- Email: [email protected]
17β-estradiol attenuates rat articular chondrocyte injury by targeting ASIC1a-mediated apoptosis
Journal Pre-proof 17β-estradiol attenuates rat articular chondrocyte injury by targeting ASIC1amediated apoptosis Su-Jing Song, Jing-Jing Tao, Shu-Fang Li, Xue-Wen Qian, Ruo-Wen Niu, Cong Wang, Yi-Hao Zhang, Yong Chen, Ke Wang, Fei Zhu, Chuan-Jun Zhu, Gang-Gang Ma, Yang-Yang, Xiao-Qing Peng, Ren-Peng Zhou, Fei-Hu Chen PII:
S0303-7207(20)30042-3
DOI:
https://doi.org/10.1016/j.mce.2020.110742
Reference:
MCE 110742
To appear in:
Molecular and Cellular Endocrinology
Received Date: 11 October 2019 Revised Date:
4 January 2020
Accepted Date: 27 January 2020
Please cite this article as: Song, S.-J., Tao, J.-J., Li, S.-F., Qian, X.-W., Niu, R.-W., Wang, C., Zhang, Y.-H., Chen, Y., Wang, K., Zhu, F., Zhu, C.-J., Ma, G.-G., Yang-Yang, , Peng, X.-Q., Zhou, R.-P., Chen, F.-H., 17β-estradiol attenuates rat articular chondrocyte injury by targeting ASIC1a-mediated apoptosis, Molecular and Cellular Endocrinology (2020), doi: https://doi.org/10.1016/j.mce.2020.110742. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier B.V.
17β-estradiol attenuates rat articular chondrocyte injury by targeting ASIC1a-mediated apoptosis Su-Jing Song1,2 Jing-Jing Tao1,2 Shu-Fang Li1,2 Xue-Wen Qian1,2 Ruo-Wen Niu1,2 Cong Wang1,2 Yi-Hao Zhang1,2 Yong Chen3 Ke Wang1,2 Fei Zhu1,2 Chuan-Jun Zhu1,2 Gang-Gang Ma3 Yang-Yang3 Xiao-Qing Peng1,2 Ren-Peng Zhou3* Fei-Hu Chen1,2*
1
The Key Laboratory of Major Autoimmune Diseases, Anhui Institute of Innovative
Drugs, School of Pharmacy, Anhui Medical University, Hefei 230032, China;
2
The Key Laboratory of Anti-inflammatory and Immune Medicines, Ministry of
Education, Hefei 230032, China.
3
Department of Clinical Pharmacology, The Second Hospital of Anhui Medical
University, Hefei 230601, China
*Corresponding author
Prof. Fei-Hu Chen, School of Pharmacy, Anhui Medical University, Hefei230032, China. E-mail: [email protected]. Tel./fax: +8655165161116.
Dr. Ren-Peng Zhou, The Second Hospital of Anhui Medical University, Department of Clinical Pharmacology, Hefei, 230601, China. E-mail: [email protected]. Tel./fax: +8655163806057.
Abstract
Epidemiological evidence suggests that the etiology and pathogenesis of rheumatoid arthritis (RA) are closely associated with estrogen metabolism and deficiency. Estrogen protects against articular damage. Estradiol replacement therapy ameliorates local inflammation and knee joint swelling in ovariectomized models of RA. The mechanistic basis for the protective role of 17β-estradiol (17β-E2) is poorly understood. Acid-sensing ion channel 1a (ASIC1a), a sodium-permeable channel, plays a pivotal role in acid-induced articular chondrocyte injury. The aims of this study were to evaluate the role of 17β-E2 in acid-induced chondrocyte injury and to determine the effect of 17β-E2 on the level and activity of ASIC1a protein. Results showed that pretreatment with 17β-E2 attenuated acid-induced damage, suppressed apoptosis, and restored mitochondrial function. Further, 17β-E2 was shown to reduce protein levels of ASIC1a through the autophagy-lysosomal pathway, to protect chondrocytes from acid-induced apoptosis, and to induce ASIC1a protein degradation through the ERα receptor. Taken together, these results show that the use of 17β-E2 may be a novel strategy for the treatment of RA by reducing cartilage destruction through down-regulation of ASIC1a protein levels.
Keywords: 17β-E2, ASIC1a, Apoptosis, Autophagy, Degradation, Rheumatoid arthritis
1. Introduction
Rheumatoid arthritis (RA) is one of top age-related chronic syndromes, characterized by inflammatory cell infiltration, synovial hyperplasia, inflammation, and vasospasm formation. All of which lead ultimately to joint destruction, cartilage erosion, and functional disability. RA incidence accounts for 1% of all worldwide disorders (Evangelatos, Fragoulis, Koulouri et al., 2019, Raterman and Lems, 2019). With
increasing age, the incidence of RA also increases, resulting in disability and loss of workplace labor. As such, it is imperative to find potential and effective therapies for the treatment of RA (McInnes and Schett, 2011, Smolen, Aletaha, Barton et al., 2018). A common characteristic of hospitalized patients is an increased incidence of RA in menopausal women with low levels of estrogen, suggesting a regulatory role for estrogen in the pathological process of RA (Sapir-Koren and Livshits, 2017, Islander, Jochems, Lagerquist et al., 2011). For the last few decades, investigations have focused on sex steroid hormones, specifically 17β-E2. Those investigations demonstrated suppression of synovial inflammation by sex steroid hormone inhibition of the immune system (Cui et al., 2013, Faraci, Taugher, Lynch et al., 2019). A large body of evidence demonstrates estrogen effects to be a crucial and essential anti-inflammatory and anti-ossifying molecule, important in vasospasm formation (Sapir-Koren and Livshits, 2017, Islander et al., 2011). Further, estrogen deficiency is considered to be the main cause of postmenopausal osteoporosis (Khosla et al., 2011). However, the detailed effects of estrogen in RA are unclear.
Investigations of estrogen in RA were focused by the fact that estrogen receptors are widely distributed in the synovium, chondrocytes, and bone (Carlsten, 2005). It has been previously shown that estrogen may act on ion channels to modulate immune system diseases by binding to cognate receptors; ERα, ERβ, and GPR30 (Qu, Liu, Ren et al., 2015, Chaban and Micevych, 2005). Autophagy is a catabolic mechanisms by which abnormal proteins and dysfunctional organelles are degraded and recycled, sustaining cellular homeostasis in several pathological conditions including RA (Tang, Zhang, Liu et al., 2019, Wang and Choi, 2014, Lenoir, Tharaux and Huber, 2016). Recently, estrogen and its receptors have been shown to play a significant role in autophagy, which is associated with cell fate and human disease (Wei and Huang, 2019, Teng, Miyake, Yokoe et al., 2015). However, the mechanistic basis for the effects of estrogen and its receptors in RA are poorly understood.
Acid sensing ion channels (ASICs) are important sensors of protons that belong to
the epithelial sodium channel superfamily. Currently, at least six subunits (ASIC1a, ASIC1b, ASIC2a, ASIC2b, ASIC3, and ASIC4) have been cloned and identified in both central and peripheral systems (Chen, Zhu, Zhu et al., 2018). Among these, ASIC1a is found primarily in chondrocytes, the synovium, bone, and muscle, where slight changes in extracellular acidosis can be detected (Zhang et al., 2019). Acid-induced ASIC1a activation results in Na2+ and Ca2+influx, leading to a series of pathological and physiological changes. Tissue acidification is a common feature of RA that results in irreversible damage to articular chondrocytes (Zhou, Wu, Wang et al., 2015, Debnath, Baehrecke and Kroemer, 2005). Moreover, decreased pH aggravates cartilage damage (Dai, Zhu, Chen et al., 2017). Our previous investigations have demonstrated that blocking ASIC1a with a special inhibitor, PcTX1, significantly reduced acid-induced articular chondrocyte injury, which suggests that ASIC1a activation is involved in acid-induced chondrocyte injury, and as such, serve as a potential therapeutic target for RA therapy (Yuan, Chen, Lu et al., 2010, Li, Wu, Xu et al., 2014, Verkest, Piquet, Diochot et al., 2018). It has been reported that estrogen can regulate ion channel function. However, it is unclear whether estrogen and its receptors have a regulatory effect on ASIC1a-mediated articular chondrocyte injury.
Therefore, we explored the effect of 17β-E2 on ASIC1a expression and function, evaluated its protective effect on acid-induced articular chondrocyte injury, and determined its role in ASIC1a-mediated chondrocyte apoptosis.
2. Materials, Reagents and Methods
2.1. Cell Culture and Treatment
Male Sprague–Dawley rats weighting between 120 and 140 g were purchased from the Laboratory Animal Sciences of Anhui Medical University. Animals were supplied with sufficient food for one night in a room at 37oC and 75% humidity. The next day,
cells were removed from the animals and placed in primary cell culture as described previously (Yuan, Chen, Lu et al., 2010). Briefly, joint tissue was separated from the rats and chondrocyte digestion performed. The cartilage tissue was gently cut into small pieces of approximately 1 mm3 and then digested with 0.2% type II collagenase in a 37oC incubator for 5 hours in phosphate buffered saline (PBS). The chondrocytes were carefully separated after digestion with a filter. The primary cells were incubated in 25 mL cell culture plates (Corning Inc., Corning, NY, USA) supplemented with Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Grand Island, NY, USA) consisting of 10% fetal bovine serum (FBS) (Gibco) and antibiotics (Invitrogen, Carlsbad, CA, USA) at a density of 2×104 cells/cm2. The cells were cultured for two or three generations prior to use. For acid stimulation, the extracellular medium pH was adjusted by the addition of an appropriate amount of HCl to achieve a pH pf 6.0 (Li et al., 2014). Chondrocytes exposed to pH 6.0 conditions for 3 hours served as the in vitro model. Our previous results showed that extracellular acidosis caused chondrocyte damage at pH 6.0 for 3 hours (Yuan, Chen, Lu et al., 2010, Li, Wu, Xu et al., 2014). Cells were pretreated with an ASIC1a-specific blocker, PcTX1 (100 ng/mL; Abcam, Cambridge, MA, USA), and estrogen receptor selective and specific antagonists ICI182780 and MPP/PHTPT/G15 (1 µM; Sigma-Aldrich, St. Louis, MO, USA). The effective concentration of 17β-E2 was determined from the literature (Chen, Wang, Mai et al., 2020, Slowik, Lammerding, Zendedel et al., 2018).
2.2. MTT Assay
The cells were uniformly seeded in 96-well plates overnight, treated with 500, 1000, and 2000 nM of 17β-E2 and fresh medium for 48 hours, followed by acidification for 3 hours in an acidified medium at pH 6.0. After treatment, cell viability was assessed by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay as follows; 40 µL of MTT were added to each well and incubated for 4 hours, then 150 µL of DMSO were added to dissolve the formazan. Next, cells were incubated with 17β-E2 estrogen receptor non-specific blocker ICI or PcTX1 with fresh medium, acidified for 3 hours, and assayed for cell viability by the MTT assay. The absorbance values at 492 nm were detected with a microplate reader ( Biotek, Vermont, USA).
2.3. Detection of Mitochondrial Membrane Potential
Chondrocytes were seeded in six-well plates. After treatment with 17β-E2 and acidification, the cells were incubated with Rhodamine123 at a final concentration of 1 mM. After culture in an incubator for 30 minutes, the cells were observed with a fluorescent inverted microscope.
2.4. Laser Confocal Microscopy
Laser confocal microscopy was used to detect extracellular calcium influx to assess the effect of 17β-E2 on the activity of ASIC1a. Primary chondrocytes were incubated on 25 mm diameter glass coverslips, treated with 1000 nM of 17β-E2 for 72 hours, and then processed according to the instructions provided by the reagent manufacturer. After treatment, the cells were washed with D-Hank’s solution three times, and incubated with 5 µmol/L of Fluo-3/AM dye at 37oC in a humidified 5% CO2 incubator for 30 minutes. To the center of each small dish was added 150 µL. The cells were cleared with D-Hank’s solution three times to remove residual dye (gently avoiding cell washing), then 2 mL of D-Hank’s solution were added for 10 minutes. The cells were continuously scanned by laser confocal for 5 minutes to detect the influx of calcium ions at an excitation wavelength of 488 nm. During the detection, 1 mL of pH 6.0 Hank’s solution containing calcium ions was added.
2.5. Immunofluorescence Staining
Chondrocytes were seeded on coverslips, cultured for 2 days, and then treated with 1000 nM 17β-E2 for 48 hours. The coverslips were washed three times with PBS, fixed with paraformaldehyde for 15 minutes, and then permeabilized with 0.5% Triton X-100 for 10 minutes. After blocking for 30 minutes with 5% BSA, the coverslips were incubated overnight at 4oC with ASIC1a reactive, LC3 antibody (Zhang et al., 2019, Zhou, Zhu, Wu et al., 2019). The cells were washed three times,
incubated with fluorescein isothiocyanate (FITC)-conjugated anti-rat IgG (Molecular Probes, Beijing, China) in the dark for 1 hour at room temperature. Cell nuclear was stained with 4′,6-diamidino-2-phenylindole, dilactate (DAPI; Invitrogen, Carlsbad, CA, USA) for 10 minutes. After washing, the samples were assessed with an inverted fluorescent microscope (Olympus, Tokyo, Japan).
2.6. Small Interfering RNA (siRNA) Transfection
After transfection of small interfering RNA (siRNA) fragments of ASIC1a and ERα into chondrocytes using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA), the cells were incubated in Opti-MEM (Gibco) medium under dark conditions. After 6 hours, chondrocytes were cultured in normal complete medium for 24 hours. The ASIC1a and ERα specific siRNAs were synthesized by GenePharma (Shanghai, China).
Sequences
are
listed
below:
ASIC1a;
5’-CACCGCCAAGAAGTTCAACAAATCGTTCAAGAGACGATTT GTTGAACTTCTTGGCTTTTTTG-3’
(Forward)
and
5’-GATCCAAAAAA
GCCAAGAAGTTCAACAAATCGTCCTTGAACGATTTGTTG AACTTCTTGGC-3’ (Reverse); ERα; GCCUCAAUGAUGGGCUUAUTT (Forward) AUAAGCCCAUCAUUGAGGCTT (Reverse).
2.7. Flow Cytometry
Cells were digested and centrifuged at 2,000 rpm for 5 minutes and pellets were collected. Supernatants were discarded and the pellets were washed three times with pre-cooled PBS. Cells were suspended in 400 µL of binding buffer. To the suspension was added to 5 µL of AnnexinV-FITC, completely mixed (note that the action was gentle to avoid cell damage), and incubated for 15 minutes in the dark at 2 - 8oC. Finally, 10 µL of propidium iodide (PI) were added, gently mixed, and then incubated for 5 minutes, as above. After this treatment, the mixture was assessed by flow cytometry. Chondrocytes were pretreated with 17β-E2 and PcTX1 and incubated with
extracellular acid (pH 6.0) for an additional 3 hours. Cell apoptosis was observed by flow cytometry with an AnnexinV-FITC/PI (BestBio) kit.
2.8. Quantitative Real-Time Polymerase Chain Reaction (PCR)
Total RNA was extracted by the standard Trizol method (Invitrogen, Shanghai) according to the instructions. Real-time quantitative PCR has been described in detail in previous literature (Zeng, Leng, Feng et al., 2015). cDNA was synthesized using PrimeScript RT reagent Kit (TaKaRa, Japan). PCR reactions were performed using SYBR-green PCR master mix (TaKaRa, Japan). The process of PCR amplification consisted of denaturation at 95oC for 10 min, 40 cycles of denaturation at 95oC for 5 seconds, annealing and extension at 61oC for 10 seconds, followed by melt curve detection from 65 to 95°C. Primers were designed with GenBank sequences and synthesized by Invitrogen. ASIC1a and β-actin primer sequences are summarized below: ASIC1a, forward, 5’-GGCCAACTTCCGTAGCTTCA-3’ and reverse, 5’-ATGCCCTGCTCTGTCGTAGAA-3’; 5’-GAGACCTTCAACACCCCAGC-3’
β-actin,
forward
and
reverse
5’-ATGTCACGCACGATTTCCC-3’. β-actin was used as an endogenous control, ∆∆
Ct values were calculated with β-actin as the reference. Relative expression levels
of target mRNAs were calculated as 2−∆∆Ct.
2.9. Hoechst Staining
Cells were cultured in six-well plates with a cover glass. The cells were pretreated with 1000 nM 17β-E2, acidified for 3 hours, and fixed with paraformaldehyde for 15 minutes. Cells were washed two times with PBS and then stained with Hoechst 33258 (BestBio, Shanghai, China) for 20 minutes in the dark. Cells were observed and photographed with an inverted fluorescent microscope (Olympus, Tokyo, Japan).
2.10. Western Blotting Analysis
Cells were seeded in six-well plates and proteins extracted after appropriate treatment. Proteins were extracted with lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, protease inhibitor, and phosphatase inhibitor). Lysates were centrifuged at 12,000 rpm for 4 minutes at 4oC. After supernatant removal, one-quarter protein loading buffer was added and boiled for 10 minutes in a 99oC water bath. Protein concentration was determined with a bicinchoninic acid (BCA) protein assay kit (Boster, Wuhan, China). Related proteins were separated by 10% or 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) (10%, 80 V for 30 min and then 120 V for 90 minutes) and transferred to polyvinylidene difluoride (PVDF) membranes. After incubating the PVDF membrane in 5% non-fat milk for 2-3 hours, the membranes were washed three times with Tris-buffered saline with Tween 20 (TBST) on a shaker for 15 minutes. Then membranes were probed with primary antibodies reactive against ASIC1a (Affinity 1:1000), LC3 (Cell Science Technology 1:1000), Beclin-1 (Affinity 1:1000), PARP (Cell Science Technology 1:1000), and Caspase-9 (Abcam 1:1000) at 4oC overnight, followed by horseradish peroxidase- conjugated goat anti-mouse or anti-rabbit antibodies at 37oC for approximately 1 hour. After washing with TBST three times, the chemiluminescent bands were detected using an ECL-chemiluminescent kit. Quantitative target protein levels were assessed with ImageJ software.
2.11 Statistical Analysis
All data are presented as means ± standard deviation. Differences between groups were assessed by analysis of variance (ANOVA) followed by a Dunnett’s or Tukey HSD post-hoc test and the Student’s t-test. P < 0.05 was considered statistically significant.
3. Results
3.1. 17β-E2 attenuates acid-induced injury of articular chondrocytes
We first evaluated the effect of 17β-E2 on chondrocyte viability. The MTT assay demonstrated different concentrations of 17β-E2 to have no effect on cell growth, as shown in Fig. 1A. However, under acidic conditions (pH 6.0), the cell viability was reduced by 45.3 ± 1.1% compared with the normal group, and the chondrocyte viability was improved after pretreatment with estradiol (500, 1000, 2000 nM) (Fig. 1B). Moreover, MTT results also showed the protective effect of 17β-E2 was blocked by 1 µM ICI182780, an estrogen receptor inhibitor, as shown in Fig. 1C. This result implies that 17β-E2-mediated protection may be through either of the estrogen receptors. Consistent with our previous results, cell viability was improved by pretreatment with a ASIC1a specific inhibitor, PcTX1 (Fig. 1D). However, our current results also showed complete blocking of ASIC1a with the specific inhibitor, PcTX1. 17β-E2 did not further increase the protection of chondrocytes, indicating that ASIC1a activation is largely involved in 17β-E2-mediated protection. Cell morphology analysis demonstrated acid-induced cell body deformation was alleviated after treatment with 17β-E2 or PcTX1 (Fig. 1E). Mitochondrial membrane potential, as a measure of mitochondrial function, plays an important role in cell survival. Fig. 1F shows that 1000 nM 17β-E2 significantly reduced the loss of mitochondrial membrane potential induced by acidification. Taken together, these results suggest that 17β-E2 protects from acid-induced articular chondrocyte injury.
3.2. 17β-E2 decreases ASIC1a protein expression and activity of articular chondrocytes
To explore whether 17β-E2 regulates ASIC1a protein expression, chondrocytes were treated with 17β-E2. As shown in Fig. 2A, 17β-E2 reduced the protein level of ASIC1a at concentrations of 500, 1000, and 2000 nM. The effect was most noticeable at 1000 nM, decreasing ASIC1a by 34.9 ± 1.67% versus control. Moreover, western blot results showed that 17β-E2 reduced ASIC1a protein levels in a time-dependent manner (Fig. 2C). Interestingly, results indicated that 17β-E2 had no effect on the level of ASIC1a mRNA at any concentration or time (Fig.
2B, D).
Immunofluorescence staining of ASIC1a in chondrocytes demonstrated decreased levels with 1000 nM 17β-E2 treatment compared to control (Fig. 2E). Laser confocal microscopy showed that treatment with 1000 nM 17β-E2 for 72 hours had a suppressive effect on acid-induced Ca2+ elevation (Fig. 2F). Preliminarily, these results indicate that 17β-E2 reduces ASIC1a protein levels and channel activity.
3.3. 17β-E2 promotes ASIC1a protein degradation of articular chondrocytes through an autophagy-lysosomal pathway
Protein degradation is essential and crucial for clearance of damaged organelles, as well as for maintenance of physiological homeostasis of phylogenetically diverse organisms. Failure of proper clearance has been shown to have pathological consequences (Zaglia, Milan, Ruhs et al., 2014, Jiang and Mizushima, 2015). Our data show that 17β-E2 did not affect the mRNA level of ASIC1a, but did reduce ASIC1 at the protein level, implying that 17β-E2 is likely involved in ASIC1a degradation (Fig. 1 B, D). To explore whether 17β-E2-mediates the decrease in ASIC1a protein by degradation, we used the protein synthesis inhibitor, cycloheximide, (CHX) (for 0 – 6 hours). In the presence of the protein synthesis inhibitor, ASIC1a protein levels decreased over time, regardless of treatment with 17β-E2 (Fig. 3A). Furthermore, the effect of 17β-E2 on ASIC1a protein levels was detected in the presence or absence of CHX. By western blot analysis, combined treatment with CHX (6 hours) and 17β-E2 showed that the level of ASIC1a protein decreased sharply by 28% compared to CHX-treated cells (Fig. 3B), indicating that 17β-E2 promotes ASIC1a protein degradation.
There are three major pathways of protein degradation; the ubiquitin-proteasome system (UPS), the autophagy–lysosomal pathway (ALP), and the Ca2+-activated protease (calpain) system. To assess the potential mechanism of estradiol-mediated degradation of ASIC1a, chondrocytes were incubated with proteasome inhibitors; MG-312
(10
µM),
chloroquine
(CQ,
50
µM),
and
2-acetamido-4-methyl-N-[4-methyl-1-oxo-1-(1-oxohexan-2-ylamino)pentan-2-yl]pent anamide (ALLN, 100 µM) for 6 hours to inhibit proteasome, lysosome, and Ca2+-activated protease calpain, respectively. As shown in Fig. 3C, pretreatment with the autophagy inhibitor, CQ, inhibited 17β-E2- ASIC1a expression. Further, inhibition of autophagy with 3-MA also attenuated 17β-E2-induced ASIC1a degradation (Fig. 3D). After treatment with the calpain inhibitor, ALLN, and the proteasome inhibitor, MG-312, there was no effect on 17β-E2-reduced ASIC1a protein levels in chondrocytes (Fig. 3 E, F). Results also showed that 17β-E2 increased Beclin-1 and LC3-II expression (Fig. 3G), suggesting that 17β-E2 activates autophagy. Moreover, CQ pretreatment enhanced the accumulation of LC3-II and Beclin-1 in articular chondrocytes induced by 17β-E2 (Fig. 3H). As shown in Fig. 3I, immunofluorescence staining of LC3 was increased in chondrocytes after pretreatment with1000 nM 17β-E2. These findings suggest that 17β-E2 activates autophagy and promotes ASIC1a degradation in chondrocytes through activation of the ALP, but not the UPS, or Ca2+-activated protease pathway.
3.4. 17β-E2 reduces ASIC1a protein levels through articular chondrocyte ERα
Estrogen biological effects are mediated by the nuclear receptors ERα and ERβ, as well as the member receptor GPER (also known as GPR30). To determine which estrogen receptor is involved in regulation of ASIC1a, cells were pretreated with a selective ER antagonist, ICI182780 (ICI, 1 µM). The results showed that the effect of 17β-E2 on ASIC1a was inhibited by ICI (Fig. 4A). By western blot, pretreatment with a nuclear (ERα and ERβ) or membrane receptor (GPER) antagonist (1 µM MPP/PHTPP/G15) showed that attenuation of ASIC1a induced by 17β-E2 was reversed (Fig. 4B). More significant reversal effects were produced by ERα blocker MPP when compared to the other two antagonists. In addition, siRNA silencing of ERα significantly increased ASIC1a protein levels compared to 17β-E2 (Fig. 4C). These results indicated that ERα, but not ERβ or GPR30, is involved in 17β-E2-induced ASIC1a protein degradation.
3.5. 17β-E2 reduces acid-induced apoptosis by targeting ASIC1a of articular chondrocytes
Flow cytometry was performed to verify the protective effect of 17β-E2. As shown in Fig. 5A, apoptosis was ameliorated in acid-treated chondrocytes after pretreatment with 17β-E2 (1000 nM) for 72 hours. Moreover, Hoechst staining showed that acid-induced chondrocytes exhibited nuclear shrinkage, with dense blue fluorescence and DNA fragments pale in color, which were relieved by17β-E2 treatment (Fig. 5B). To further assess the effect of 17β-E2 on chondrocytes apoptosis, cells were cultured with an estrogen nuclear receptor blocker, 1 µM ICI, with or without 17β-E2. After treatment in pH 6.0 medium, changes in caspase-9 and PARP were relieved in comparison to the pH 6.0 group (Fig. 5C). Apoptosis is related to activation of ASIC1a (Li et al., 2014). We found that PcTX1, a selective inhibitor of ASIC1a, had a better suppressive effect on apoptosis (Fig. 5D), suggesting that ASIC1a activation is involved in acid-induced chondrocyte apoptosis. To further confirm the relationship between the estrogen-mediated protective effect and ASIC1a-induced chondrocytes apoptosis, combined pretreatment with PcTX1 and 17β-E2 was found to not change the level of caspase-9 or PARP compared to PcTX1 (Fig. 5E). These data suggest that17β-E2 protects from acid-induced chondrocyte apoptosis through ASIC1a channels. Taken together, these results demonstrate that 17β-E2 decrease ASIC1a levels and are partly responsible for acid-mediated chondrocyte protection.
4. Discussion
In the present study, we explored the effects of 17β-E2 on ASIC1a channel expression and activity. The results demonstrated that 17β-E2 protects chondrocytes from acid-induced and ASIC1a-mediated injury by inhibiting apoptosis and mitochondrial dysfunction. Further, we demonstrated that 17β-E2 decrease ASIC1a protein levels and function. Moreover, we found that 17β-E2 activated autophagy and promoted ASIC1a protein degradation through the autophagy–lysosomal pathway.
Furthermore, we showed that ERα is involved in17β-E2-mediated ASIC1a protein degradation. Finally, we demonstrated that 17β-E2 alleviated acid-induced and ASIC1a-mediated chondrocyte apoptosis. Taken together, these results indicate that 17β-E2 protects against acid-induced articular chondrocyte injury through reduced ASIC1a protein levels and channel activity.
RA is an immune systemic disease associated with joint synovial inflammation and bone loss. Tissue acidification is a common feature of this inflammatory disease. The accumulated evidence demonstrates the involvement of the ASIC1a proton channel in acid-induced injury and bone damage by increasing chondrocyte apoptosis and synovial inflammation in RA (Gregory, Gautam, Benson et al., 2018, Wu, Ren, Zhou et al., 2019). Results of our previous studies showed that inhibition or deficiency of ASIC1a protected against acid-induced articular injury, suggesting that targeting ASIC1a may have a role in RA therapy (Zhou, Zhu, Wu et al., 2019, Dai, Zhu, Chen et al., 2017, Chen, Zhu, Zhu et al., 2018). It is still largely unknown why elderly females are more inclined to develop RA than elderly males. 17β-E2 has an effect on T-type calcium channels, potassium channels, N-methyl-D-aspartate acid receptor 1, TREK1, and BK channels (Song, Li, Liu et al., 2018, Choudhury and Sikdar, 2018, Evanson, Goldsmith, Ghosh et al., 2018). In the present study, we explored the effects of 17β-E2 on the ASIC1a of articular chondrocytes. Our results showed that prolonged exposure of chondrocyte to 17β-E2 reduced ASIC1a protein levels in a time dependent manner and ASIC1a-mediated Ca2+ influx through inhibition of ASIC1a activation.
Several studies have shown the beneficial effects of estrogen on the pathology associated with RA. In several models of arthritis, estrogen produces beneficial effects by inhibition of local cytokine production and attenuation of knee joint swelling. Estrogen deficiency accelerates the severity of joint destruction and bone loss in ovariectomized animals (Schneider, Kanashiro, Dutra et al., 2019). As well, 17β-E2 and estrogen receptors play an important role in mitochondrial damage and
acid-induced apoptosis (Chen, Yager and Russo, 2005, Sun, Yang, Liu et al., 2019). Mitochondria not only participate in Ca2+ homeostasis, but also regulate cell death and apoptosis (Fex, Nicholas, Vishnu et al., 2018), with 17β-E2 playing an essential role in the regulation of mitochondrial function and structure (Mahmoodzadeh and Dworatzek, 2019). In the present study, 17β-E2 was shown to protect from acid-induced articular chondrocyte injury and ASIC1a-mediated apoptosis. Further, 17β-E2 attenuated acid-induced mitochondrial injury by restoring membrane integrity. Moreover, with inhibition of ASIC1a by a specific blocker, PcTX1, 17β-E2 did not produce an additional protective effect on articular chondrocyte damage. These results suggest the protective role of 17β-E2 on acid-induced chondrocyte injury is due to a decrease in ASIC1a protein levels and channel activity.
It is well known that the effect of estrogen on target tissues and organs is through its receptors. ERα is a nuclear receptor expressed in tissues, including cartilage and bone adjacent to joint inflammation, as well as in other peripheral tissues such as the thymus and spleen that can be related to autoimmune disease (Xu, Sha, Wang et al., 2019, Ikeda, Tsukui, Imazawa et al., 2012). Ikeda et al. found ERα to play a critical role in chondrocyte proliferation and maturation during longitudinal bone growth (Ikeda et al., 2012). However, the underlying mechanistic basis for this is poorly understood. Our present data show that the nuclear receptor, ERα, is expressed in chondrocytes. We found that in chondrocytes, ICI187280, a high-affinity nuclear receptor antagonist, reversed the 17β-E2 mediated decrease in ASIC1a protein levels. Furthermore, we showed that pharmacological inhibition and deficiency in ERα blocked the 17β-E2 induced reduction in ASIC1a protein levels. Taken together, these results demonstrate the ERα to be involved in the 17β-E2 induced reduction in ASIC1a protein levels and in ASIC1a-mediated chondrocyte apoptosis.
Autophagy is required for cellular growth, survival, proliferation, and stability during diverse physiological and pathological conditions such as RA. The involvement of autophagy in acidotic pathologic conditions in RA, was the focus of
our previous studies (Zhou et al., 2019). A recent study showed that activation of autophagy is corrected by sex hormone treatment and that estrogen has a significant effect on sex-based autophagy (Wei and Huang, 2019). Vomero et al. reported that estradiol rescued osteoblast apoptosis by promoting autophagy. Beclin-1 and the conversion of LC3, markers that reflect autophagy progression, are important initiators and regulators of autophagy (Jiang and Mizushima, 2015, Huang, Li, Shou et al., 2019). Consistent with that study, our results demonstrated LC3-II and Beclin-1to be up-regulated by 17β-E2 pretreatment of chondrocytes, suggesting that 17β-E2 can enhance the activation of chondrocytes autophagy.
Protein degradation is a complex process that eliminates aberrant cellular components, maintaining cellular homeostasis, and cell survival. Many studies have shown that the ubiquitin-proteasome system (UPS) and the autophagy-lysosomal pathway (ALP) are responsible for the degradation of most misfolded and abnormal proteins (Pan, Kondo, Le et al., 2008, Larsen and Sulzer, 2002), with ALP playing a complementary and alternative role to UPS (Larsen and Sulzer, 2002). Further, amiloride-sensitive epithelial sodium channels (ENaC) have been shown to be degraded by UPS (Eaton, Malik, Bao et al., 2010). Allison et al. reported that fibroblasts
clear excess
and
misfolded
proteins
through
proteasome and
lysosome/autophagy pathways, thus, promoting cell survival (Vomero et al., 2018, Iwata et al., 2005, Allison and McNamara, 2019). Our current data demonstrated 17β-E2 to induce ASIC1a protein degradation. 17β-E2-mediated ASIC1a degradation was inhibited by CQ, a lysosome inhibitor, and 3-MA, an autophagy inhibitor (3-MA). Pretreatment with MG-312 and ALLN (inhibitors of proteasomes and the Ca2+-activated protease calpain, respectively) had no effect on ASIC1a protein degradation in the presence of 17β-E2. Taken together, these results suggest that17β-E2 promotes the degradation of ASIC1a protein via the ALP.
Herein, we demonstrated 17β-E2 to protect from acid-induced articular injury and ASIC1a-mediated chondrocyte apoptosis through the promotion of ASIC1a protein
degradation. This study provides a potential new mechanistic understanding of 17β-E2 mediated protection and provides for potential future treatment strategies for RA.
Highlights
17β-E2 inhibits Ca2+ influx, attenuates apoptosis, and restores articular chondrocyte function during acidosis.
Activation of ASIC1a is involved in acid-induced chondrocyte injury and 17β-E2 protects from ASIC1a-mediated apoptosis.
17β-E2 reduces ASIC1a protein levels through the ERα receptor.
17β-E2 promotes ASIC1a protein degradation via the autophagy lysosomal pathway.
Abbreviations
RA, Rheumatoid arthritis; ASIC1a, Acid Sensing ion channel 1a; 17β-E2, 17β-estradiol; ERα, Estrogen Receptor alpha; ERβ, Estrogen Receptor beta; PcTX1, Psalmotoxin 1; ALP, Autophagy lysosome pathway
Sources of Funding
This work was supported by grants from the National Natural Science Foundation of China (No. 81873986), the Natural Science Foundation of Anhui Province (No: 1908085QH317), and the Scientific Research Fund of Anhui Medical University (2018xkj044).
References Evangelatos, G., Fragoulis, G.E., Koulouri, V. and Lambrou, G.I., 2019. MicroRNAs in rheumatoid arthritis: From pathogenesis to clinical impact, Autoimmun Rev. 18, 102391. Raterman, H.G. and Lems, W.F., 2019. Pharmacological Management of Osteoporosis in Rheumatoid Arthritis Patients: A Review of the Literature and Practical Guide, Drugs Aging. 36, 1061-1072. Smolen, J.S., Aletaha, D., Barton, A., Burmester, G.R., Emery, P., Firestein, G.S., Kavanaugh, A., McInnes, I.B., Solomon, D.H., Strand, V. and Yamamoto, K., 2018. Rheumatoid arthritis, Nat Rev Dis Primers. 4, 18001. McInnes, I.B. and Schett, G., 2011. The pathogenesis of rheumatoid arthritis, N Engl J Med. 365, 2205-19. Sapir-Koren, R. and Livshits, G., 2017. Postmenopausal osteoporosis in rheumatoid arthritis: The estrogen deficiency-immune mechanisms link, Bone. 103, 102-115. Islander, U., Jochems, C., Lagerquist, M.K., Forsblad-d'Elia, H. and Carlsten, H., 2011. Estrogens in rheumatoid arthritis; the immune system and bone, Mol Cell Endocrinol. 335, 14-29. Cui, J., Shen, Y. and Li, R., 2013. Estrogen synthesis and signaling pathways during aging: from periphery to brain, Trends Mol Med. 19, 197-209. Faraci, F.M., Taugher, R.J., Lynch, C., Fan, R., Gupta, S. and Wemmie, J.A., 2019. Acid-Sensing Ion Channels: Novel Mediators of Cerebral Vascular Responses, Circ Res. 125, 907-920. Khosla, S., Melton, L.J., 3rd and Riggs, B.L., 2011. The unitary model for estrogen deficiency and the pathogenesis of osteoporosis: is a revision needed?, J Bone Miner Res. 26, 441-51. Carlsten, H., 2005. Immune responses and bone loss: the estrogen connection, Immunol Rev. 208, 194-206. Qu, Z.W., Liu, T.T., Ren, C., Gan, X., Qiu, C.Y., Ren, P., Rao, Z. and Hu, W.P., 2015. 17beta-Estradiol Enhances ASIC Activity in Primary Sensory Neurons to Produce Sex Difference in Acidosis-Induced Nociception, Endocrinology. 156, 4660-71. Chaban, V.V. and Micevych, P.E., 2005. Estrogen receptor-alpha mediates estradiol attenuation of ATP-induced Ca2+ signaling in mouse dorsal root ganglion neurons, J Neurosci Res. 81, 31-7. Tang, Y., Zhang, Y., Liu, S., Sun, Z., Wang, C., Li, L., Zhou, W. and Cheng, S., 2019. 14-3-3zeta binds to and stabilizes phospho-beclin 1(S295) and induces autophagy in hepatocellular carcinoma cells, J Cell Mol Med. Wang, Z. and Choi, M.E., 2014. Autophagy in kidney health and disease, Antioxid Redox Signal. 20, 519-37. Lenoir, O., Tharaux, P.L. and Huber, T.B., 2016. Autophagy in kidney disease and aging: lessons from rodent models, Kidney Int. 90, 950-964. Teng, A.C., Miyake, T., Yokoe, S., Zhang, L., Rezende, L.M., Jr., Sharma, P., MacLennan, D.H., Liu, P.P. and Gramolini, A.O., 2015. Metformin increases degradation of phospholamban via autophagy in cardiomyocytes, Proc Natl Acad Sci U S A. 112, 7165-70. Wei, Y. and Huang, J., 2019. Role of estrogen and its receptors mediated-autophagy in cell fate and human diseases, J Steroid Biochem Mol Biol. 191, 105380. Chen, Y., Zhu, C.J., Zhu, F., Dai, B.B., Song, S.J., Wang, Z.Q., Feng, Y.B., Ge, J.F., Zhou, R.P. and
Chen, F.H., 2018. Necrostatin-1 ameliorates adjuvant arthritis rat articular chondrocyte injury via inhibiting ASIC1a-mediated necroptosis, Biochem Biophys Res Commun. 504, 843-850. Zhang, Y, Qian X, Yang X, Niu, R, Song, S, Zhu F, Zhu C, Peng, X, Chen F.H 2019. ASIC1a induces synovial inflammation via the Ca2+/NFATc3/ RANTES pathway， Zhou, R., Wu, X., Wang, Z., Ge, J. and Chen, F., 2015. Interleukin-6 enhances acid-induced apoptosis via upregulating acid-sensing ion channel 1a expression and function in rat articular chondrocytes, Int Immunopharmacol. 29, 748-760. Debnath, J., Baehrecke, E.H. and Kroemer, G., 2005. Does autophagy contribute to cell death?, Autophagy. 1, 66-74. Dai, B., Zhu, F., Chen, Y., Zhou, R., Wang, Z., Xie, Y., Wu, X., Zu, S., Li, G., Ge, J. and Chen, F., 2017. ASIC1a Promotes Acid-Induced Autophagy in Rat Articular Chondrocytes through the AMPK/FoxO3a Pathway, Int J Mol Sci. 18. Yuan, F.L., Chen, F.H., Lu, W.G., Li, X., Li, J.P., Li, C.W., Xu, R.S., Wu, F.R., Hu, W. and Zhang, T.Y., 2010. Inhibition of acid-sensing ion channels in articular chondrocytes by amiloride attenuates articular cartilage destruction in rats with adjuvant arthritis, Inflamm Res. 59, 939-47. Li, X., Wu, F.R., Xu, R.S., Hu, W., Jiang, D.L., Ji, C., Chen, F.H. and Yuan, F.L., 2014. Acid-sensing ion channel 1a-mediated calcium influx regulates apoptosis of endplate chondrocytes in intervertebral discs, Expert Opin Ther Targets. 18, 1-14. Verkest, C., Piquet, E., Diochot, S., Dauvois, M., Lanteri-Minet, M., Lingueglia, E. and Baron, A., 2018. Effects of systemic inhibitors of acid-sensing ion channels 1 (ASIC1) against acute and chronic mechanical allodynia in a rodent model of migraine, Br J Pharmacol. 175, 4154-4166. Chen Z, Wang Y, Mai Z, Chen L, Wei J, Lu H, Yuan D and Ai H (2020) Effects of 17beta-Estradiol combined with cyclical compressive stress on the proliferation and differentiation of mandibular condylar chondrocytes. Arch Oral Biol 109:104570. doi: 10.1016/j.archoralbio.2019.104570 Slowik A, Lammerding L, Zendedel A, Habib P and Beyer C (2018) Impact of steroid hormones E2 and P on the NLRP3/ASC/Casp1 axis in primary mouse astroglia and BV-2 cells after in vitro hypoxia. J Steroid Biochem Mol Biol 183:18-26. doi: 10.1016/j.jsbmb.2018.05.003 Yuan, F.L., Chen, F.H., Lu, W.G., Li, X., Wu, F.R., Li, J.P., Li, C.W., Wang, Y., Zhang, T.Y. and Hu, W., 2010. Acid-sensing ion channel 1a mediates acid-induced increases in intracellular calcium in rat articular chondrocytes, Mol Cell Biochem. 340, 153-9. Zhou, R., Zhu, F., Wu, X., Song, S., Chen, Y., Zhu, C., Dai, B., Qian, X., Wang, K., Hu, W. and Chen, F., 2019. Effects of autophagy on apoptosis of articular chondrocytes in adjuvant arthritis rats, J Cell Mol Med. 23, 7879-7884. Zeng, Z., Leng, T., Feng, X., Sun, H., Inoue, K., Zhu, L. and Xiong, Z.G., 2015. Silencing TRPM7 in mouse cortical astrocytes impairs cell proliferation and migration via ERK and JNK signaling pathways, PLoS One. 10, e0119912. Zaglia, T., Milan, G., Ruhs, A., Franzoso, M., Bertaggia, E., Pianca, N., Carpi, A., Carullo, P., Pesce, P., Sacerdoti, D., Sarais, C., Catalucci, D., Kruger, M., Mongillo, M. and Sandri, M., 2014. Atrogin-1 deficiency promotes cardiomyopathy and premature death via
impaired autophagy, J Clin Invest. 124, 2410-24. Jiang, P. and Mizushima, N., 2015. LC3- and p62-based biochemical methods for the analysis of autophagy progression in mammalian cells, Methods. 75, 13-8. Gregory, N.S., Gautam, M., Benson, C.J. and Sluka, K.A., 2018. Acid Sensing Ion Channel 1a (ASIC1a) Mediates Activity-induced Pain by Modulation of Heteromeric ASIC Channel Kinetics, Neuroscience. 386, 166-174. Wu, X., Ren, G., Zhou, R., Ge, J. and Chen, F.H., 2019. The role of Ca(2+) in acid-sensing ion channel 1a-mediated chondrocyte pyroptosis in rat adjuvant arthritis, Lab Invest. 99, 499-513. Song, M.Y., Li, C.Y., Liu, X.F., Xiao, J.Y. and Zhao, H., 2018. Effect of 17beta-oestradiol on T-type calcium channels in the lateral habenula, J Neuroendocrinol. 30, e12629. Choudhury, N. and Sikdar, S.K., 2018. 17beta-estradiol potentiates TREK1 channel activity through G protein-coupled estrogen receptor, J Steroid Biochem Mol Biol. 183, 94-105. Evanson, K.W., Goldsmith, J.A., Ghosh, P. and Delp, M.D., 2018. The G protein-coupled estrogen receptor agonist, G-1, attenuates BK channel activation in cerebral arterial smooth muscle cells, Pharmacol Res Perspect. 6, e00409. Schneider, A.H., Kanashiro, A., Dutra, S.G.V., Souza, R.D.N., Veras, F.P., Cunha, F.Q., Ulloa, L., Mecawi, A.S., Reis, L.C. and Malvar, D.D.C., 2019. Estradiol replacement therapy regulates innate immune response in ovariectomized arthritic mice, Int Immunopharmacol. 72, 504-510. Chen, J.Q., Yager, J.D. and Russo, J., 2005. Regulation of mitochondrial respiratory chain structure and function by estrogens/estrogen receptors and potential physiological/pathophysiological implications, Biochim Biophys Acta. 1746, 1-17. Sun, Y., Yang, J., Liu, W., Yao, G., Xu, F., Hayashi, T., Onodera, S. and Ikejima, T., 2019. Attenuating effect of silibinin on palmitic acid-induced apoptosis and mitochondrial dysfunction in pancreatic beta-cells is mediated by estrogen receptor alpha, Mol Cell Biochem. 460, 81-92. Fex, M., Nicholas, L.M., Vishnu, N., Medina, A., Sharoyko, V.V., Nicholls, D.G., Spegel, P. and Mulder, H., 2018. The pathogenetic role of beta-cell mitochondria in type 2 diabetes, J Mahmoodzadeh, S. and Dworatzek, E., 2019. The Role of 17beta-Estradiol and Estrogen Receptors in Regulation of Ca(2+) Channels and Mitochondrial Function in Cardiomyocytes, Front Endocrinol (Lausanne). 10, 310. Xu, K., Sha, Y., Wang, S., Chi, Q., Liu, Y., Wang, C. and Yang, L., 2019. Effects of Bakuchiol on chondrocyte proliferation via the PI3K-Akt and ERK1/2 pathways mediated by the estrogen receptor for promotion of the regeneration of knee articular cartilage defects, Cell Prolif. 52, e12666. Ikeda, K., Tsukui, T., Imazawa, Y., Horie-Inoue, K. and Inoue, S., 2012. Conditional expression of constitutively active estrogen receptor alpha in chondrocytes impairs longitudinal bone growth in mice, Biochem Biophys Res Commun. 425, 912-7. Vomero, M., Barbati, C., Colasanti, T., Perricone, C., Novelli, L., Ceccarelli, F., Spinelli, F.R., Di Franco, M., Conti, F., Valesini, G. and Alessandri, C., 2018. Autophagy and Rheumatoid Arthritis: Current Knowledges and Future Perspectives, Front Immunol. 9, 1577. Huang, X., Li, Y., Shou, L., Li, L., Chen, Z., Ye, X. and Qian, W., 2019. The molecular mechanisms underlying BCR/ABL degradation in chronic myeloid leukemia cells
promoted by Beclin1-mediated autophagy, Cancer Manag Res. 11, 5197-5208. Pan, T., Kondo, S., Le, W. and Jankovic, J., 2008. The role of autophagy-lysosome pathway in neurodegeneration associated with Parkinson's disease, Brain. 131, 1969-78. Larsen, K.E. and Sulzer, D., 2002. Autophagy in neurons: a review, Histol Histopathol. 17, 897-908. Eaton, D.C., Malik, B., Bao, H.F., Yu, L. and Jain, L., 2010. Regulation of epithelial sodium channel trafficking by ubiquitination, Proc Am Thorac Soc. 7, 54-64. Iwata, A., Riley, B.E., Johnston, J.A. and Kopito, R.R., 2005. HDAC6 and microtubules are required for autophagic degradation of aggregated huntingtin, J Biol Chem. 280, 40282-92. Allison, H. and McNamara, L.M., 2019. Inhibition of osteoclastogenesis by mechanically stimulated osteoblasts is attenuated during estrogen deficiency, Am J Physiol Cell Physiol. 317, C969-C982.
Figure Legends
Fig. 1 Effects of 17β-E2 on acid-induced chondrocyte injury. A. Different concentrations of 17β-E2 on viability of chondrocyte were assessed by MTT assay. B, C and D. Cell viability were detected by MTT assay after acidification. E. Representative phase-contrast images taken after treatment with the indicated solutions. F. Mitochondrial membrane potential were measured by Rhodamine 123 after pretreatment. All data are expressed as mean±SD ###
#
P<0.05,
##
P<0.01,
P<0.001versus control; *P<0.05, **P<0.01, ***P<0.001 versus pH6.0 group.
Fig. 2 Effects of 17β-E2 on ASIC1a expression and activity. A. Western blot analysis of ASIC1a protein in chondrocyte in different concentrations. C. Western blot analysis of ASIC1a protein in different times. B, D. Real time PCR analysis of ASIC1a mRNA in chondrocyte in different concentrations and times. E. Immunofluorescence of ASIC1a expression. F. Laser confocal analysis of ASIC1a activity. All data are expressed as mean±SD. #P<0.05, ##P<0.01, ###P<0.001versus control.
Fig. 3 17β-E2 activate autophagy and degrade ASIC1a protein. A. Western blot
analysis of ASIC1a protein expression, after treatment with CHX (cycloheximide) for 6 hours. B. Results were detected by western blot when cells were pretreated with CHX with or without 17β-E2. C-F. After chondrocyte were pretreated with lysosome inhibitors CQ, 3-MA, ALLN, MG-312 with or without 17β-E2, ASIC1a protein were analyzed by Western blot. G. Western blot analysis of LC3-II, Beclin-1 levels. H. Results of LC3-II and Beclin-1 were measured by Western blot after treatment with autophagy inhibitor CQ in absence and presence of 17β-E2. I. Immunofluorescence of LC3 levels in chondrocytes. All data are expressed as mean±SD. #P<0.05, ###
##
P<0.01,
P<0.001versus control; *P<0.05, **P<0.01, ***P<0.001 versus 17β-E2 group;
&
P<0.05 versus CQ.
Fig. 4 17β-E2 decreases ASIC1a protein expression via ERα. A. ASIC1a protein expression was analyzed by Western blot after treatment with estrogen receptors non-selective blockers ICI with or without 17β-E2. B. The level of ASIC1a protein was further measured by Western blot after pre-treated with estrogen receptor ERα, β, GPR30 special blockers (MPP, PHTPP, G15) in the presence of 17β-E2. C. Changes in ASIC1a protein expression were assessed by Western blot after combined treatment of MPP, ERα interference fragment, negative control with 17β-E2. All data are expressed as mean±SD.
#
P<0.05,
##
P<0.01,
###
P<0.001versus control; *P<0.05,
**P<0.01, ***P<0.001 versus 17β-E2 group.
Fig. 5 17β-E2 attenuates acid-mediated apoptosis. A. Acid-induced chondrocytes apoptosis were detected by Annexin-V/PI Assay after pretreatment with 17β-E2 and PcTX1. B. Hoechst Staining analysis of chondrocyte apoptosis. C. Chondrocytes were treated with ICI in absence and presence of 17β-E2, then incubated in pH 6.0, Western blot analysis of casepase-9, PARP and ASIC1a protein expression. D. 17β-E2, ASIC1a special inhibitor PcTX1 and shASIC1a attenuated acid-induced chondrocytes apoptosis by western blotting for casepase-9, PARP. E. 17β-E2 reduce ASIC1a-mediated cell apoptosis by western blot analysis for ASIC1a, casepase-9, PARP, after pretreatment with PcTX1 with or without 17β-E2. All data are expressed
as mean±SD. #P<0.05,
##
P<0.01,
***P<0.001 versus pH6.0 group.
###
P<0.001 versus control; *P<0.05, **P<0.01,
S0303-7207(20)30042-3
DOI:
https://doi.org/10.1016/j.mce.2020.110742
Reference:
MCE 110742
To appear in:
Molecular and Cellular Endocrinology
Received Date: 11 October 2019 Revised Date:
4 January 2020
Accepted Date: 27 January 2020
Please cite this article as: Song, S.-J., Tao, J.-J., Li, S.-F., Qian, X.-W., Niu, R.-W., Wang, C., Zhang, Y.-H., Chen, Y., Wang, K., Zhu, F., Zhu, C.-J., Ma, G.-G., Yang-Yang, , Peng, X.-Q., Zhou, R.-P., Chen, F.-H., 17β-estradiol attenuates rat articular chondrocyte injury by targeting ASIC1a-mediated apoptosis, Molecular and Cellular Endocrinology (2020), doi: https://doi.org/10.1016/j.mce.2020.110742. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier B.V.
17β-estradiol attenuates rat articular chondrocyte injury by targeting ASIC1a-mediated apoptosis Su-Jing Song1,2 Jing-Jing Tao1,2 Shu-Fang Li1,2 Xue-Wen Qian1,2 Ruo-Wen Niu1,2 Cong Wang1,2 Yi-Hao Zhang1,2 Yong Chen3 Ke Wang1,2 Fei Zhu1,2 Chuan-Jun Zhu1,2 Gang-Gang Ma3 Yang-Yang3 Xiao-Qing Peng1,2 Ren-Peng Zhou3* Fei-Hu Chen1,2*
1
The Key Laboratory of Major Autoimmune Diseases, Anhui Institute of Innovative
Drugs, School of Pharmacy, Anhui Medical University, Hefei 230032, China;
2
The Key Laboratory of Anti-inflammatory and Immune Medicines, Ministry of
Education, Hefei 230032, China.
3
Department of Clinical Pharmacology, The Second Hospital of Anhui Medical
University, Hefei 230601, China
*Corresponding author
Prof. Fei-Hu Chen, School of Pharmacy, Anhui Medical University, Hefei230032, China. E-mail: [email protected]. Tel./fax: +8655165161116.
Dr. Ren-Peng Zhou, The Second Hospital of Anhui Medical University, Department of Clinical Pharmacology, Hefei, 230601, China. E-mail: [email protected]. Tel./fax: +8655163806057.
Abstract
Epidemiological evidence suggests that the etiology and pathogenesis of rheumatoid arthritis (RA) are closely associated with estrogen metabolism and deficiency. Estrogen protects against articular damage. Estradiol replacement therapy ameliorates local inflammation and knee joint swelling in ovariectomized models of RA. The mechanistic basis for the protective role of 17β-estradiol (17β-E2) is poorly understood. Acid-sensing ion channel 1a (ASIC1a), a sodium-permeable channel, plays a pivotal role in acid-induced articular chondrocyte injury. The aims of this study were to evaluate the role of 17β-E2 in acid-induced chondrocyte injury and to determine the effect of 17β-E2 on the level and activity of ASIC1a protein. Results showed that pretreatment with 17β-E2 attenuated acid-induced damage, suppressed apoptosis, and restored mitochondrial function. Further, 17β-E2 was shown to reduce protein levels of ASIC1a through the autophagy-lysosomal pathway, to protect chondrocytes from acid-induced apoptosis, and to induce ASIC1a protein degradation through the ERα receptor. Taken together, these results show that the use of 17β-E2 may be a novel strategy for the treatment of RA by reducing cartilage destruction through down-regulation of ASIC1a protein levels.
Keywords: 17β-E2, ASIC1a, Apoptosis, Autophagy, Degradation, Rheumatoid arthritis
1. Introduction
Rheumatoid arthritis (RA) is one of top age-related chronic syndromes, characterized by inflammatory cell infiltration, synovial hyperplasia, inflammation, and vasospasm formation. All of which lead ultimately to joint destruction, cartilage erosion, and functional disability. RA incidence accounts for 1% of all worldwide disorders (Evangelatos, Fragoulis, Koulouri et al., 2019, Raterman and Lems, 2019). With
increasing age, the incidence of RA also increases, resulting in disability and loss of workplace labor. As such, it is imperative to find potential and effective therapies for the treatment of RA (McInnes and Schett, 2011, Smolen, Aletaha, Barton et al., 2018). A common characteristic of hospitalized patients is an increased incidence of RA in menopausal women with low levels of estrogen, suggesting a regulatory role for estrogen in the pathological process of RA (Sapir-Koren and Livshits, 2017, Islander, Jochems, Lagerquist et al., 2011). For the last few decades, investigations have focused on sex steroid hormones, specifically 17β-E2. Those investigations demonstrated suppression of synovial inflammation by sex steroid hormone inhibition of the immune system (Cui et al., 2013, Faraci, Taugher, Lynch et al., 2019). A large body of evidence demonstrates estrogen effects to be a crucial and essential anti-inflammatory and anti-ossifying molecule, important in vasospasm formation (Sapir-Koren and Livshits, 2017, Islander et al., 2011). Further, estrogen deficiency is considered to be the main cause of postmenopausal osteoporosis (Khosla et al., 2011). However, the detailed effects of estrogen in RA are unclear.
Investigations of estrogen in RA were focused by the fact that estrogen receptors are widely distributed in the synovium, chondrocytes, and bone (Carlsten, 2005). It has been previously shown that estrogen may act on ion channels to modulate immune system diseases by binding to cognate receptors; ERα, ERβ, and GPR30 (Qu, Liu, Ren et al., 2015, Chaban and Micevych, 2005). Autophagy is a catabolic mechanisms by which abnormal proteins and dysfunctional organelles are degraded and recycled, sustaining cellular homeostasis in several pathological conditions including RA (Tang, Zhang, Liu et al., 2019, Wang and Choi, 2014, Lenoir, Tharaux and Huber, 2016). Recently, estrogen and its receptors have been shown to play a significant role in autophagy, which is associated with cell fate and human disease (Wei and Huang, 2019, Teng, Miyake, Yokoe et al., 2015). However, the mechanistic basis for the effects of estrogen and its receptors in RA are poorly understood.
Acid sensing ion channels (ASICs) are important sensors of protons that belong to
the epithelial sodium channel superfamily. Currently, at least six subunits (ASIC1a, ASIC1b, ASIC2a, ASIC2b, ASIC3, and ASIC4) have been cloned and identified in both central and peripheral systems (Chen, Zhu, Zhu et al., 2018). Among these, ASIC1a is found primarily in chondrocytes, the synovium, bone, and muscle, where slight changes in extracellular acidosis can be detected (Zhang et al., 2019). Acid-induced ASIC1a activation results in Na2+ and Ca2+influx, leading to a series of pathological and physiological changes. Tissue acidification is a common feature of RA that results in irreversible damage to articular chondrocytes (Zhou, Wu, Wang et al., 2015, Debnath, Baehrecke and Kroemer, 2005). Moreover, decreased pH aggravates cartilage damage (Dai, Zhu, Chen et al., 2017). Our previous investigations have demonstrated that blocking ASIC1a with a special inhibitor, PcTX1, significantly reduced acid-induced articular chondrocyte injury, which suggests that ASIC1a activation is involved in acid-induced chondrocyte injury, and as such, serve as a potential therapeutic target for RA therapy (Yuan, Chen, Lu et al., 2010, Li, Wu, Xu et al., 2014, Verkest, Piquet, Diochot et al., 2018). It has been reported that estrogen can regulate ion channel function. However, it is unclear whether estrogen and its receptors have a regulatory effect on ASIC1a-mediated articular chondrocyte injury.
Therefore, we explored the effect of 17β-E2 on ASIC1a expression and function, evaluated its protective effect on acid-induced articular chondrocyte injury, and determined its role in ASIC1a-mediated chondrocyte apoptosis.
2. Materials, Reagents and Methods
2.1. Cell Culture and Treatment
Male Sprague–Dawley rats weighting between 120 and 140 g were purchased from the Laboratory Animal Sciences of Anhui Medical University. Animals were supplied with sufficient food for one night in a room at 37oC and 75% humidity. The next day,
cells were removed from the animals and placed in primary cell culture as described previously (Yuan, Chen, Lu et al., 2010). Briefly, joint tissue was separated from the rats and chondrocyte digestion performed. The cartilage tissue was gently cut into small pieces of approximately 1 mm3 and then digested with 0.2% type II collagenase in a 37oC incubator for 5 hours in phosphate buffered saline (PBS). The chondrocytes were carefully separated after digestion with a filter. The primary cells were incubated in 25 mL cell culture plates (Corning Inc., Corning, NY, USA) supplemented with Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Grand Island, NY, USA) consisting of 10% fetal bovine serum (FBS) (Gibco) and antibiotics (Invitrogen, Carlsbad, CA, USA) at a density of 2×104 cells/cm2. The cells were cultured for two or three generations prior to use. For acid stimulation, the extracellular medium pH was adjusted by the addition of an appropriate amount of HCl to achieve a pH pf 6.0 (Li et al., 2014). Chondrocytes exposed to pH 6.0 conditions for 3 hours served as the in vitro model. Our previous results showed that extracellular acidosis caused chondrocyte damage at pH 6.0 for 3 hours (Yuan, Chen, Lu et al., 2010, Li, Wu, Xu et al., 2014). Cells were pretreated with an ASIC1a-specific blocker, PcTX1 (100 ng/mL; Abcam, Cambridge, MA, USA), and estrogen receptor selective and specific antagonists ICI182780 and MPP/PHTPT/G15 (1 µM; Sigma-Aldrich, St. Louis, MO, USA). The effective concentration of 17β-E2 was determined from the literature (Chen, Wang, Mai et al., 2020, Slowik, Lammerding, Zendedel et al., 2018).
2.2. MTT Assay
The cells were uniformly seeded in 96-well plates overnight, treated with 500, 1000, and 2000 nM of 17β-E2 and fresh medium for 48 hours, followed by acidification for 3 hours in an acidified medium at pH 6.0. After treatment, cell viability was assessed by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay as follows; 40 µL of MTT were added to each well and incubated for 4 hours, then 150 µL of DMSO were added to dissolve the formazan. Next, cells were incubated with 17β-E2 estrogen receptor non-specific blocker ICI or PcTX1 with fresh medium, acidified for 3 hours, and assayed for cell viability by the MTT assay. The absorbance values at 492 nm were detected with a microplate reader ( Biotek, Vermont, USA).
2.3. Detection of Mitochondrial Membrane Potential
Chondrocytes were seeded in six-well plates. After treatment with 17β-E2 and acidification, the cells were incubated with Rhodamine123 at a final concentration of 1 mM. After culture in an incubator for 30 minutes, the cells were observed with a fluorescent inverted microscope.
2.4. Laser Confocal Microscopy
Laser confocal microscopy was used to detect extracellular calcium influx to assess the effect of 17β-E2 on the activity of ASIC1a. Primary chondrocytes were incubated on 25 mm diameter glass coverslips, treated with 1000 nM of 17β-E2 for 72 hours, and then processed according to the instructions provided by the reagent manufacturer. After treatment, the cells were washed with D-Hank’s solution three times, and incubated with 5 µmol/L of Fluo-3/AM dye at 37oC in a humidified 5% CO2 incubator for 30 minutes. To the center of each small dish was added 150 µL. The cells were cleared with D-Hank’s solution three times to remove residual dye (gently avoiding cell washing), then 2 mL of D-Hank’s solution were added for 10 minutes. The cells were continuously scanned by laser confocal for 5 minutes to detect the influx of calcium ions at an excitation wavelength of 488 nm. During the detection, 1 mL of pH 6.0 Hank’s solution containing calcium ions was added.
2.5. Immunofluorescence Staining
Chondrocytes were seeded on coverslips, cultured for 2 days, and then treated with 1000 nM 17β-E2 for 48 hours. The coverslips were washed three times with PBS, fixed with paraformaldehyde for 15 minutes, and then permeabilized with 0.5% Triton X-100 for 10 minutes. After blocking for 30 minutes with 5% BSA, the coverslips were incubated overnight at 4oC with ASIC1a reactive, LC3 antibody (Zhang et al., 2019, Zhou, Zhu, Wu et al., 2019). The cells were washed three times,
incubated with fluorescein isothiocyanate (FITC)-conjugated anti-rat IgG (Molecular Probes, Beijing, China) in the dark for 1 hour at room temperature. Cell nuclear was stained with 4′,6-diamidino-2-phenylindole, dilactate (DAPI; Invitrogen, Carlsbad, CA, USA) for 10 minutes. After washing, the samples were assessed with an inverted fluorescent microscope (Olympus, Tokyo, Japan).
2.6. Small Interfering RNA (siRNA) Transfection
After transfection of small interfering RNA (siRNA) fragments of ASIC1a and ERα into chondrocytes using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA), the cells were incubated in Opti-MEM (Gibco) medium under dark conditions. After 6 hours, chondrocytes were cultured in normal complete medium for 24 hours. The ASIC1a and ERα specific siRNAs were synthesized by GenePharma (Shanghai, China).
Sequences
are
listed
below:
ASIC1a;
5’-CACCGCCAAGAAGTTCAACAAATCGTTCAAGAGACGATTT GTTGAACTTCTTGGCTTTTTTG-3’
(Forward)
and
5’-GATCCAAAAAA
GCCAAGAAGTTCAACAAATCGTCCTTGAACGATTTGTTG AACTTCTTGGC-3’ (Reverse); ERα; GCCUCAAUGAUGGGCUUAUTT (Forward) AUAAGCCCAUCAUUGAGGCTT (Reverse).
2.7. Flow Cytometry
Cells were digested and centrifuged at 2,000 rpm for 5 minutes and pellets were collected. Supernatants were discarded and the pellets were washed three times with pre-cooled PBS. Cells were suspended in 400 µL of binding buffer. To the suspension was added to 5 µL of AnnexinV-FITC, completely mixed (note that the action was gentle to avoid cell damage), and incubated for 15 minutes in the dark at 2 - 8oC. Finally, 10 µL of propidium iodide (PI) were added, gently mixed, and then incubated for 5 minutes, as above. After this treatment, the mixture was assessed by flow cytometry. Chondrocytes were pretreated with 17β-E2 and PcTX1 and incubated with
extracellular acid (pH 6.0) for an additional 3 hours. Cell apoptosis was observed by flow cytometry with an AnnexinV-FITC/PI (BestBio) kit.
2.8. Quantitative Real-Time Polymerase Chain Reaction (PCR)
Total RNA was extracted by the standard Trizol method (Invitrogen, Shanghai) according to the instructions. Real-time quantitative PCR has been described in detail in previous literature (Zeng, Leng, Feng et al., 2015). cDNA was synthesized using PrimeScript RT reagent Kit (TaKaRa, Japan). PCR reactions were performed using SYBR-green PCR master mix (TaKaRa, Japan). The process of PCR amplification consisted of denaturation at 95oC for 10 min, 40 cycles of denaturation at 95oC for 5 seconds, annealing and extension at 61oC for 10 seconds, followed by melt curve detection from 65 to 95°C. Primers were designed with GenBank sequences and synthesized by Invitrogen. ASIC1a and β-actin primer sequences are summarized below: ASIC1a, forward, 5’-GGCCAACTTCCGTAGCTTCA-3’ and reverse, 5’-ATGCCCTGCTCTGTCGTAGAA-3’; 5’-GAGACCTTCAACACCCCAGC-3’
β-actin,
forward
and
reverse
5’-ATGTCACGCACGATTTCCC-3’. β-actin was used as an endogenous control, ∆∆
Ct values were calculated with β-actin as the reference. Relative expression levels
of target mRNAs were calculated as 2−∆∆Ct.
2.9. Hoechst Staining
Cells were cultured in six-well plates with a cover glass. The cells were pretreated with 1000 nM 17β-E2, acidified for 3 hours, and fixed with paraformaldehyde for 15 minutes. Cells were washed two times with PBS and then stained with Hoechst 33258 (BestBio, Shanghai, China) for 20 minutes in the dark. Cells were observed and photographed with an inverted fluorescent microscope (Olympus, Tokyo, Japan).
2.10. Western Blotting Analysis
Cells were seeded in six-well plates and proteins extracted after appropriate treatment. Proteins were extracted with lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, protease inhibitor, and phosphatase inhibitor). Lysates were centrifuged at 12,000 rpm for 4 minutes at 4oC. After supernatant removal, one-quarter protein loading buffer was added and boiled for 10 minutes in a 99oC water bath. Protein concentration was determined with a bicinchoninic acid (BCA) protein assay kit (Boster, Wuhan, China). Related proteins were separated by 10% or 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) (10%, 80 V for 30 min and then 120 V for 90 minutes) and transferred to polyvinylidene difluoride (PVDF) membranes. After incubating the PVDF membrane in 5% non-fat milk for 2-3 hours, the membranes were washed three times with Tris-buffered saline with Tween 20 (TBST) on a shaker for 15 minutes. Then membranes were probed with primary antibodies reactive against ASIC1a (Affinity 1:1000), LC3 (Cell Science Technology 1:1000), Beclin-1 (Affinity 1:1000), PARP (Cell Science Technology 1:1000), and Caspase-9 (Abcam 1:1000) at 4oC overnight, followed by horseradish peroxidase- conjugated goat anti-mouse or anti-rabbit antibodies at 37oC for approximately 1 hour. After washing with TBST three times, the chemiluminescent bands were detected using an ECL-chemiluminescent kit. Quantitative target protein levels were assessed with ImageJ software.
2.11 Statistical Analysis
All data are presented as means ± standard deviation. Differences between groups were assessed by analysis of variance (ANOVA) followed by a Dunnett’s or Tukey HSD post-hoc test and the Student’s t-test. P < 0.05 was considered statistically significant.
3. Results
3.1. 17β-E2 attenuates acid-induced injury of articular chondrocytes
We first evaluated the effect of 17β-E2 on chondrocyte viability. The MTT assay demonstrated different concentrations of 17β-E2 to have no effect on cell growth, as shown in Fig. 1A. However, under acidic conditions (pH 6.0), the cell viability was reduced by 45.3 ± 1.1% compared with the normal group, and the chondrocyte viability was improved after pretreatment with estradiol (500, 1000, 2000 nM) (Fig. 1B). Moreover, MTT results also showed the protective effect of 17β-E2 was blocked by 1 µM ICI182780, an estrogen receptor inhibitor, as shown in Fig. 1C. This result implies that 17β-E2-mediated protection may be through either of the estrogen receptors. Consistent with our previous results, cell viability was improved by pretreatment with a ASIC1a specific inhibitor, PcTX1 (Fig. 1D). However, our current results also showed complete blocking of ASIC1a with the specific inhibitor, PcTX1. 17β-E2 did not further increase the protection of chondrocytes, indicating that ASIC1a activation is largely involved in 17β-E2-mediated protection. Cell morphology analysis demonstrated acid-induced cell body deformation was alleviated after treatment with 17β-E2 or PcTX1 (Fig. 1E). Mitochondrial membrane potential, as a measure of mitochondrial function, plays an important role in cell survival. Fig. 1F shows that 1000 nM 17β-E2 significantly reduced the loss of mitochondrial membrane potential induced by acidification. Taken together, these results suggest that 17β-E2 protects from acid-induced articular chondrocyte injury.
3.2. 17β-E2 decreases ASIC1a protein expression and activity of articular chondrocytes
To explore whether 17β-E2 regulates ASIC1a protein expression, chondrocytes were treated with 17β-E2. As shown in Fig. 2A, 17β-E2 reduced the protein level of ASIC1a at concentrations of 500, 1000, and 2000 nM. The effect was most noticeable at 1000 nM, decreasing ASIC1a by 34.9 ± 1.67% versus control. Moreover, western blot results showed that 17β-E2 reduced ASIC1a protein levels in a time-dependent manner (Fig. 2C). Interestingly, results indicated that 17β-E2 had no effect on the level of ASIC1a mRNA at any concentration or time (Fig.
2B, D).
Immunofluorescence staining of ASIC1a in chondrocytes demonstrated decreased levels with 1000 nM 17β-E2 treatment compared to control (Fig. 2E). Laser confocal microscopy showed that treatment with 1000 nM 17β-E2 for 72 hours had a suppressive effect on acid-induced Ca2+ elevation (Fig. 2F). Preliminarily, these results indicate that 17β-E2 reduces ASIC1a protein levels and channel activity.
3.3. 17β-E2 promotes ASIC1a protein degradation of articular chondrocytes through an autophagy-lysosomal pathway
Protein degradation is essential and crucial for clearance of damaged organelles, as well as for maintenance of physiological homeostasis of phylogenetically diverse organisms. Failure of proper clearance has been shown to have pathological consequences (Zaglia, Milan, Ruhs et al., 2014, Jiang and Mizushima, 2015). Our data show that 17β-E2 did not affect the mRNA level of ASIC1a, but did reduce ASIC1 at the protein level, implying that 17β-E2 is likely involved in ASIC1a degradation (Fig. 1 B, D). To explore whether 17β-E2-mediates the decrease in ASIC1a protein by degradation, we used the protein synthesis inhibitor, cycloheximide, (CHX) (for 0 – 6 hours). In the presence of the protein synthesis inhibitor, ASIC1a protein levels decreased over time, regardless of treatment with 17β-E2 (Fig. 3A). Furthermore, the effect of 17β-E2 on ASIC1a protein levels was detected in the presence or absence of CHX. By western blot analysis, combined treatment with CHX (6 hours) and 17β-E2 showed that the level of ASIC1a protein decreased sharply by 28% compared to CHX-treated cells (Fig. 3B), indicating that 17β-E2 promotes ASIC1a protein degradation.
There are three major pathways of protein degradation; the ubiquitin-proteasome system (UPS), the autophagy–lysosomal pathway (ALP), and the Ca2+-activated protease (calpain) system. To assess the potential mechanism of estradiol-mediated degradation of ASIC1a, chondrocytes were incubated with proteasome inhibitors; MG-312
(10
µM),
chloroquine
(CQ,
50
µM),
and
2-acetamido-4-methyl-N-[4-methyl-1-oxo-1-(1-oxohexan-2-ylamino)pentan-2-yl]pent anamide (ALLN, 100 µM) for 6 hours to inhibit proteasome, lysosome, and Ca2+-activated protease calpain, respectively. As shown in Fig. 3C, pretreatment with the autophagy inhibitor, CQ, inhibited 17β-E2- ASIC1a expression. Further, inhibition of autophagy with 3-MA also attenuated 17β-E2-induced ASIC1a degradation (Fig. 3D). After treatment with the calpain inhibitor, ALLN, and the proteasome inhibitor, MG-312, there was no effect on 17β-E2-reduced ASIC1a protein levels in chondrocytes (Fig. 3 E, F). Results also showed that 17β-E2 increased Beclin-1 and LC3-II expression (Fig. 3G), suggesting that 17β-E2 activates autophagy. Moreover, CQ pretreatment enhanced the accumulation of LC3-II and Beclin-1 in articular chondrocytes induced by 17β-E2 (Fig. 3H). As shown in Fig. 3I, immunofluorescence staining of LC3 was increased in chondrocytes after pretreatment with1000 nM 17β-E2. These findings suggest that 17β-E2 activates autophagy and promotes ASIC1a degradation in chondrocytes through activation of the ALP, but not the UPS, or Ca2+-activated protease pathway.
3.4. 17β-E2 reduces ASIC1a protein levels through articular chondrocyte ERα
Estrogen biological effects are mediated by the nuclear receptors ERα and ERβ, as well as the member receptor GPER (also known as GPR30). To determine which estrogen receptor is involved in regulation of ASIC1a, cells were pretreated with a selective ER antagonist, ICI182780 (ICI, 1 µM). The results showed that the effect of 17β-E2 on ASIC1a was inhibited by ICI (Fig. 4A). By western blot, pretreatment with a nuclear (ERα and ERβ) or membrane receptor (GPER) antagonist (1 µM MPP/PHTPP/G15) showed that attenuation of ASIC1a induced by 17β-E2 was reversed (Fig. 4B). More significant reversal effects were produced by ERα blocker MPP when compared to the other two antagonists. In addition, siRNA silencing of ERα significantly increased ASIC1a protein levels compared to 17β-E2 (Fig. 4C). These results indicated that ERα, but not ERβ or GPR30, is involved in 17β-E2-induced ASIC1a protein degradation.
3.5. 17β-E2 reduces acid-induced apoptosis by targeting ASIC1a of articular chondrocytes
Flow cytometry was performed to verify the protective effect of 17β-E2. As shown in Fig. 5A, apoptosis was ameliorated in acid-treated chondrocytes after pretreatment with 17β-E2 (1000 nM) for 72 hours. Moreover, Hoechst staining showed that acid-induced chondrocytes exhibited nuclear shrinkage, with dense blue fluorescence and DNA fragments pale in color, which were relieved by17β-E2 treatment (Fig. 5B). To further assess the effect of 17β-E2 on chondrocytes apoptosis, cells were cultured with an estrogen nuclear receptor blocker, 1 µM ICI, with or without 17β-E2. After treatment in pH 6.0 medium, changes in caspase-9 and PARP were relieved in comparison to the pH 6.0 group (Fig. 5C). Apoptosis is related to activation of ASIC1a (Li et al., 2014). We found that PcTX1, a selective inhibitor of ASIC1a, had a better suppressive effect on apoptosis (Fig. 5D), suggesting that ASIC1a activation is involved in acid-induced chondrocyte apoptosis. To further confirm the relationship between the estrogen-mediated protective effect and ASIC1a-induced chondrocytes apoptosis, combined pretreatment with PcTX1 and 17β-E2 was found to not change the level of caspase-9 or PARP compared to PcTX1 (Fig. 5E). These data suggest that17β-E2 protects from acid-induced chondrocyte apoptosis through ASIC1a channels. Taken together, these results demonstrate that 17β-E2 decrease ASIC1a levels and are partly responsible for acid-mediated chondrocyte protection.
4. Discussion
In the present study, we explored the effects of 17β-E2 on ASIC1a channel expression and activity. The results demonstrated that 17β-E2 protects chondrocytes from acid-induced and ASIC1a-mediated injury by inhibiting apoptosis and mitochondrial dysfunction. Further, we demonstrated that 17β-E2 decrease ASIC1a protein levels and function. Moreover, we found that 17β-E2 activated autophagy and promoted ASIC1a protein degradation through the autophagy–lysosomal pathway.
Furthermore, we showed that ERα is involved in17β-E2-mediated ASIC1a protein degradation. Finally, we demonstrated that 17β-E2 alleviated acid-induced and ASIC1a-mediated chondrocyte apoptosis. Taken together, these results indicate that 17β-E2 protects against acid-induced articular chondrocyte injury through reduced ASIC1a protein levels and channel activity.
RA is an immune systemic disease associated with joint synovial inflammation and bone loss. Tissue acidification is a common feature of this inflammatory disease. The accumulated evidence demonstrates the involvement of the ASIC1a proton channel in acid-induced injury and bone damage by increasing chondrocyte apoptosis and synovial inflammation in RA (Gregory, Gautam, Benson et al., 2018, Wu, Ren, Zhou et al., 2019). Results of our previous studies showed that inhibition or deficiency of ASIC1a protected against acid-induced articular injury, suggesting that targeting ASIC1a may have a role in RA therapy (Zhou, Zhu, Wu et al., 2019, Dai, Zhu, Chen et al., 2017, Chen, Zhu, Zhu et al., 2018). It is still largely unknown why elderly females are more inclined to develop RA than elderly males. 17β-E2 has an effect on T-type calcium channels, potassium channels, N-methyl-D-aspartate acid receptor 1, TREK1, and BK channels (Song, Li, Liu et al., 2018, Choudhury and Sikdar, 2018, Evanson, Goldsmith, Ghosh et al., 2018). In the present study, we explored the effects of 17β-E2 on the ASIC1a of articular chondrocytes. Our results showed that prolonged exposure of chondrocyte to 17β-E2 reduced ASIC1a protein levels in a time dependent manner and ASIC1a-mediated Ca2+ influx through inhibition of ASIC1a activation.
Several studies have shown the beneficial effects of estrogen on the pathology associated with RA. In several models of arthritis, estrogen produces beneficial effects by inhibition of local cytokine production and attenuation of knee joint swelling. Estrogen deficiency accelerates the severity of joint destruction and bone loss in ovariectomized animals (Schneider, Kanashiro, Dutra et al., 2019). As well, 17β-E2 and estrogen receptors play an important role in mitochondrial damage and
acid-induced apoptosis (Chen, Yager and Russo, 2005, Sun, Yang, Liu et al., 2019). Mitochondria not only participate in Ca2+ homeostasis, but also regulate cell death and apoptosis (Fex, Nicholas, Vishnu et al., 2018), with 17β-E2 playing an essential role in the regulation of mitochondrial function and structure (Mahmoodzadeh and Dworatzek, 2019). In the present study, 17β-E2 was shown to protect from acid-induced articular chondrocyte injury and ASIC1a-mediated apoptosis. Further, 17β-E2 attenuated acid-induced mitochondrial injury by restoring membrane integrity. Moreover, with inhibition of ASIC1a by a specific blocker, PcTX1, 17β-E2 did not produce an additional protective effect on articular chondrocyte damage. These results suggest the protective role of 17β-E2 on acid-induced chondrocyte injury is due to a decrease in ASIC1a protein levels and channel activity.
It is well known that the effect of estrogen on target tissues and organs is through its receptors. ERα is a nuclear receptor expressed in tissues, including cartilage and bone adjacent to joint inflammation, as well as in other peripheral tissues such as the thymus and spleen that can be related to autoimmune disease (Xu, Sha, Wang et al., 2019, Ikeda, Tsukui, Imazawa et al., 2012). Ikeda et al. found ERα to play a critical role in chondrocyte proliferation and maturation during longitudinal bone growth (Ikeda et al., 2012). However, the underlying mechanistic basis for this is poorly understood. Our present data show that the nuclear receptor, ERα, is expressed in chondrocytes. We found that in chondrocytes, ICI187280, a high-affinity nuclear receptor antagonist, reversed the 17β-E2 mediated decrease in ASIC1a protein levels. Furthermore, we showed that pharmacological inhibition and deficiency in ERα blocked the 17β-E2 induced reduction in ASIC1a protein levels. Taken together, these results demonstrate the ERα to be involved in the 17β-E2 induced reduction in ASIC1a protein levels and in ASIC1a-mediated chondrocyte apoptosis.
Autophagy is required for cellular growth, survival, proliferation, and stability during diverse physiological and pathological conditions such as RA. The involvement of autophagy in acidotic pathologic conditions in RA, was the focus of
our previous studies (Zhou et al., 2019). A recent study showed that activation of autophagy is corrected by sex hormone treatment and that estrogen has a significant effect on sex-based autophagy (Wei and Huang, 2019). Vomero et al. reported that estradiol rescued osteoblast apoptosis by promoting autophagy. Beclin-1 and the conversion of LC3, markers that reflect autophagy progression, are important initiators and regulators of autophagy (Jiang and Mizushima, 2015, Huang, Li, Shou et al., 2019). Consistent with that study, our results demonstrated LC3-II and Beclin-1to be up-regulated by 17β-E2 pretreatment of chondrocytes, suggesting that 17β-E2 can enhance the activation of chondrocytes autophagy.
Protein degradation is a complex process that eliminates aberrant cellular components, maintaining cellular homeostasis, and cell survival. Many studies have shown that the ubiquitin-proteasome system (UPS) and the autophagy-lysosomal pathway (ALP) are responsible for the degradation of most misfolded and abnormal proteins (Pan, Kondo, Le et al., 2008, Larsen and Sulzer, 2002), with ALP playing a complementary and alternative role to UPS (Larsen and Sulzer, 2002). Further, amiloride-sensitive epithelial sodium channels (ENaC) have been shown to be degraded by UPS (Eaton, Malik, Bao et al., 2010). Allison et al. reported that fibroblasts
clear excess
and
misfolded
proteins
through
proteasome and
lysosome/autophagy pathways, thus, promoting cell survival (Vomero et al., 2018, Iwata et al., 2005, Allison and McNamara, 2019). Our current data demonstrated 17β-E2 to induce ASIC1a protein degradation. 17β-E2-mediated ASIC1a degradation was inhibited by CQ, a lysosome inhibitor, and 3-MA, an autophagy inhibitor (3-MA). Pretreatment with MG-312 and ALLN (inhibitors of proteasomes and the Ca2+-activated protease calpain, respectively) had no effect on ASIC1a protein degradation in the presence of 17β-E2. Taken together, these results suggest that17β-E2 promotes the degradation of ASIC1a protein via the ALP.
Herein, we demonstrated 17β-E2 to protect from acid-induced articular injury and ASIC1a-mediated chondrocyte apoptosis through the promotion of ASIC1a protein
degradation. This study provides a potential new mechanistic understanding of 17β-E2 mediated protection and provides for potential future treatment strategies for RA.
Highlights
17β-E2 inhibits Ca2+ influx, attenuates apoptosis, and restores articular chondrocyte function during acidosis.
Activation of ASIC1a is involved in acid-induced chondrocyte injury and 17β-E2 protects from ASIC1a-mediated apoptosis.
17β-E2 reduces ASIC1a protein levels through the ERα receptor.
17β-E2 promotes ASIC1a protein degradation via the autophagy lysosomal pathway.
Abbreviations
RA, Rheumatoid arthritis; ASIC1a, Acid Sensing ion channel 1a; 17β-E2, 17β-estradiol; ERα, Estrogen Receptor alpha; ERβ, Estrogen Receptor beta; PcTX1, Psalmotoxin 1; ALP, Autophagy lysosome pathway
Sources of Funding
This work was supported by grants from the National Natural Science Foundation of China (No. 81873986), the Natural Science Foundation of Anhui Province (No: 1908085QH317), and the Scientific Research Fund of Anhui Medical University (2018xkj044).
References Evangelatos, G., Fragoulis, G.E., Koulouri, V. and Lambrou, G.I., 2019. MicroRNAs in rheumatoid arthritis: From pathogenesis to clinical impact, Autoimmun Rev. 18, 102391. Raterman, H.G. and Lems, W.F., 2019. Pharmacological Management of Osteoporosis in Rheumatoid Arthritis Patients: A Review of the Literature and Practical Guide, Drugs Aging. 36, 1061-1072. Smolen, J.S., Aletaha, D., Barton, A., Burmester, G.R., Emery, P., Firestein, G.S., Kavanaugh, A., McInnes, I.B., Solomon, D.H., Strand, V. and Yamamoto, K., 2018. Rheumatoid arthritis, Nat Rev Dis Primers. 4, 18001. McInnes, I.B. and Schett, G., 2011. The pathogenesis of rheumatoid arthritis, N Engl J Med. 365, 2205-19. Sapir-Koren, R. and Livshits, G., 2017. Postmenopausal osteoporosis in rheumatoid arthritis: The estrogen deficiency-immune mechanisms link, Bone. 103, 102-115. Islander, U., Jochems, C., Lagerquist, M.K., Forsblad-d'Elia, H. and Carlsten, H., 2011. Estrogens in rheumatoid arthritis; the immune system and bone, Mol Cell Endocrinol. 335, 14-29. Cui, J., Shen, Y. and Li, R., 2013. Estrogen synthesis and signaling pathways during aging: from periphery to brain, Trends Mol Med. 19, 197-209. Faraci, F.M., Taugher, R.J., Lynch, C., Fan, R., Gupta, S. and Wemmie, J.A., 2019. Acid-Sensing Ion Channels: Novel Mediators of Cerebral Vascular Responses, Circ Res. 125, 907-920. Khosla, S., Melton, L.J., 3rd and Riggs, B.L., 2011. The unitary model for estrogen deficiency and the pathogenesis of osteoporosis: is a revision needed?, J Bone Miner Res. 26, 441-51. Carlsten, H., 2005. Immune responses and bone loss: the estrogen connection, Immunol Rev. 208, 194-206. Qu, Z.W., Liu, T.T., Ren, C., Gan, X., Qiu, C.Y., Ren, P., Rao, Z. and Hu, W.P., 2015. 17beta-Estradiol Enhances ASIC Activity in Primary Sensory Neurons to Produce Sex Difference in Acidosis-Induced Nociception, Endocrinology. 156, 4660-71. Chaban, V.V. and Micevych, P.E., 2005. Estrogen receptor-alpha mediates estradiol attenuation of ATP-induced Ca2+ signaling in mouse dorsal root ganglion neurons, J Neurosci Res. 81, 31-7. Tang, Y., Zhang, Y., Liu, S., Sun, Z., Wang, C., Li, L., Zhou, W. and Cheng, S., 2019. 14-3-3zeta binds to and stabilizes phospho-beclin 1(S295) and induces autophagy in hepatocellular carcinoma cells, J Cell Mol Med. Wang, Z. and Choi, M.E., 2014. Autophagy in kidney health and disease, Antioxid Redox Signal. 20, 519-37. Lenoir, O., Tharaux, P.L. and Huber, T.B., 2016. Autophagy in kidney disease and aging: lessons from rodent models, Kidney Int. 90, 950-964. Teng, A.C., Miyake, T., Yokoe, S., Zhang, L., Rezende, L.M., Jr., Sharma, P., MacLennan, D.H., Liu, P.P. and Gramolini, A.O., 2015. Metformin increases degradation of phospholamban via autophagy in cardiomyocytes, Proc Natl Acad Sci U S A. 112, 7165-70. Wei, Y. and Huang, J., 2019. Role of estrogen and its receptors mediated-autophagy in cell fate and human diseases, J Steroid Biochem Mol Biol. 191, 105380. Chen, Y., Zhu, C.J., Zhu, F., Dai, B.B., Song, S.J., Wang, Z.Q., Feng, Y.B., Ge, J.F., Zhou, R.P. and
Chen, F.H., 2018. Necrostatin-1 ameliorates adjuvant arthritis rat articular chondrocyte injury via inhibiting ASIC1a-mediated necroptosis, Biochem Biophys Res Commun. 504, 843-850. Zhang, Y, Qian X, Yang X, Niu, R, Song, S, Zhu F, Zhu C, Peng, X, Chen F.H 2019. ASIC1a induces synovial inflammation via the Ca2+/NFATc3/ RANTES pathway， Zhou, R., Wu, X., Wang, Z., Ge, J. and Chen, F., 2015. Interleukin-6 enhances acid-induced apoptosis via upregulating acid-sensing ion channel 1a expression and function in rat articular chondrocytes, Int Immunopharmacol. 29, 748-760. Debnath, J., Baehrecke, E.H. and Kroemer, G., 2005. Does autophagy contribute to cell death?, Autophagy. 1, 66-74. Dai, B., Zhu, F., Chen, Y., Zhou, R., Wang, Z., Xie, Y., Wu, X., Zu, S., Li, G., Ge, J. and Chen, F., 2017. ASIC1a Promotes Acid-Induced Autophagy in Rat Articular Chondrocytes through the AMPK/FoxO3a Pathway, Int J Mol Sci. 18. Yuan, F.L., Chen, F.H., Lu, W.G., Li, X., Li, J.P., Li, C.W., Xu, R.S., Wu, F.R., Hu, W. and Zhang, T.Y., 2010. Inhibition of acid-sensing ion channels in articular chondrocytes by amiloride attenuates articular cartilage destruction in rats with adjuvant arthritis, Inflamm Res. 59, 939-47. Li, X., Wu, F.R., Xu, R.S., Hu, W., Jiang, D.L., Ji, C., Chen, F.H. and Yuan, F.L., 2014. Acid-sensing ion channel 1a-mediated calcium influx regulates apoptosis of endplate chondrocytes in intervertebral discs, Expert Opin Ther Targets. 18, 1-14. Verkest, C., Piquet, E., Diochot, S., Dauvois, M., Lanteri-Minet, M., Lingueglia, E. and Baron, A., 2018. Effects of systemic inhibitors of acid-sensing ion channels 1 (ASIC1) against acute and chronic mechanical allodynia in a rodent model of migraine, Br J Pharmacol. 175, 4154-4166. Chen Z, Wang Y, Mai Z, Chen L, Wei J, Lu H, Yuan D and Ai H (2020) Effects of 17beta-Estradiol combined with cyclical compressive stress on the proliferation and differentiation of mandibular condylar chondrocytes. Arch Oral Biol 109:104570. doi: 10.1016/j.archoralbio.2019.104570 Slowik A, Lammerding L, Zendedel A, Habib P and Beyer C (2018) Impact of steroid hormones E2 and P on the NLRP3/ASC/Casp1 axis in primary mouse astroglia and BV-2 cells after in vitro hypoxia. J Steroid Biochem Mol Biol 183:18-26. doi: 10.1016/j.jsbmb.2018.05.003 Yuan, F.L., Chen, F.H., Lu, W.G., Li, X., Wu, F.R., Li, J.P., Li, C.W., Wang, Y., Zhang, T.Y. and Hu, W., 2010. Acid-sensing ion channel 1a mediates acid-induced increases in intracellular calcium in rat articular chondrocytes, Mol Cell Biochem. 340, 153-9. Zhou, R., Zhu, F., Wu, X., Song, S., Chen, Y., Zhu, C., Dai, B., Qian, X., Wang, K., Hu, W. and Chen, F., 2019. Effects of autophagy on apoptosis of articular chondrocytes in adjuvant arthritis rats, J Cell Mol Med. 23, 7879-7884. Zeng, Z., Leng, T., Feng, X., Sun, H., Inoue, K., Zhu, L. and Xiong, Z.G., 2015. Silencing TRPM7 in mouse cortical astrocytes impairs cell proliferation and migration via ERK and JNK signaling pathways, PLoS One. 10, e0119912. Zaglia, T., Milan, G., Ruhs, A., Franzoso, M., Bertaggia, E., Pianca, N., Carpi, A., Carullo, P., Pesce, P., Sacerdoti, D., Sarais, C., Catalucci, D., Kruger, M., Mongillo, M. and Sandri, M., 2014. Atrogin-1 deficiency promotes cardiomyopathy and premature death via
impaired autophagy, J Clin Invest. 124, 2410-24. Jiang, P. and Mizushima, N., 2015. LC3- and p62-based biochemical methods for the analysis of autophagy progression in mammalian cells, Methods. 75, 13-8. Gregory, N.S., Gautam, M., Benson, C.J. and Sluka, K.A., 2018. Acid Sensing Ion Channel 1a (ASIC1a) Mediates Activity-induced Pain by Modulation of Heteromeric ASIC Channel Kinetics, Neuroscience. 386, 166-174. Wu, X., Ren, G., Zhou, R., Ge, J. and Chen, F.H., 2019. The role of Ca(2+) in acid-sensing ion channel 1a-mediated chondrocyte pyroptosis in rat adjuvant arthritis, Lab Invest. 99, 499-513. Song, M.Y., Li, C.Y., Liu, X.F., Xiao, J.Y. and Zhao, H., 2018. Effect of 17beta-oestradiol on T-type calcium channels in the lateral habenula, J Neuroendocrinol. 30, e12629. Choudhury, N. and Sikdar, S.K., 2018. 17beta-estradiol potentiates TREK1 channel activity through G protein-coupled estrogen receptor, J Steroid Biochem Mol Biol. 183, 94-105. Evanson, K.W., Goldsmith, J.A., Ghosh, P. and Delp, M.D., 2018. The G protein-coupled estrogen receptor agonist, G-1, attenuates BK channel activation in cerebral arterial smooth muscle cells, Pharmacol Res Perspect. 6, e00409. Schneider, A.H., Kanashiro, A., Dutra, S.G.V., Souza, R.D.N., Veras, F.P., Cunha, F.Q., Ulloa, L., Mecawi, A.S., Reis, L.C. and Malvar, D.D.C., 2019. Estradiol replacement therapy regulates innate immune response in ovariectomized arthritic mice, Int Immunopharmacol. 72, 504-510. Chen, J.Q., Yager, J.D. and Russo, J., 2005. Regulation of mitochondrial respiratory chain structure and function by estrogens/estrogen receptors and potential physiological/pathophysiological implications, Biochim Biophys Acta. 1746, 1-17. Sun, Y., Yang, J., Liu, W., Yao, G., Xu, F., Hayashi, T., Onodera, S. and Ikejima, T., 2019. Attenuating effect of silibinin on palmitic acid-induced apoptosis and mitochondrial dysfunction in pancreatic beta-cells is mediated by estrogen receptor alpha, Mol Cell Biochem. 460, 81-92. Fex, M., Nicholas, L.M., Vishnu, N., Medina, A., Sharoyko, V.V., Nicholls, D.G., Spegel, P. and Mulder, H., 2018. The pathogenetic role of beta-cell mitochondria in type 2 diabetes, J Mahmoodzadeh, S. and Dworatzek, E., 2019. The Role of 17beta-Estradiol and Estrogen Receptors in Regulation of Ca(2+) Channels and Mitochondrial Function in Cardiomyocytes, Front Endocrinol (Lausanne). 10, 310. Xu, K., Sha, Y., Wang, S., Chi, Q., Liu, Y., Wang, C. and Yang, L., 2019. Effects of Bakuchiol on chondrocyte proliferation via the PI3K-Akt and ERK1/2 pathways mediated by the estrogen receptor for promotion of the regeneration of knee articular cartilage defects, Cell Prolif. 52, e12666. Ikeda, K., Tsukui, T., Imazawa, Y., Horie-Inoue, K. and Inoue, S., 2012. Conditional expression of constitutively active estrogen receptor alpha in chondrocytes impairs longitudinal bone growth in mice, Biochem Biophys Res Commun. 425, 912-7. Vomero, M., Barbati, C., Colasanti, T., Perricone, C., Novelli, L., Ceccarelli, F., Spinelli, F.R., Di Franco, M., Conti, F., Valesini, G. and Alessandri, C., 2018. Autophagy and Rheumatoid Arthritis: Current Knowledges and Future Perspectives, Front Immunol. 9, 1577. Huang, X., Li, Y., Shou, L., Li, L., Chen, Z., Ye, X. and Qian, W., 2019. The molecular mechanisms underlying BCR/ABL degradation in chronic myeloid leukemia cells
promoted by Beclin1-mediated autophagy, Cancer Manag Res. 11, 5197-5208. Pan, T., Kondo, S., Le, W. and Jankovic, J., 2008. The role of autophagy-lysosome pathway in neurodegeneration associated with Parkinson's disease, Brain. 131, 1969-78. Larsen, K.E. and Sulzer, D., 2002. Autophagy in neurons: a review, Histol Histopathol. 17, 897-908. Eaton, D.C., Malik, B., Bao, H.F., Yu, L. and Jain, L., 2010. Regulation of epithelial sodium channel trafficking by ubiquitination, Proc Am Thorac Soc. 7, 54-64. Iwata, A., Riley, B.E., Johnston, J.A. and Kopito, R.R., 2005. HDAC6 and microtubules are required for autophagic degradation of aggregated huntingtin, J Biol Chem. 280, 40282-92. Allison, H. and McNamara, L.M., 2019. Inhibition of osteoclastogenesis by mechanically stimulated osteoblasts is attenuated during estrogen deficiency, Am J Physiol Cell Physiol. 317, C969-C982.
Figure Legends
Fig. 1 Effects of 17β-E2 on acid-induced chondrocyte injury. A. Different concentrations of 17β-E2 on viability of chondrocyte were assessed by MTT assay. B, C and D. Cell viability were detected by MTT assay after acidification. E. Representative phase-contrast images taken after treatment with the indicated solutions. F. Mitochondrial membrane potential were measured by Rhodamine 123 after pretreatment. All data are expressed as mean±SD ###
#
P<0.05,
##
P<0.01,
P<0.001versus control; *P<0.05, **P<0.01, ***P<0.001 versus pH6.0 group.
Fig. 2 Effects of 17β-E2 on ASIC1a expression and activity. A. Western blot analysis of ASIC1a protein in chondrocyte in different concentrations. C. Western blot analysis of ASIC1a protein in different times. B, D. Real time PCR analysis of ASIC1a mRNA in chondrocyte in different concentrations and times. E. Immunofluorescence of ASIC1a expression. F. Laser confocal analysis of ASIC1a activity. All data are expressed as mean±SD. #P<0.05, ##P<0.01, ###P<0.001versus control.
Fig. 3 17β-E2 activate autophagy and degrade ASIC1a protein. A. Western blot
analysis of ASIC1a protein expression, after treatment with CHX (cycloheximide) for 6 hours. B. Results were detected by western blot when cells were pretreated with CHX with or without 17β-E2. C-F. After chondrocyte were pretreated with lysosome inhibitors CQ, 3-MA, ALLN, MG-312 with or without 17β-E2, ASIC1a protein were analyzed by Western blot. G. Western blot analysis of LC3-II, Beclin-1 levels. H. Results of LC3-II and Beclin-1 were measured by Western blot after treatment with autophagy inhibitor CQ in absence and presence of 17β-E2. I. Immunofluorescence of LC3 levels in chondrocytes. All data are expressed as mean±SD. #P<0.05, ###
##
P<0.01,
P<0.001versus control; *P<0.05, **P<0.01, ***P<0.001 versus 17β-E2 group;
&
P<0.05 versus CQ.
Fig. 4 17β-E2 decreases ASIC1a protein expression via ERα. A. ASIC1a protein expression was analyzed by Western blot after treatment with estrogen receptors non-selective blockers ICI with or without 17β-E2. B. The level of ASIC1a protein was further measured by Western blot after pre-treated with estrogen receptor ERα, β, GPR30 special blockers (MPP, PHTPP, G15) in the presence of 17β-E2. C. Changes in ASIC1a protein expression were assessed by Western blot after combined treatment of MPP, ERα interference fragment, negative control with 17β-E2. All data are expressed as mean±SD.
#
P<0.05,
##
P<0.01,
###
P<0.001versus control; *P<0.05,
**P<0.01, ***P<0.001 versus 17β-E2 group.
Fig. 5 17β-E2 attenuates acid-mediated apoptosis. A. Acid-induced chondrocytes apoptosis were detected by Annexin-V/PI Assay after pretreatment with 17β-E2 and PcTX1. B. Hoechst Staining analysis of chondrocyte apoptosis. C. Chondrocytes were treated with ICI in absence and presence of 17β-E2, then incubated in pH 6.0, Western blot analysis of casepase-9, PARP and ASIC1a protein expression. D. 17β-E2, ASIC1a special inhibitor PcTX1 and shASIC1a attenuated acid-induced chondrocytes apoptosis by western blotting for casepase-9, PARP. E. 17β-E2 reduce ASIC1a-mediated cell apoptosis by western blot analysis for ASIC1a, casepase-9, PARP, after pretreatment with PcTX1 with or without 17β-E2. All data are expressed
as mean±SD. #P<0.05,
##
P<0.01,
***P<0.001 versus pH6.0 group.
###
P<0.001 versus control; *P<0.05, **P<0.01,