International Association for Hydrogen Energy. All rights reserved.
1.
Introduction
Hemoheterotrophic (‘‘dark’’) fermentation of carbohydratebased substrates is a promising application for biological
hydrogen production, compared with photosynthetic (light driven) or chemical applications [1]. Production of hydrogen by dark fermentation is a process that can achieve two simultaneous objectives: the production of bioenergy and
* Corresponding author. Tel.: þ45 4525 1429; fax: þ45 4593 2850. E-mail address: [email protected] (I. Angelidaki). 0360-3199/$ – see front matter Crown Copyright ª 2008 Published by Elsevier Ltd on behalf of International Association for Hydrogen Energy. All rights reserved. doi:10.1016/j.ijhydene.2008.07.094
international journal of hydrogen energy 33 (2008) 6082–6091
reduction of environmental pollution [2]. Dark fermentation process has low energy demands, no oxygen limitation problems, and low capital costs for at least small-scale production facilities compared to light driven processes (100–1000 l H2/h) [3–5]. Hydrogen yields from dark fermentative process can be improved by directing hydrogen production towards acetate formation, and decreasing or preventing butyrate end product formation. Fermentation with thermophiles or extremethermophiles, operating at temperatures higher than 60 C is a way to accomplish high hydrogen yields [6]. Thus, higher temperatures result in higher conversion reactions and hydrogen yields due to more favourable thermodynamics conditions [7]. Thermophilic and extreme-thermophilic microorganisms have a high potential as hydrogen producers [8–11]. A large number of microbial species, including Clostridia, Thermotoga, Thermoanaerobacterium and Caldicellulosiruptor species are efficient producers of hydrogen under thermophilic and extreme-thermophilic conditions during degradation of various types of carbohydrates [12–15]. Thermoanaerobacterium represents anaerobic spore forming thermophilic microorganisms previously found in thermophilic hydrogen producing reactors [9,13–16]. Genus Thermoanaerobacterium especially Thermoanaerobacterium thermosaccharolyticum is capable of hydrogen production from various types of substrate under thermophilic conditions [17–19]. Thermotoga and Caldicellulosiruptor species are extreme-thermophiles that have been tested for hydrogen production from glucose, xylose and paper sludge hydrolysate [7,12,19–23]. However, thermophilic and extreme-thermophilic dark fermentation process still requires further improvement for industrial application. General environmental engineering approaches for hydrogen production are often performed in open systems with mixed microflora with a high species diversity which usually constitutes a challenge for stable system operation. Knowledge of the microbial composition of the major hydrogen producing microorganisms would result in efficient and optimal operation of fermentative hydrogen producing systems (effective control of the start-up and operation) [24]. Therefore, tools for identification of the microbes present in the hydrogen production process are necessary. Fluorescence in situ hybridization (FISH) is a well-established technique for detection and quantification of specific microbial populations in natural and engineered environments [25]. Oligonucleotides targeting the 16S rRNA gene of phylum Firmicutes (LGC 354A, B and C) at various taxonomic levels have previously been published [26], although the percentage coverage of target group Firmicutes was only 45% [27]. However, there was no general 16S rRNA gene probe specific for Thermoanaerobacterium spp. and Caldicellulosiruptor spp., apart from LGC354A, B and C probes that are specific for most of phylum Firmicutes (gram positive bacteria with low GþC content) [28]. Probe LGC354, commonly used for targeting microorganisms from Firmicutes, was found to give unsatisfied results for the identification of hydrogen producing bacteria [13,29,30]. The LGC354 probe was also found not to be specific for order Clostridiales including family Synthophomonadaceae and family Thermoanaerobacteriaceae within phylum Firmicutes [13,29]. The majority of representative thermophilic and extreme-thermophilic hydrogen producing bacteria cannot be detected by LGC354 probes, emphasizing the
6083
need for a probe that covers the Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. The dearth of adequate probes, however, has largely precluded the application of FISH to thermophilic dark fermentative hydrogen producing ecosystems. To remedy this situation, we designed and evaluated genus and specie level 16S rRNA oligonucleotide probes for in situ specific detection and quantification of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp., major phylogenetic groups of microorganisms found in thermophilic and extreme-thermophilic hydrogen producing reactor systems.
2.
Materials and methods
2.1.
Pure and mixed microbial cultures
Bacterial strains were obtained either from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ, Braunschweig, Germany) or isolated directly from thermophilic hydrogen producing bacterial sludge. The following pure cultures were obtained from DSMZ and use as target bacteria (positive controls) in FISH. Thermoanaerobacterium saccharolyticum DSM7060, Thermoanaerobacterium aotearoense DSM8692 for genus specific probe Tbm1282 and T. thermosaccharolyticum DSM571 for both Tbm1282 and specie specific probe Tbmthsacc184, Caldicellulosiruptor saccharolyticus DSM8903, Caldicellulosiruptor acetigenus DSM7040 and Caldicellulosiruptor owensensis DSM13100 for genus specific probe Ccs432. T. thermosaccharolyticum strain PSU-2 isolated from thermophilic hydrogen producing reactor fed with palm oil mill effluent (POME) [19] was used to test both Tbm1282 and Tbmthsacc184. Caldicellulosiruptor spp. isolated from extreme-thermophilic hydrogen producing reactor fed with household solid waste (manuscript in preparation) was also used to test Ccs432. Desulfotomaculum alkaliphilum DSM12257, Geobacillus stearothermophilus DSM2313 and Clostridium thermocellum DSM1237 were used as non-target bacteria (negative controls) for probe Tbm1282 and Ccs432. T. aotearoense DSM8692 was used as negative control for Tbmthsacc184. All microbial strains were cultured according to DSMZ. Aliquots of actively growing pure cultures were immediately fixed for FISH in 4% paraformaldehyde (PFA) [31]. Probes were also tested in mixed cultures to confirm their specificity and applicability in natural and engineered thermophilic anaerobic environments. As sources for the mixed cultures, sludge samples from following reactor system were used: lab-scales thermophilic (60 C) upflow anaerobic sludge blanket reactor (UASB, total volume 0.25 L, liquid volume 0.2) fed with sucrose, operated at HRT 1 h, pH 5.5 and organic loading rate of 46.8 mmol sucrose/L/h; thermophilic intermittent mixed feeding anaerobic sequencing batch reactor (ASBR total volume 3 L, liquid volume 2 L) fed with palm oil mill effluent (POME), operated at HRT 2 d, pH 5.5 and organic loading rate of 60 g COD/L/d; extreme-thermophilic (70 C) UASB (total volume 0.25 L, liquid volume 0.2) fed with xylose, operated at HRT 1 d, pH 6.5 and organic loading of 1 g xylose/l/h; and extreme-thermophilic continuously stirred tank reactor (CSTR, total volume 1 L, liquid volume 0.75) fed with lignocellulosic hydrolysate, operated at HRT 1 d, 70 C, pH 5.5 and organic loading rate of 20 g COD/l/d.
6084
international journal of hydrogen energy 33 (2008) 6082–6091
2.2. 16S rRNA gene phylogenetic analysis and probe design Oligonucleotide probes were designed and evaluated using PRIMROSE as described previously [32]. The 16S rRNA gene databases of Michigan State University [33] and BLAST program of National Center for Biotechnology Information (NCBI) were searched for a specific sequence testing the probe specificity [34]. The database ProbeBase was used for information on oligonucleotide probes known to date [28]. Criteria for the sequence of oligonucleotide probes were 18 bases and no self-complementary structures [35]. The secondary structure of 16S rRNA was also taken to consideration to confirm the potential target is within the single stranded region of the native ribosome. Designed probes were tested using the probe match function of the Ribosomal Database Project (RDP) software package version 9 [36]. The probes were named according to the nomenclature proposed by the Oligonucleotide Probe Database (OPD) [37]. In addition, probes were named with a short name representing the species and a number corresponding to the 50 end position of the probe target region using Escherichia coli 16S rRNA numbering as a reference. Oligonucleotide probe sequences are listed in Table 1 and are available at ProbeBase [28]. Phylogenetic trees based on comparative analysis of the 16S rRNA genes were constructed using distance, parsimony and maximum likelihood methods in Clustal X [38].
2.3.
Probe evaluation
To evaluate the specificity of developed FISH probes, speciesspecific (Tbmthsacc184), genus-specific (Tbm1282 and Ccs432) and domain-specific (LGC354A, B and C) probes were hybridized with target and non-target reference strains. Labeling efficiency, or relative probe fluorescence, was expressed as a ratio (in %) between the probe-conferred fluorescence intensity with the probe-hybridized cells and the fluorescence intensity obtained with the DAPI staining cells. This
parameter is calculated to assess the in situ accessibility of the designed probes by determining the fluorescence intensity of each probe relative to that of DAPI staining cells. This mode of calculation derives from the work of Fuchs et al. [39] that has underlined the importance of the accessibility of the probes to their target sites for the 16S rRNA of E. coli. Specificity of the newly designed probes were also tested with spiked samples (inoculating reference bacteria into methanogenic sludge samples) as described in Gunasekara et al. [40], the latter to confirm probe stringency in a more complex environment. Methanogenic samples were obtained from a potato factory (Kruiningen, Netherlands). The methanogenic sludge samples (10 mL) were then spiked with reference target bacteria (10 mL exponentially grown cells, OD660 ¼ 0.5) for each probe to verify the ability of the selected probes to detect the target species against a background of non-target cells and to estimate the detection limit of the method in mixed cultures environments.
2.4.
Fluorescence in situ hybridization (FISH)
FISH was performed as described by Amann et al. [31], using paraformaldehyde as a fixative and probes listed in Table 1. Oligonucleotide probes were commercially synthesized as 50 labeled oligonucleotides with fluorescein isothiocyanate (FITC) and the indocyanine dye Cy3 (Thermo Electron Biopolymers, Ulm, Germany). For each probe, whole cell hybridization conditions (stringency) were optimized using cultures of target microorganisms and the non-target microorganisms with the lowest number of mismatches to the probes. For elucidation of the hybridization conditions for the probes, hybridization temperature was kept constant at 46 C. The formamide concentration for optimum probe stringency was empirically determined by performing a series of FISH experiments at 5% formamide increments starting at 0% formamide up to a concentration of 50% formamide. Probe stringency experiments were performed in triplicate in order to confirm the result of each probe optimization. The
Table 1 – The optimal formamide and percentage of coverage of target group of 16S rRNA-targeted oligonucleotide probes used in this study Probe name
OPD code
Tbm1282 S-G-Tbm-1282-a-A-18 Tbmthsacc184 S-S-Tbmthsacc-0184a-A-18 Ccs432 S-G-Ccs-0432-a-A-18 ARC915 S-D-Arch-0915-a-A-20 EUB338 I S-D-Bact-0338-a-A-18 EUB338 II S-*-BactP-0338-a-A-18 EUB 338 III S-*-BactV-0338-a-A-18 LGC354A S-*-Lgc-0354-a-A-18 LGC354B LGC354C Ttoga660
Sequence (50 _30 )
TGGGACCTGTTTTCTGGG GCGATGCCGCTTCTCGAC
Target organisms
Genus Thermoanaerobacterium Thermoanaerobacterium thermosaccharolyticum CTCCCCGTCCAAAGAGGT Genus Caldicellulosiruptor GTGCTCCCCCGCCAATTCCT Archaea GCTGCCTCCCGTAGGAGT Most bacteria GCAGCCACCCGTAGGTGT Planctomycetales GCTGCCACCCGTAGGTGT Verrucomicrobiales TGGAAGATTCCCTACTGC Firmicutes (low GþC) gram positive bacteria S-*-Lgc-0354-b-A-18 CGGAAGATTCCCTACTGC Firmicutes (low GþC) gram positive bacteria S-*-Lgc-0354-c-A-18 CCGAAGATTCCCTACTGC Firmicutes (low GþC) gram positive bacteria S-*-Ttoga-0660-a-A-18 GTTCCGTCTCCCTCTACC Thermotogales
Coverage Formamide of target (%) group (%)
Reference
78 –
35 35
Present study Present study
93 – 90 69 93 7
30 30 0–50 0–50 0–50 35
Present study [46] [47] [42] [42] [26]
21
35
[26]
17
35
[26]
48
20
[48]
international journal of hydrogen energy 33 (2008) 6082–6091
optimum formamide concentration recommended in Table 1 corresponds to the highest concentration where the probes hybridize to the target microorganisms (positive control) with the strongest signal intensity and where the non-target microorganisms (negative control) did not hybridize [41]. Newly designed probes were hybridized together with mixture of EUB338 I, II and III probe [42]. DAPI was used for total microbial cell quantification. All hybridizations were performed as simultaneous dual color hybridizations where the EUB338 probe served the role of a general counter stain for all bacteria. Images were acquired with an epifluorescence microscope (Nikon Corporation, Japan) equipped with a 100 W mercury lamp, a 100/1.25 an oil objective and appropriate filter sets for FITC (Croma Technology Corp. USA) and Cy3 (Nikon Corporation, Japan).
2.5. Detection and quantification of the thermophilic and extreme-thermophilic hydrogen producing microorganisms by FISH The newly designed probes were used to quantify Thermoanaerobacterium spp, T. thermosaccharolyticum and Caldicellulosiruptor spp. in hydrogen producing sludge samples. The probes were tested separately and also combined together to verify the possibility of using them in combination in future studies. In addition, the microbial composition of hydrogen producing sludge was determined by FISH with two domain specific oligonucleotide probes (EUB338 targeting Bacteria and ARC915 targeting Archaea), one phylum specific oligonucleotide probes (LGC354 targeting Firmicutes (low GþC) gram positive bacteria), three genus specific oligonucleotide probes (Ccs432 targeting Caldicellulosiruptor, Tbm1282 targeting Thermoanaerobacterium and Ttoga660 targeting Thermotogales) and one species specific oligonucleotide probes (Tbmthsacc184 targeting T. thermosaccharolyticum) covering the main phylogenetic groups of thermophilic and extreme-thermophilic hydrogen producers. Prior to hybridization, sludge samples were dispersed by mild ultrasonic treatment (0.5 min pulsed) for 2 min and suspended in PBS buffer ethanol to final concentration of 50% ethanol [43]. For quantitative analyses, the percentage of area coverage of signals from the probes was calculated using the QuantimentQ500 W (Lecia, Cambridge, England) image analysis system. The abundances of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. were calculated as the ratio of area covered by biomass stained simultaneously with both probes and DAPI to the area covered by DAPI stained biomass alone. For each sample, 25 microscopic fields (92 92 mm) were analyzed. Signal intensity was quantified indirectly as the percentage of cells whose brightness exceeded the visual detection limit [43].
3.
Results and discussion
3.1.
Probe design and specificity
16S rRNA gene sequences of phylum Firmicutes from RDP databases were phylogenetically analyzed and previously published oligonucleotides were evaluated for target group accuracy. A survey of 16S rRNA gene sequence diversity of
6085
phylum Firmicutes was carried out. The genus Thermoanaerobacterium and Caldicellulosiruptor were found clearly separated from hydrogen producing Clostridium spp. (data not shown). Based on the alignment of 16S rRNA sequence of 54 members of Thermoanaerobacterium group, signatures were confirmed by the in silico specificity with the genus targeted. The best signature region specific for whole genus Thermoanaerobacterium was found in region around position 1282–1300 (according E. coli numbering). This signature matched with 16S rRNA gene sequences of Thermoanaerobacterium spp. The probe Tbm1282 specifically designed to target genus Thermoanaerobacterium was completely matched to 16S rRNA gene sequence of 10 cultured species of Thermoanaerobacterium group and 11 non-cultured Thermoanaerobacterium with 75% coverage of Thermoanaerobacterium group. Outside the target group, there is no sequence complementary to Tbm1282. The cultured specie with the lowest number of mismatches (three positions) to the probe sequence was Desulfotomaculum alkaliphilum. Closely related thermophilic genera such as Desulfotomaculum, Geobacillus and Clostridium had more than three mismatches. A useful oligonucleotide probe contains one or more mismatches to non-target sequences [44], while Tbm1282 probe had more than three mismatches indicating its suitability for FISH. According to models of rRNA secondary structure [39], the accessibility of Tbm1282 probe was predicted to be class IV, equaled to class IV accessibility for the probe LGC354. The best signature region specific for species T. thermosaccharolyticum was found in region around position 184. The probe specific for T. thermosaccharolyticum strain, namely Tbmthsacc184, had more than three mismatches within genus Thermoanaerobacterium with exception of T. aotearoense JW/SL-NZ613T which had one mismatch. The accessibility of Tbmthsacc184 was rated class II and it was 100% specific to T. thermosaccharolyticum. Outside target group, no sequence complementary to Tbmthsacc184 was observed. From alignment results of 28 members of genus Caldicellulosiruptor and probes evaluation with in silico method, the best signature specific for whole genus Caldicellulosiruptor was found around position 432. The probe specific for genus Caldicellulosiruptor (Ccs432) was completely matched to 16S rRNA sequence of 16 cultured species of Caldicellulosiruptor and 9 non-cultured Caldicellulosiruptor with 93% coverage of Caldicellulosiruptor. The accessibility of Ccs432 probe was rated class III, compared to class IV accessibility for probe LGC354 targeting phylum Firmicutes. Tbm1282, Tbmthsacc184 and Ccs432 probes covered 75%, 100% and 93% of their target group, respectively. As a consequence of continuously growing sequence databases, coverage and specificity of any probes may change over the time. For instance, probes LGC354A, B and C, were previously applied for Firmicutes [26]. Though originally well designed, it now covers only 45% of target sequence known.
3.2. Evaluations of the specificity of designed oligonucleotide probes Evaluation of probes specificity of Tbm1282, Tbmthsacc184 and Ccs432 probes for Thermoanaerobacterium spp., species T. thermosaccharolyticum and Caldicellulosiruptor spp., respectively,
6086
international journal of hydrogen energy 33 (2008) 6082–6091
were carried out by hybridization of probes with target and non-target microorganisms. The qualitative results for three probes showed that hybridization occurred with target microorganisms and not with non-target microorganisms, demonstrating the specificity of probes designed in silico. Tbm1282 probe was tested against Thermoanaerobacterium spp. isolated from thermophilic hydrogen producing sludge and other strains obtained from culture collections. All probes were hybridized at stringencies between 0% and 50% formamide similarly to other studies performed for specific detection of Bacteria and Archaea (Table 1). The optimal stringencies usually are taken at the highest formamide concentration before specific hybridization signal was lost [45]. The optimal stringency for probes Tbm1282 and Tbmthsacc184 was 35% formamide in the hybridization buffer (Table 1). Cells detection was found to decline when the formamide concentration in hybridization buffer exceeded 35–40%. At optimal stringency, both probes were found to be sufficiently discriminating against non-target microorganisms, while avoiding a loss of signal in target microorganism. As predicted
DAPI binding cells (cells area)
A
from the alignment of the sequence in the target area, the probe hybridized with all the target bacteria tested at optimal stringencies. Tbmthsacc184 probe have one mismatch to sequence of T. aotearoense. This probe showed high specificity towards T. thermosaccharolyticum and did not hybridize with T. aotearoense at optimal stringency. The optimal stringencies for Ccs432 probe were 30% formamide in the hybridization buffer (Table 1). Cells detection decreased when the formamide concentration in the hybridization buffer exceeded 30–35%. At optimal stringencies, Ccs432 probe discriminated well against a non-target organisms, but still fully detected cells of target organisms. Labeling efficiency or relative probe fluorescence, assessed against the DAPI staining cells for each designed probes is presented in Fig. 1. The hybridization percentage was greater than 95% for all three probes tested. Moreover, we noted that all reference strains of the Firmicutes failed to hybridize with LGC354A, B and C. To aid in their meaningful application, newly designed probes should both coverage and specificity be maximized, i.e., to detect most sequences within their target taxon,
250000
B
200000
R2 = 0.97
150000 100000 50000 0 0
50000
100000 150000 200000 250000
C
DAPI binding cells (cells area)
Tbm1282 bindig cells (cells area) 200000
D R2 = 0.91
150000
100000
50000
0
0
50000
100000
150000
200000
E
DAPI binding cells (cells area)
Tbmthsacc184 bindig cells (cell area) 60000
F
40000
R2 = 0.93
20000
0 0
20000
40000
60000
Ccs432 probe binding cells (cells area) Fig. 1 – Epifluorescence microscopic images of pure culture of reference strain (T. thermosaccharolyticum) after FISH with FITC labeled probe Tbm1282 (A), Tbmthsacc184 (C) and (C. saccharolyticus) Ccs432 (E) and correlation between cells counts by DAPI and counts by Tbm1282 (B), correlation between cells counts by DAPI and counts by Tbmthsacc184 (D) and correlation between cells counts by DAPI and counts by Ccs432 (F).
international journal of hydrogen energy 33 (2008) 6082–6091
Table 2 – Average number of cells, hybridized with designed probes, before and after spiking with methanogenic sludgeb Probe Tbm1282 Tbmthsacc184 Ccs432
Before spiking (cells/mL SD)a
After spiking (cells/mL SD)
4.26 0.30 104 5.5 0.35 104 4.75 0.40 104
4.3 0.25 104 5.6 0.22 104 4.9 0.25 104
a SD represents standard deviations from triplicate sampling analysis. b Total microbial number obtained by DAPI staining before and after spiking were 1.76 0.35 109 and 1.8 0.32 109, respectively.
while hybridizing with only a minimum number of non-target sequences [43]. Thus, methanogenic sludge samples were spiked with positive reference bacteria for each probes and hybridized with Tbm1282, Tbmthsacc184 and Ccs432 probes. To distinguish between Thermoanaerobacterium spp., species T. thermosaccharolyticum and Caldicellulosiruptor spp. in complex
6087
mixed culture environment. Methanogenic sludge samples had initial low levels of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. (less than 0.6% measured with the present method). FISH assay specifically detected Thermoanaerobacterium spp., species T. thermosaccharolyticum and Caldicellulosiruptor spp. in sludge samples containing a background of other bacteria. Results obtained (Table 2) demonstrated that probes Tbm1282, Tbmthsacc184 and Ccs432 allowed detection of added T. thermosaccharolyticum and C. saccharolyticus cells in expected amounts. Thus, our newly designed oligonucleotides are suitable for practical application as probes in whole-cell FISH analyses.
3.3. Microbial composition of thermophilic and extremethermophilic hydrogen producing sludge The microbiology of any biological reactor is an important issue in terms of bacterial species composition and viable cell counts, i.e., qualitative and quantitative measurements of bacterial community. The FISH techniques appeared to be an
Fig. 2 – Fluorescence image of sludge samples from thermophilic biohydrogen producing systems stained with DAPI (A and C), green Thermoanaerobacterium spp. detected by Tbm1282 probe labeled with FITC (B) and red T. thermosaccharolyticum detected by Tbmthsacc184 probe with Cy3 (D). Fluorescence images of sludge samples from extreme-thermophilic system stained with DAPI (E) and red Caldicellulosiruptor spp. detected by Ccs432 probe labeled with Cy3 (F).
6088
international journal of hydrogen energy 33 (2008) 6082–6091
effective quantitative tool to obtain knowledge for microbial community structure and its actual contribution to hydrogen production. In addition to optimizing the biohydrogen reactor design, Levin et al. [1] also suggested that further research on dark fermentation should aim at the microbial identification. Therefore, 16S rRNA targeted oligonucleotide probes specific for Thermoanaerobacterium spp. (Tbm1282), T. thermosaccharolyticum (Tbmthsacc184) and Caldicellulosiruptor spp. (Ccs432) were used to monitor and understand microbial ecology in thermophilic (Fig. 2 A–D) and extreme-thermophilic biohydrogen producing reactors (Fig. 2 E and F). DAPI staining was applied on sludge samples and combined with EUB338 mixed probe (EUB338I, EUB338II and EUB338III) covering Eubacteria domain. Together with the probes ARC915, EUB338, LGC354 mixed (LGC354A, B and C) and Ttoga660 (Table 1), many major groups of bacteria known to inhabit thermophilic and extreme-thermophilic dark fermentative hydrogen producing systems were quantified (Fig. 3). Main part of microbial community in the thermophilic (60 C) sludge belonged to Eubacteria with 87–88% of total DAPI binding cells (Fig. 3). Hybridization using probes targeting the Archaea domain also showed few positive cells in all samples with 2–3% of total DAPI binding cells. Thermophilic biohydrogen producing reactors, one fed with sucrose and other, fed with POME were dominated by Thermoanaerobacterium spp. (49% and 36%, respectively) and T. thermosaccharolyticum (16% and 10%, respectively). The majority of bacteria that existed in thermophilic sludge samples was found to be affiliated to Thermoanaerobacterium spp., which could be the predominant hydrogen producing microorganism in thermophilic dark fermentative reactors. The predominant phylogenetic groups of Thermoanaerobacterium spp. detected by FISH in thermophilic hydrogen producing systems were found to be similar to those previously detected by DGGE [9,14–17]. Extreme-thermophilic (70 C) biohydrogen reactors, one fed with xylose and other, fed with lignocellulosic hydrolysate were dominated by Caldicellulosiruptor spp. Microbial
community of both reactors comprised of following major groups of hydrogen producers: Caldicellulosiruptor spp. (40.5% and 20.5%, respectively) and phylum Firmicutes (low GþC) gram positive bacteria (17% and 20%, respectively). High numbers of non-identified bacteria were found in the extreme-thermophilic reactors (21.5% for reactor fed with xylose and 34.8% for reactor fed with lignocellulosic hydrolysate). Most reasonable explanation is that the set of probes used in this study did not cover some extreme-thermophilic hydrogen producing bacteria such as Caldoanaerobacter spp. and Caloramator spp. [22]. Higher amounts of Archaea (7–8.5%) detected at extreme-thermophilic conditions compared to Archaea numbers (2–3%) at thermophilic conditions can be explained with previously documented extreme-thermophilic hydrogen production due to archaeon Thermococcus kodakaraensis KOD1 [10]. Use of probe LGC354, which is commonly used for detection of low-GþC content Gram-positive microorganisms (Firmicutes) such as Clostridium, Streptococcus, Bacillus, and Dialister, resulted in non-satisfactory identification of hydrogen producing bacteria as previously reported in Ref. [29]. As shown in Fig. 4, instead of detecting the spore forming Thermoanaerobacterium, only the thermophilic non-spore forming bacteria were hybridized positive with LGC354. Thus, the application of FISH technique using probe Tbm1282, Tbmthsacc184 and Ccs432 for monitoring hydrogen producing bacteria under thermophilic and extreme-thermophilic conditions would be useful for reactor control due to its accuracy and time savings compared to molecular fingerprinting methods such as DGGE. The genus Thermoanaerobacterium and Caldicellulosiruptor, which is largely missed by the phylum-specific probe LGC354 [26], is well covered by Tbm1282 and Ccs432, with almost identical stringency requirements. Thus, Tbm1282 and Ccs432 can serve as a supplement to LGC354 to extend its coverage. Newly designed probes can successfully provide insight into microbial ecology of thermophilic and extreme-thermophilic dark fermentative hydrogen producing systems.
Cells area (% of tatol DAPI binding cells area)
100 EUB338 mixed 90
ARC915 Ccs432
80
Tbm1282
70
Tbmthsacc184 60
LGC354 mixed Ttoga660
50
not identified
40 30 20 10 0 Thermo-sucrose
Thermo-POME
Extreme-xylose
Extreme-hydrolysate
Hydrogen producing sludge samples Fig. 3 – Microbial community composition of sludge samples from thermophilic hydrogen producing reactors (fed with sucrose and POME) and extreme-thermophilic biohydrogen producing reactors (fed with xylose and lignocellulosic hydrolysate) quantified by FISH. The error bars indicate the standard deviations from a triplicate sampling analysis.
6089
international journal of hydrogen energy 33 (2008) 6082–6091
A
B
Sporulated cells
Fig. 4 – Image of hydrogen producing sludge collected from thermophilic UASB reactor using DAPI staining (A), sporulated cells are indicated with arrows, and FISH with LGC354 mixed probes (B).
4.
Conclusions
Three 16S rRNA gene oligonucleotide probes targeting Thermoanaerobacterium spp. (Tbm1282), T. thermosaccharolyticum (Tbmthsacc184) and Caldicellulosiruptor spp. (Ccs432) were designed and validated by FISH. Tbm1282, Tbmthsacc184 and Ccs432 showed high specificity with 75%, 100% and 93% coverage of target groups, respectively. The three new probes were applied for the assessment of the microbial composition of thermophilic and extreme-thermophilic biohydrogen reactors in association with seven group- and genus-specific probes targeting the main predominant groups of the hydrogen producing bacteria. Results obtained showed the applicability of Tbm1282, Tbmthsacc184 and Ccs432 for specific detection and monitoring of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. in mixed cultures environments such as thermophilic and extreme-thermophilic hydrogen producing systems. The sludge samples from thermophilic biohydrogen reactor contained high amounts of Thermoanaerobacterium spp., 26–59% and T. thermosaccharolyticum, 10–16% from the total population, while sludge samples from extreme-thermophilic biohydrogen producing reactor contained high amount of Caldicellulosiruptor spp., 20.5–40.5% from the total population. Probes Tbm1282, Tbmthsacc184 and Ccs432 will be useful in the future studies to assess and monitoring the presence of Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. in hydrogen producing systems, particularly in relation with process control and optimization. Knowledge of the microbial ecology in reactor systems can find application in optimization of thermophilic and extremethermophilic biohydrogen process.
Acknowledgements This work was financial support by Danish Research Council STVF Project No. 2058-03-0020 and the Commission on Higher
Education, Research Group for Development of Microbial Hydrogen Production Process from Biomass (Thailand). Prawit Klongjan is gratefully acknowledged for delivery of extremethermophilic sludge samples.
references
[1] Levin DB, Pitt L, Love M. Biohydrogen production: prospects and limitations to practical application. Int J Hydrogen Energy 2004;29:173–85. [2] Angenent LT, Karim K, Al-Dahhan M, Wrenn BA, Espinosa RD. Production of bioenergy and biochemicals from industrial and agricultural wastewater. Trends Biotechnol 2004;22:476–85. [3] Hawkes FR, Dinsdale R, Hawkes DL, Hussy I. Sustainable fermentative hydrogen production: challenges for process optimization. Int J Hydrogen Energy 2002;27:1339–47. [4] Ustak S, Havrland B, Munoz JOJ, Fernandez EC, Lachman J. Experimental verification of various methods for biological hydrogen production. Int J Hydrogen Energy 2007;32:1736–41. [5] Hawkes FR, Hussy I, Kyazze G, Dinsdale R, Hawkes DL. Continuous dark fermentative hydrogen production by mesophilic microflora: principles and progress. Int J Hydrogen Energy 2007;32:172–84. [6] van Niel EWJ, Claassen PAM, Stams AJM. Substrate and product inhibition of hydrogen production by the extreme thermophile, Caldicellulosiruptor saccharolyticus. Biotechnol Bioeng 2003;81:254–62. [7] Kadar Z, De Vrijek T, van Noorden GE, Budde MAW, Szengyel Z, Reczey K, et al. Yields from glucose, xylose, and paper sludge hydrolysate during hydrogen production by the extreme thermophile Caldicellulosiruptor saccharolyticus. Appl Biochem Biotech 2004;113:497–508. [8] Liu H, Zhang T, Fang HHP. Thermophilic hydrogen production from a cellulose-containing wastewater. Biotechnol Lett 2003;25:365–9. [9] Ahn Y, Park EJ, Oh YK, Park S, Webster G, Weightman AJ. Biofilm microbial community of a thermophilic trickling biofilter used for continuous biohydrogen production. FEMS Microbiol Lett 2005;249:31–8. [10] Kanai T, Imanaka H, Nakajima A, Uwamori K, Omori Y, Fukui T, et al. Continuous hydrogen production by the
6090
[11]
[12]
[13]
[14]
[15]
[16] [17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
international journal of hydrogen energy 33 (2008) 6082–6091
hyperthermophilic archaeon, Thermococcus kodakaraensis KOD1. J Biotechnol 2005;16:271–82. Islam R, Cicek N, Sparling R, Levin D. Effect of substrate loading on hydrogen production during anaerobic fermentation by Clostridium thermocellum 27405. Appl Microbiol Biotechnol 2006;72:576–83. van Niel EWJ, Budde MAW, de Haas GG, van de Wal FJ, Claassen PAM, Stams AJM. Distinctive properties of high hydrogen producing extreme thermophiles, Cadicellulosiruptor saccharolyticus and Thermotoga elfii. Int J Hydrogen Energy 2002;27:1391–8. Zhang T, Liu H, Fang HHP. Biohydrogen production from starch in wastewater under thermophilic condition. J Environ Manage 2003;69:149–56. Shin HS, Youn JH, Kim HS. Hydrogen production from food waste in anaerobic mesophilic and thermophilic acidogenesis. Int J Hydrogen Energy 2004;29:1355–63. O-Thong S, Prasertsan P, Intrasungkha N, Dhamwichukorn S, Birkeland NK. Improvement of biohydrogen production and pollution reduction from palm oil mill effluent with nutrient supplementation at thermophilic condition using an anaerobic sequencing batch reactor. Enzyme Microb Technol 2007;41:583–90. Shin HS, Youn JH. Conversion of food waste into hydrogen by thermophilic acidogenesis. Biodegradation 2005;16:33–44. Ueno Y, Haruta S, Igarashi Y. Microbial community in anaerobic hydrogen producing microflora enriched from sludge compost. Appl Microbiol Biotechnol 2001;57:555–62. Ueno Y, Sasaki D, Fukui H, Haruta S, Ishii M, Igarashi Y. Changes in bacterial community during fermentative hydrogen and acid production from organic waste by thermophilic anaerobic microflora. J Appl Microbiol 2006;101: 331–43. O-Thong S, Prasertsan P, Karakashev D, Angelidaki I. Thermophilic fermentative hydrogen production by the newly isolated Thermoanaerobacterium thermosaccharolyticum PSU-2. Int J Hydrogen Energy 2008;33:1204–14. van Ooteghem SA, Beer SK, Paul CY. Hydrogen production by thermophilic bacteria Thermotoga neapolitana. Appl Biochem Biotech 2002;98–100:177–89. de Vrije T, Mars AE, Budde MAW, Lai MH, Dijkema C, de Waard P, et al. Glycolytic pathway and hydrogen yield studies of the extreme thermophile Caldicellulosiruptor saccharolyticus. Appl Microbiol Biotechnol;74:1358–67. Yokoyama H, Moriya N, Ohmori H, Waki M, Ogino A, Tanaka Y. Community analysis of hydrogen producing extreme thermophilic anaerobic microflora enriched from cow manure with five substrates. Appl Microbiol Biotechnol 2007;77:213–22. de Vrije T, de Haas GG, Tan GB, Keijsers ERP, Classen PAM. Pretreatment of Miscanthus for hydrogen production by Thermotoga elfii. Int J Hydrogen Energy 2002;27:1381–90. Jen JC, Chou CH, Hsu PC, Yu SJ, Chen WE, Lay JJ, et al. FlowFISH analysis and isolation of clostridial strains in an anaerobic semi-solid bio-hydrogen producing system by hydrogenase gene target. Appl Microbiol Biotechnol 2007;74: 1126–34. Amann R, Glo¨ckner FO, Neef A. Modern methods in subsurface microbiology – in situ identification of microorganisms with nucleic acid probes. FEMS Microbiol Rev 1997;20:191–200. Meier H, Amann R, Ludwig W, Schleifer KH. Specific oligonucleotide probes for in situ detection of a major group of gram-positive bacteria with low DNA GþC content. Syst Appl Microbiol 1999;22:186–96. Loy A, Horn M, Wagner M. ProbeBase: an online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res 2003;31:514–6.
[28] Loy A, Maixner F, Wagner M, Horn M. probeBase – an online resource for rRNA-targeted oligonucleotide probes: new features 2007. Nucleic Acids Res 2007;35:800–4. [29] Hung HC, Cheng CH, Cheng LH, Liang CM, Lin CY. Application of Clostridium-specific PCR primers on the analysis of dark fermentation hydrogen-producing bacterial community. Int J Hydrogen Energy 2008;33:1586–92. [30] Hung HC, Lee KS, Cheng LH, Huang YH, Lin PJ, Chang JS. Quantitative analysis of a high-rate hydrogen producing microbial community in anaerobic agitated granular sludge bed bioreactors using glucose as substrate. Appl Microbiol Biotechnol 2007;75:693–701. [31] Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143–69. [32] Ashelford KE, Weightman AJ, Fry JC. PRIMROSE: a computer program for generating and estimating the phylogenetic range of 16S rRNA oligonucleotide probes and primers in conjunction with the RDP-II database. Nucleic Acids Res 2002;30:3481–9. [33] Cole JR, Chai B, Marsh TL, Farris RJ, Wang Q, Kulam SA, et al. The ribosomal database project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res 2003;1:442–3. [34] Altschul SF, Gish W, Miller W, Myers E, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. [35] Stender H, Fiandaca M, Hyldig-Nielsen JJ, Coull J. PNA for rapid microbiology. J Microbiol Methods 2002;48:1–17. [36] Maidak BL, Cole JR, Lilburn TG, Parker Jr CT, Saxman PR, Farris RJ, et al. The RDP-II (ribosomal database project). Nucleic Acids Res 2001;29:173–4. [37] Alm EW, Oerther DB, Larsen N, Stahl DA, Raskin L. The oligonucleotide probe database. Appl Environ Microbiol 1996; 62:3557–9. [38] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673–80. [39] Fuchs BM, Wallner G, Beisker W, Schwippl I, Ludwig W, Amann R. Flow cytometric analysis of the in situ accessibility of Escherichia coli 16S rRNA for fluorescently labeled oligonucleotide probes. Appl Environ Microbiol 1998;64:4973–82. [40] Gunasekera TS, Dorsch MR, Slade MB, Veal DA. Specific detection of Pseudomonas spp. in milk by fluorescence in situ hybridization using ribosomal RNA directed probes. Appl Microbiol 2003;94:936–45. [41] Schmid M, Twachtmann U, Klein M, Strous M, Juretschko S, Jetten M, et al. Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Syst Appl Microbiol 2000;23:93–106. [42] Daims H, Bruhl A, Amann R, Schleifer KH, Wagner M. The domain-specific probe EUB338 is insufficient for the detection of all bacteria: development and evaluation of a more comprehensive probe set. Syst Appl Microbiol 1999; 22:434–44. [43] Rusch A, Amend JP. Order-specific 16S rRNA-targeted oligonucleotide probes for (hyper) thermophilic archaea and bacteria. Extremophiles 2004;8:357–66. [44] Hugenholtz P, Tyson GW, Blackall LL. Design and evaluation of 16S rRNA-targeted oligonucleotide probes for fluorescence in situ hybridization. In: Methods in Molecular Biology (Gene Probes). Humana Press; 2001. p. 29–42. [45] Manz W, Amann R, Ludwig W, Wagner M, Schleifer K-H. Phylogenetic oligonucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst Appl Microbiol 1992;15:593–600.
international journal of hydrogen energy 33 (2008) 6082–6091
[46] Stahl DA, Amann R. Development and application of nucleic acid probes. In: Stackebrandt E, Goodfellow M, editors. Nucleic acid techniques in bacterial systematics. Chichester, UK: John Wiley & Sons Ltd.; 1991. p. 205–48. [47] Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA. Combination of 16S rRNA-targeted oligonucleotide
6091
probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 1990;56:1919–25. [48] Harmsen H, Prieur D, Jeanthon C. Group-specific 16S rRNAtargeted oligonucleotide probes to identify thermophilic bacteria in marine hydrothermal vents. Appl Environ Microbiol 1997;63:4061–8.