2 α-Thalassaemia

2 ot-Thalassaemia L U I G I F. B E R N I N I

Emeritus Professor in Biochemical Genetics

Emeritus Lecturer in Biochemical Genetics at Leiden University

C O R N E L I S L. H A R T E V E L D PhD Researcher in Molecular Genetics

Institute of" Human Genetics of the Medical Faculty, University of Leiden, SyIvius Laboratory, Wassenaarseweg 72, 2333 AL Leiden, The Netherlands

c~-Thalassaemias are genetic defects extremely frequent in some populations and are characterized by the decrease or complete suppression of a-globin polypeptide chains. The gene cluster, which codes for and controls the production of these polypeptides, maps near the telomere of the short arm of chromosome 16, within a G + C rich and early-replicating DNA region. The genes expressed during the embryonic (4) or fetal and adult stage (or2 and cq) can be modified by point mutations which affect either the processing-translation of mRNA or make the polypeptide chains extremely unstable. Much more frequent are the deletions of variable size (from = 3 to more than 100kb) which remove one or both ct genes in cis or even the whole gene cluster. Deletions of a single gene are the result of unequal pairing during meiosis, followed by reciprocal recombination. These unequal cross-overs, which produce also c¢ gene triplications and quadruplications, are made possible by the high degree of homology of the two tx genes and of their flanking sequences. Other deletions involving one or more genes are due to recombinations which have taken place within non-homologous regions (illegitimate recombinations) or in DNA segments whose homology is limited to very short sequences. Particularly interesting are the deletions which eliminate large DNA areas 5' of ~ or of both ~ genes. These deletions do not include the structural genes but, nevertheless, suppress completely their expression. Larger deletions involving the tip of the short arm of chromosome 16 by truncation, interstitial deletions or translocations result in the contiguous gene syndrome ATR-16. In this complex syndrome ot-thalassaemia is accompanied by mental retardation and variable dismorphic features. The study of mutations of the 5' upstream flanking region has led to the discovery of a DNA sequence, localized 40 kb upstream of the ~-globin gene, which controls the expression Baillikre ~ Clinical Haematology-Vol. 11, No. 1, March 1998 ISBN 0-7020-2460-0 0950-3536/98/010053 + 38 $12.00/00

53 Copyright © 1998, by Bailli~re Tindall All rights of reproduction in any form reserved

54

L. F. BERNINI AND C. L. HARTEVELD

of the c~ genes (c~ major regulatory element or HS-40). In the acquired variant of haemoglobin H (HbH) disease found in rare individuals with myelodysplastic disorders and in the X-linked mental retardation associated with c~-thalassaemia, a profound reduction or absence of ~ gene expression has been observed, which is not accompanied by structural alterations of the coding or controlling regions of the c~ gene complex. Most probably the acquired c~-thalassaemia is due to the lack of soluble activators (or presence of repressors) which act in t r a n s and affect the expression of the homologous clusters and are coded by genes not (closely) linked to the c~ genes. The ATR-X syndrome results from mutations of the XH2 gene, located on the X chromosome (Xq13.3) and coding for a transacting factor which regulates gene expression. The interaction of the different c~-thalassaemia determinants results in three phenotypes: the c~-thalassaemic trait, clinically silent and presenting only limited alterations of haematological parameters, HbH disease, characterized by the development of a haemolytic anaemia of variable degree, and the (lethal) Hb Bag's hydrops fetalis syndrome. The diagnosis of otthalassaemia due to deletions is implemented by the electrophoretic analysis of genomic DNA digested with restriction enzymes and hybridized with specific molecular probes. Recently polymerase chain reaction (PCR) based strategies have replaced the Southern blotting methodology. The straightforward identification of point mutations is carried out by the specific amplification of the c~2 or e~ gene by PCR followed by the localization and identification of the mutation with a variety of screening systems (denaturing gradient gel electrophoresis (DGGE), single strand conformation polymorphisms (SSCP)) and direct sequencing. Key words: t~-thalassaemia; c~-globin; haemoglobin variants; haemoglobinopathies; txthalassaemia deletions, c~-thalassaemia point mutations.

The term o~-thalassaemia relates to a class of inherited disorders of haemoglobin synthesis in which the production of o~-globin chains is partially or completely suppressed. The interaction between numerous different o~thalassaemia alleles results in the expression of a large spectrum of phenotypes ranging f r o m a silent trait to a very severe anaemia already lethal in utero or soon after birth. Between the middle and the end of 1950s the existence of a new inherited disorder involving the production of ~x-globin chains was suggested by the presence, in patients with microcytic h y p o c h r o m i c anaemia, o f unusual haemoglobins having different physical properties and quaternary structure (Minnich et al, 1954; Gouttas et al, 1955; Rigas et al, 1955). These abnormal haemoglobins were later identified as tetramers of either 7- or [3-globin chains and referred to as haemoglobin Bart's and H b H (Hunt and Lehmann, 1959; Jones et al, 1959). Their presence in the haemolysates of the patients was correctly interpreted as the consequence of a relative or absolute deficiency of ~-globin chains resulting in the defective production of H b A and H b F and in the aggregation into tetramers of unpaired 13-like polypeptide chains (Ingram and Stretton, 1959). The clinical and haematological findings in patients with H b H disease and their relatives suggested the occurrence of at least two forms of o~-thalassaemia trait, an almost asymptomatic one with minimal alterations of the haematological indices (c~-thalassaemia 2) and a second with reduced mean corpuscular

~-THALASSAEMIA

55

haemoglobin (MCH) and mean corpuscular volume (MCV), normal HbA2 values and the presence of HbH inclusion bodies in rare erythrocytes (o~-thalassaemia 1) (Na-Nakorn et al, I965; Pootrakul et al, 1967; Wasi et al, 1969). In the same period the direct measurement in vitro of the relative rates of synthesis of c~ and 13chains became possible (Heywood et al, 1964). The application of this new technique demonstrated the increasing deficiency of ~-globin chain production in the o~-thalassaemia trait, HbH disease and hydrops fetalis (Weatherall et al, 1965; Kan et al, 1968). At the end of the sixties it was, however, still impossible to decide whether the expression of cz-globin chains was controlled by a single gene or by two similar, duplicated genes. According to the first model, cx-thalassaemia might have been due to the interactions of a wild type gene and two (or more) thalassaemic alleles having different degrees of severity. Alternatively, the inactivation of one or more genes in cis or trans of a duplicated cluster could have accounted for both the ~-thalassaemia traits, HbH disease and Hb Bart's hydrops fetalis (Kattamis and Lehmann, 1970). By the middle of the seventies it appeared very likely that the production of o~-globin chains was controlled by two linked genes. This conclusion was supported by the analysis of the interaction between cz-thalassaemia 1 and Hb Constant Spring (Milner et al, 1971) and by the finding of people carrying two o~-globin chain structural variants in addition to HbA (Hollan et al, 1971; Bernini et al, 1970; Meloni et al, 1980). A direct confirmation of the multiplicity of cx-genes was obtained after the purification of a-mRNA, the preparation of cDNA probes and the gene quantitation by cDNA/DNA hybridization in solution (reviewed in Bunn and Forget, 1986). The use of the latter technique demonstrated clearly the presence of four o~-genes in the normal individuals, the complete absence of ~-globin genes in the Hb Bart's hydrops fetalis syndrome and the deletion of one, two and three genes in the o~-thalassaemia 2 trait, in the o~-thalassaemia 1 trait, and in the HbH disease, respectively (Ottolenghi et al, 1974; Kan et al, 1975). The cDNA/DNA hybridization experiments could not, however, explain the absence of hydrops fetalis in African populations in spite of the high frequency of o~-thal 1 trait and also the apparent deletion of only two o~-gene in some individuals with HbH disease. The solution to the last problems were provided by the application of two new technologies: gene mapping and gene cloning. These techniques allowed the determination of the position of the different gene and pseudogenes along the o~ gene cluster, the assessment of intergenic distances, the fine structure of a-like genes and of their non-translated 5' and 3' regions and the size of the introns (reviewed in Bunn and Forget, 1986). In the same period, by mouse-human somatic cell fusion and cDNA-DNA hybridization the o~ genes were localized on chromosome 16 (Deisseroth et al, 1977) and later mapped on the short arm of the chromosome (Barton et al, 1982). By that time the general organization of the o~-globin gene cluster was, even if not in the finest detail, sufficiently

c~(c05-3

__eL

__YEM __CI

_(cO~,-,

___~PAN ____GEO

_ _ _ MED I _CANT

__SEA

_(e):o,~

__BRIT __MA __$A

____RT _ _ MED 1I __DUTCH I __CAL

____F[L

__THAI

(B) __Me

--(Xz,7 -qX3.5 -.(X+lS

._~3.711 __(~3.71ll

(A) -Ct4-: -(tx 71

Alurepeats I I

5' Tel O~.~_-,

t

I

-99 Distl "

t,

-100

I I I I

IL9-R ~ ,

t

t

t

J

MPG ~

I

t

I

I

-40

II

IIS-40 Proxl 4" I III

-60

5'-H~VR II III11

-80

L3 L2 n I]

I

-20 t

0 i

I

+20 f

1

,

t

+40 I

I

i

II

f

l

i

U

L

f' [ II ILII

I IIIIIII IIIL

I

I

..

]

I

I

L

I

I

IIII II

IIIII

I I

+80kb

II

I

~I

I

3'

'"

+60

Inter-~ HVR 3'-HVR III I I l l I I I i i I 7~.77/7?..?L..',

L1 L O ~ ot2oq O " ~nnn""~

t

II I I I I

I

Lacerra et al (1991) Embury et al (1980) Embury et al (1980) Embury et al (1980) Embury et al (1980) Zhao et al (1991) Kulozik et al (1988) [ndrak et al (1993) Vickers and Higgs (1989) Fischel-Ghodsian et al (1988) Fischel-Ghodsian et al (1988) Sabath et al (1994) Ktttlar et al (1989a) Harteveld et al (1997a) Fichera et al (1997) Higgs et al (1985) Gonzalez-Redondo et al (1989) Vandenplas et al (1987) Nicholls et al (1985) Pressley et al (1980) Pressley et al (1980) Villegas et al (1994) Villegas et al (1990) Fei et al (1992a) Pressley et aI (1980) Shalmon et al (1994) Gonzalez-Redondo et al (1988) Lamb et al (1993)

Table 1. Physical map of the human ct-globin locus between +60 from the ~-globin gene cap site to the telomere.

-120

-140

t't7

<

,-r >

t~ o

>

Z

m

__

ll5kb

11

i

i

i

:=

I

I

III IIIH

II

IIIIII

I

II II IIIII

,'!!

UIIIItlIIIIII III

II II t Hill I

lilt

lUllUlII II IIIIIII

I

IIH

II

I

I

IWIIIHIIIIIIIIIIIIII

II

II IIIII III

I

IlL

+

IIIIIIIIII I I

I[I

III I III1[ III[ILI/[

IIIIIIIIIII I

IIIIII IIII III II

II II IIII

III

IIIIIIIIIIIIII I

I II II

I

I I IIIIIIIIII I

IIIIIII

IIIIIII

IIII

III

III

I

/( ~_530 kb

+

Felice et al (1984) Harris et al (1990) Waye et al (1992) Harteveld et al (1997b) Lamb et al (1989) Hatton et al (1990) Roman et al (1992) Roman et al (1991) Wilkie et al (1990b) Liebhaber et al (1990) Flint et al (1994) Flint et al (1994) Flint et al (1994) Flint et al (1996)

The genes are indicated as full boxes, the pseudogenes as open boxes. The hypervariable regions (HVRs) are indicated as zigzag lines. The unique sequences L0-L3 are indicated as small open boxes; the position of the element HS-40 involved in regulation of ct-globin gene expression is indicated by a vertical arrow. The directions of transcription and localization of the Distl, MPG, Proxl and -99 genes are indicated as black bars, on the line when the direction of transcription is towards the centromere and below the line when in the opposite direction. The IL9-R pseudogene is indicated as an open bar. The genes known as 16pHQG;I and 2 flanking the telomere are of undetermined function and probably represent pseudogenes. Alu repeats are depicted as vertical lines below the physical map (Flint et al, 1997). (A) Deletions involving one c~-globin gene. The ct+-thalassaemia deletions are shown with the deletion extent as full black boxes or unfilled boxes if the endpoints have not been precisely determined. The symbol '-" indicates the deletion of a complete a gene; '(a)' indicates a partial deletion. An open end indicates that the deletion length has not been determined. (B) Deletion of two
(c~ct)" (eta) u (C~x)CMO (OtCOTA'r OxcOXC --(ctc0m

(aa) MM

(~ct) RA

__BO

__DUTCH

__HW

(C) __~R

>

K

>

-] m > t" >

?

58

L. F. BERNINI AND C. L. HARTEVELD

(A) Mo~se:

Human:

• ~GATA/A . . . . ACCCATCTGGAACCTATCAGTGACCATAGTCAACAGCAGGTGTACACA.. IIII ItllIIIIIIIIIll IIIll IIIll I llII llll ACCC.TCTGGAACCTATCAGGGACCACAGTCAGC..CAGGCAAGCACATC

: 48 : 47

*CACC/A Mouse:

..CCCAGGCCAAGC~TGC-~.GCAGACCACTGTGGG.ATCTATGGAGATGC : 94 Iltl IIIIIIit1Itl III I II111II 111 !I I I 1

Human:

TGCCCAAGCCAAGGGTC-~--,AGGCATGCAGCTGTGGGGGTCTGTGAAAACAC : 97

Mouse:

• GATA/B~ . ~NF-E2/A . . TTGAACGAG~TA~CTAAGCCAAGCATC4~TCAGAGTTTCTAGAGGCC :144

Human:

TTGAGGGAG~TAACTGGGCCAACCA~ACTCAGTGCTTCTGGAGGCC

Mouse:

NF-E2/B~ . AG~ ACTAGGACTGCTC~%(~TAATACT,TGGGGGTACAGAGTCAG..AAAGGAAA

Iiti

111Iitliiiii

11111 I I I I 1 t 1 1 1 1

I III1

ttltli :147

4CACC/B~CACC/C

I

II11111111111"tl

11 I I I I I 1 1 " * I I

tt**I

II

:191

II111

Human:

AACAGGACTGCTGAGTCATCCTGTGGGGGTGGAG.GTGGGACAAGGGAAA

Mouse:

C~.ACAAATGGTACCACTGATTAGGACCTCTGACGCTGTTTTCCCATCCT:240

Human:

~C~GGTGAATGGTACTGCTGATTACAACCTCTGGTGCTGCCTCCCCCTCCT

Mouse:

G~ATrTGCC~GTGACCCTG~GCC...~.~Gr~.AC.". . . . . C r ~

4CACC/D.

:196

GATA/C,

II****IIit111I

I111111

IIII11t

IIII

1 II1

ttti :246

wGATAID.

IIItll*ll

I I

I

I

lJtl

Jlll

lJ

ill

:277

I

Human:

GTTTATCTGAGAGGGAAGGCCATGCCCAAAGTGTTCACAGCCAGGCTTCA

Mouse:

GT..CA-,t,~TCTTACCCTGAC. . . . AACACCTTGTACACCTGCAGTTGGGAAGACTTTC :330

Human:

GGGGCAAAGCCTGACCCAGACAGTAAATACGTTCTTCATCTGGAGCT..GAAGAAATTC

I

II11

11 1111 111

I1 1I I I t

It

111 It

I

:296

IIIII

III :353

(B) MOUSE A

A

B

A lq~/R2

B

C

Nl~/g~

HUMAN

A

A

B

A

B

BC

D

C

D

Figure 1. (A) Alignment of the mouse and human c~-MRE. Bat-s represent identical bases, &sterisks mark mismatches in potential transcription factor binding sites. Individual binding sites (bold) are alphabetically marked from 5' to Y. (B) Putative protein binding sites at the mouse and human e~-MRE+ Note the absence of CACC boxes B, C and D and GATA- 1 site D but the conservation of the AG box in the 3' part of the mouse c~-MRE.

~-THALASSAEMIA

59

clearto account forthe genetics of (z-thalassaemiasyndromes(Laueretal, 1980). STRUCTURE AND ORGANIZATION OF THE ct-GLOBIN GENE CLUSTER The (z-globin gene cluster was finally located at position 16p13.3 by Breuning et al (1987). The embryonic and adult (z-like genes are contained in a DNA cluster of about 30 kb inserted in a large isochore of the H3 family contiguous to the telomere region (reviewed in Higgs, 1993). These isochores are preferentially located in subtelomeric regions, show a high GC content (60%) and contain non-methylated CpG-rich islands and hypervariable minisatellite sequences. They are, in addition, early replicating and contain a large number of 'housekeeping' genes (reviewed in Bemardi, 1989). The region extending for about 300 kb from the terminal repeats of the short arm of chromosome 16 shows a very high density of Alu family repeats which constitute close to 26% of the whole sequence (Flint et al, 1997). The frequency of the repeats along the sequence is not uniform but seems to decrease in gene-rich regions. The genomic organization of the region 5' of the (z gene cluster conforms to these general rules and shows in a relatively limited area (see Table 1) the existence of at least four genes, 16priG;4, Dist 1, MPG and Prox 1, which are independently regulated and expressed constitutively (Kielman et al, 1993, 1996; Vyas et al, 1995). The study of the (z-globin upstream flanking region ((Z-UFR) has been stimulated by the discovery that a large deletion which eliminates part of this region (Hatton et al, 1990) is responsible for the silencing of the otherwise intact embryonic and adult (z genes in cis. This situation seemed analogous to the ~-thalassaemia caused by the deletion of the ~ locus control region (13-LCR) elements 5' to the 13-globin gene cluster (Van der Ploeg et al, 1992). An MRE (~-MRE) was indeed found 40kb upstream of the embryonal ~ gene and referred to as HS-40 (Higgs et al, 1990) (see Table 1). The cloning and complete characterization of the homologous region in mouse has revealed that the mouse (z-UFR-(z-globin cluster is located on chromosome 11 in a subcentromeric position and, although smaller than its human homologue, contains the same non-globin genes identified in humans, in the same orientation with respect to the (z genes (Kielman et al, 1993). The (Z-MRE identified in humans was also found in the mouse (Z-UFR, 26 kb upstream of the mouse embryonic globin gene (Hba-x) (see Figure 1) (Kielman et al, 1994). The (Z-MRE includes in a 350bp sequence several binding sites for transcription factors (Jarman et al, 1991). The functional analysis of the (Z-MRE in in vitro systems and in transgenic mouse indicates that this element is necessary for the expression of (z-globin genes (Bernet et al, 1995; Chen et al, 1997). In these experimental systems the (Z-MRE behaves as a strong enhancer of the (z-as well as of [3- and y-globin genes but does

60

L. F. B E R N I N I A N D C. L. H A R T E V E L D

not show the copy number dependence observed for the 13-LCR (Sharpe et al, 1992). Human and mouse (x-UFR regions are highly conserved and, because of the peculiar gene density observed in GC-rich areas of the genome, the non-globin genes are so tightly packed that essential regulatory elements such as (x-MREs and numerous erythroid hypersensitive sites are located 10 kb

(A)

) HS-40 1~

Chromosome 16 lm

~2

[

~1t~(~21P(x1 (~2 ctl 0

5'

"

In! -

'-

q

Adult

(x2~2 Hb Gowsr II

I

I_~

u~:

~2~2

I

HbA HbA2

~2y2 Hb Portland I

p

2~2 Hb Portland II

BLCR

I

"~

6

Chromosome 11

Ira'

mmml

5'

m

m

~

mmm

Gy

Ay

ip~

~

m

3'

q

(B) Site of

erythropoiesis 50 Percentage 40 oftotal

globin synthesis

30

20 10

6

12

18 24

Prenatal age (weeks)

30

36 Birth

6

12

18 24

30

36 42

Postnatal age (weeks)

Figure 2. (A) Schematic representation of the (x-globin (upper) and ~-globin (lower) gene clusters and their chromosomal location. The embryonic, fetal and adult haemoglobins coded by the different genes during development are indicated in frames between the clusters. Genes are shown as full boxes, pseudogenes as open boxes. The 0 gene of undetermined function is indicated in grey. HVRs are indicated as zigzag lines. The positions of the regulatory elements HS-40 and the I3-LCR, consisting of hypersensitive sites 1-6, are indicated by vertical arrows. (B) Graphical representation of the expression of human globin genes during development. The site of erythropoiesis is indicated at the top of the figure. Adapted from Weatherall and Clegg (1981, The Thalassaemia Syndromes, 3rd edn. Oxford: Blackwell).

61

~-THALASSAEMIA

within the transcription unit of PROX1, the most centromeric gene of the c~-UFR. In addition, human MPG and PROX1 genes overlap, the 3' end of the PROX1 gene being located within the last intron of MPG (Table 1) (Kielman et al, 1996). The structural and functional interrelationships between o~gene cluster and o~-UFR have probably played an important role in the systemic evolution of this gene complex. Within a DNA sequence of about 30kb the 0t-globin gene cluster includes in the direction 5'---)3' the embryonic gene ~2, three pseudogenes (W~I, W~,2, utica1), the two duplicated in tandem ~ and (~1 genes and the 0 gene (Figure 2) (Lauer et al, 1980). As in the 13-1ike globin cluster, the 5'---)3' sequence of c~ genes along the chromosome reflects their order of activation and expression during ontogenesis. The two (~ genes, 5'-oE-oq-3", are the result of a duplication which took place about 60 Myears ago (reviewed in Collins and Weissman, 1984). Since then, instead of diverging, the two genes have undergone, through repeated rounds of gene conversion and cross-over fixation, a process of concerted evolution and have remained virtually identical. They differ only by a seven-nucleotide insertion near the end of the second intron and a base substitution also in the second intron at positions 509 and 573 from the cap site and diverge considerably in the region downstream of the third exon (Figure 3) (Michelson and Orkin, 1983). ~2 and ~ genes are inserted

a2 ~

5"

1 f l / / / i / ~

Z1

509 T

ct t

Q

568-569

GGCCCTC

573

3'

0rl//77.,~

Z2

{.//,////////////////////]

,~z2

(x 1 ~

a I b I cl

740

804

(3

RGCC(}T'rCCTCCTGCCCGCTGGGCCTCCC,

n~C,~G~CCCTCC T C C ~ T C C T T 6 C R C C G G -CGCTTCC

C

G, • ,R,~,T,

C¢.~.¢.,,*.

,T .....

CT . . . . . . . . . .

.......

T,C ......

¢ . T F I . , ¢ C .G

Figure 3. Schematic representation of the duplicated ~-~obin genes and the location of the X, Y and Z homology boxes. Below the picture the regions of homology between the Z boxes of the cq and ct,globin genes are depicted. The overall homology is 98.5% and is subdivided by a 7 bp insertion in the IVS 2 of a~ into Z1 (99% homology) and Z2 (93% homology). Z2 can be further subdivided into Z2a (99%), Z2b (78%) and Z2c (100%, surrounding the polyadenylation signal). The exact nucleotide differences between cq and ~2 are indicated at the bottom of the figure. Dots mark the sequence similarity and the numbers indicate the position from the cap site of the ct2 gene. Adapted from Higgs et al (1984), Nucleic Acids Research 12: 6965-6977).

62

L . F . BERNIN1 AND C. L. HARTEVELD

within three larger homologous sequences, X, Y and Z, also duplicated in tandem and separated by non-homologous DNA regions (Figure 3) (Lauer et al, 1980). Several hypervariable repetitive minisatellite sequences are embodied along the whole cluster. These minisatellites were identified because restriction enzymes specific for regions flanking the hypervariable sequences revealed in the normal population a range of variable-length alleles inherited in a Mendelian fashion (reviewed by Higgs et al, 1989). The HVRs are located 70 kb upstream of the 42 gene (5'-HVR), between the 42 and the ~41 genes (inter-4 HVR), within the introns of 42 and ~41 genes (intra-~ HVR) and at the 3' end of the cluster (3'-HVR). The unit size of each repeat ranges from 5 to 57 bp and the number of repeats from 5-55 in the 5'-HVR to 70-450 in the 3'-HVR. These hypervariable minisatellites have been (and still are) extremely useful as genetic markers in the derivation of t~-gtobin gene haplotypes and their study in families and populations (Waye and Eng, t994).

EXPRESSION OF oL-LIKE AND [~-LIKE GENES DURING D E V E L O P M E N T AND IN ADULT LIFE Embryonic ~ and E chains are already produced at 5 weeks gestation in the primitive erythroblasts of the yolk sac (Peschle et al, 1985). From the sixth week thereafter the embryonic chains are progressively replaced by adult (o~,[3) and fetal (Y) polypeptides (Figure 2). The switch is associated with a change in the transcription of the relative genes within the same erythropoietic lineage and not with the replacement of primitive progenitors by a different cell lineage (Stamatoyannopoulos et al, 1987). The occurrence of an e---~7 switch within the same cell is proved by the presence in the erythroblast's population of cells containing either e chains or 7 chains or both kinds of proteins (Mesker et al, in press). The transition ~---)o~has not been documented at single-cell level in humans. In mouse the occurrence of an embryonic-->fetal switch has been challenged by Leder et al (1997). These authors have shown by in situ hybridization that ~ and o~mRNAs are simultaneously present in the earliest erythrocyte population and that mice homozygous for a knock-out of the 4 gene develop normally. This experiment suggests that in mice the complete lack of the ~ peptide is not lethal and that the embryonic chain is largely redundant and can be replaced by the adult t~ which is expressed at the same time. During fetal and adult life the globin genes of the o~ and 13 clusters are expressed in a co-ordinated fashion, so that eventually the ratio of o~-like and [~-like chains synthesized remains always very close to 1. The production of globin chains, however, is not kept balanced by any particular mechanism implying mutual dependence. As evident in o~- and [3-thalassaemic disorders, the complete suppression of the synthesis of one chain does not prevent the production of excessive amounts of the other type of chain. Because unpaired globin chains are unstable and aggregate

~-THALASSAEMIA

63

into functionally useless tetramers, the maintenance of a balanced o~: non-o~ synthetic ratio is of critical importance in the viability of erythrocytes and oxygen exchange. The physiological 1 : 1 ratio of globin chains is not the consequence of a balanced mRNA output. In fact, the o~-globin mRNA: [3-globin mRNA ratio is equal to 2.6 (Hunt et al, 1980; Lin et al, 1994) or is even higher (about 4) according to recent reports (Smetanina et al, 1996) and there is good evidence that the balance at the protein level is brought about by a higher translation efficiency of [3 mRNA. The analysis of the translational profiles of globin mRNAs in reticulocytes has revealed a preferential sequestration of o~-globin mRNA into the pre-80S fractions. In addition ~-globin chains are assembled on polysomes larger than those sustaining o~-globin mRNA translation. This indicates that a differential inhibition of the initiation is responsible for the lower translational yield of a-globin mRNA (Lodish, 1976; Binninger and Weber, 1984). The structural features most important in enhancing the rate of initiation are the length of the leader sequence and the reduction or absence of a secondary structure (Kozak, 1991). The experiments carried out by Kozak (1994) with rabbit ~ and cz mRNAs in a translation-competent reticulocyte lysate system suggest that the reduced translatability of o~-globin mRNA is due to a shorter 5' leader sequence and to a much higher degree of secondary structure of the leader in comparison with the ~-globin mRNA. The translational efficiency of the oc-globin mRNA was indeed improved by increasing the length of the leader or introducing into the sequence mutations able to minimize secondary structure. There is complete agreement on the relative ratio of ~-globin mRNA transcribed by the a2 and oq genes. This ratio equals 2.6 according to the experiments of Liebhaber et al (1986) and an average of 2.8 as reported by Smetanina et al (1996). The translational profile of the mRNA expressed by the two genes is also the same (Shakin and Liebhaber, 1986), implying comparable translational efficiencies. Analysis of mRNA ratios in human embryos has revealed that the levels of ot2 and c~ mRNA are the same until the eighth week of gestation; afterwards the o~2 mRNA assumes the dominant expression which will be maintained in the adult. The same developmental switch has been observed in transgenic mice carders of the whole o~-globin gene cluster (Albitar et al, 1992). Assuming a comparable translational efficiency, a close correlation is expected, therefore, between the amount of messenger and the levels of protein synthesized. A recent reassessment of the quantities of o~-globin chain stable variants expressed by the c~2- and o~-globin genes in heterozygotes suggests, however, that the level of or2 mRNA is about twice the relative amount of protein translated (Molchanova et al, 1994). The same authors impute the altered mRNA: protein ratio to a less efficient translation of the o~2 mRNA. The difference reported by Molchanova et al between the output of c~-globin chains coded by the ot2 and oq genes, even if smaller than previously realized, is quite significant. It seems difficult to challenge, therefore, the concept of the existence of major (o~2) and minor (oq) globin genes. A large number of variables (including protein and mRNA stability,

64

L.F.

B E R N I N I A N D C. L. H A R T E V E L D

translational efficiency, influence of cis- or trans-acting factors etc.) determine the output of globin chains coded by the two duplicated genes. The concurrence of many factors may generate an appreciable degree of variability observed in the relative expression of o~-globin genes in cis (o~2:oq ratios) and in trans (o~2:cx2 or cx~:oq ratios). This variability may suggest the existence of different arrangements within the c~ gene cluster (haplotypes) which might be sufficient to account for the apparently unusual phenotypes mentioned above (Pagnier et al, 1982). The dominance of the 5'c~ gene has also been demonstrated in other species (Snyder, 1980). In mouse the interaction of a deletion-type o0thalassaemia with an ~+-thalassaemia determinant generated by disruption by gene targeting of the 5' cx-globin gene results in a very severe HbH disease already lethal in utero (Chang et al, 1996). This outcome confirms that the 5" c~-globin gene is the predominant one also in mouse. In sheep o~-globin genes are duplicated (~c~and ~o~) and the 5' Io~ gene shows again dominance contributing, per haplotype, 32% of the ~-globin chains against the 18% expressed by the H~ gene (Vestri et al, 1983a,b). Triplication and quadruplication of ~ genes represent a relatively common genomic rearrangement in sheep. Vestri et al (1994) have been able to show a gradient of expression from the 5' to the 3' gene, at both mRNA and protein level. The c0 ~3Hisgene, for instance, expresses 18% of the total haplotype output when the gene is at the second position from the 5' end but only about 1% when it is located at the fourth. The authors rule out protein instability, variable translational efficiency and transcriptional interference as possible reasons for the decreasing expression and suggest that a competition which takes place between promoters for interaction with a common enhancer might be important in the generation of such a gradient. oz-Thalassaemia determinants

Depending on the production of c~-globin chains, o~-thalassaemia determinants can be classified into two groups: c~° and ~+. In o:°-thalassaemia the production of o~ chains by the affected chromosome is completely abolished; c~+-thalassaemia is defined by the variable amounts of ~ polypeptide chains which can still be expressed in cis to the thatassaemic cluster. This nomenclature, which describes o~-thalassaemias in terms of o~-globin chain expression/haplotype, has replaced the previous classification of these defects into severe (o~-thalassaemia 1) and mild (~-thalassaemia 2) forms (Weatherall and Clegg, 1981). ~°-Thalassaemia is usually the result of deletions which eliminate (~) and ~ genes in cis, the entire ~ cluster together with the main regulatory sequence o~-MRE or only the HS-40 regulatory element. Another (less frequent) cause of ~°-thalassaemia is the occurrence of a point mutation within the single (otherwise intact and presumably functional) ~ gene left over in a haplotype after the deletion of the other partner. ~+-Thalassaemia is mainly the result of the deletion of a single gene within the cluster or the consequence of a thalassaemia-generating point

O~-THALASSAEMIA

65

mutation of either the ~ or the cz~ gene. Some non-deletional mutations may not completely suppress the gene expression; furthermore, the same kind of mutation, because of the dominance of the cz2 gene over cz~, may give a different degree of ¢z chain unbalance when located on either gene. Finally, some mutations of the cz2 gene interfere with the transcription of the downstream czI gene and induce an o~-globin chain deficiency more pronounced than that expected from the inactivation of only one gene in cis (Whitelaw and Proudfoot, 1986). The homozygosity or compound heterozygosity for cz°-thalassaemia or the varieties of cz+-thalassaemia determinants and their interaction with the normal haplotype account for an almost continuous range of clinical severity spanning from lethality in the embryonic or fetal period to a very mild trait. In order of increasing severity the thalassaemic haplotypes can be classified as follows: cz2czlT< ot2- <-cz I < ff,zTczj< - o F < - - . This classification is based on well-documented clinical and experimental observations which indicate that the expression of the czz gene is predominant over that of czI and that deletions of a single gene result in a less severe deficiency in comparison with that caused by point mutations (indicated by T) of the cz2 gene. The least severe thalassaemic phenotypes are represented by the interaction of a normal haplotype with an cz+ determinant caused by point mutations of the cz~ gene; the most severe results from the homozygosity for an cz° haplotype characterized by large deletions which eliminate both cz genes. Between these two extremes a large variety of combinations between thalassaemic and normal haplotypes result in different genotypes expressed either as a trait, with clear haematological abnormalities but no clinical symptoms, or as HbH disease, which may have a variable expression ranging from a very mild to a very severe haemolytic anaemia.

c~-Thalassaemia trait c~-Thalassaemia trait is usually caused either by the interaction of the normal haplotype with an cx°- or an o~+-thalassaemia determinant or by the homozygosity for two cx+ haplotypes. Much less frequently this phenotype can be the result of compound heterozygosity for a deletional o~+thalassaemia and an c~+ determinant caused by a point mutation or even homozygosity for the latter kind of determinant. Depending on the nature and localization of the mutation, the phenotype of the trait can thus range from the 'silent cartier' to individuals showing very pronounced haematological abnormalities. The prevalence at birth of the trait was originally estimated by the presence and quantitation of Hb Bart's in cord blood (see Weatherall and Clegg, 1981). In newborns heterozygous for ¢x+-thalassaemia Hb Bart's is observed at levels of 1-2% whereas 5-6% of this haemoglobin is found in the cord blood of infants heterozygous for o~°-thalassaemia. This kind of screening, however, underestimates the real frequencies of the ¢x+ determinant because no Hb Bart's is detectable in a substantial number of newborns with the genotype -c~3.7/0~0~(Higgs et al, 1980a).

66

L. F. BERNINI AND C. L. HARTEVELD

Heterozygous ~-thalassaemia The haematological indices in carriers of this form of ~-thalassaemia are only slightly altered and overlap considerably with those of normal individuals. A reliable diagnosis can, therefore, be implemented only by DNA analysis.

Heterozygous a°-thalassaemia-homozygous ot+-thalassaemia These phenotypes are characterized by slight anaemia with elevated red cell counts, microcytosis and hypochromia of the ted cells with anisocytosis and poikilocytosis. MCH and MCV values as well as the c~-globin: l]globin synthesis ratio are definitely lower than in normal individuals. HbF and HbA2 levels are normal. In adult individuals Hb Bart's is no longer detectable by electrophoresis of the haemolysate but rare erythrocytes with HbH inclusion bodies can be found in a considerable number of carriers (Galanello et al, 1984). Also, small amounts of ~ chain are detected by immunofluorescence (Chui et al, 1988) in the great majority of heterozygotes for the South East Asian (SEA) type of deletion (in the - SEA/~ genotype both ~ genes are present and functional) (Tang et al, 1993). The diagnosis of heterozygous ~0_ thalassaemia by haematological analysis is thus almost always possible. Table 2 shows the correlation between haematological parameters and genotype observed in our laboratory in a group of ~;+- and ~°-thalassaemia carriers. The average values of MCH and globin synthesis ratios correlate well with the expected extent of ~ chain production and are very significantly different in individuals with genotypes ~ 0 t / ~ , -crTc~ and --/c~cc Heterozygotes for a point mutation of the or2 gene (o~Tlc~o0 show average values which, although not significantly different from, are intermediate Table 2. Correlation between haematological parameters and o~-thalassaemia genotypes.

Number of individual s Molecular diagnosis MCH (fmol) ~:~t ratio A

B

A['~++

C

A

B

C

25 o~'o~o~ 1.78+0.13 1.03+0.12

26 -o~3.7/1~o~ 1.63_+0.14 1.32+0.12

10 o(F 13~/o~o~ 1,55 ± 0.09 1.45_+0.21

D

+++ +++t

Bl +

+++I MCH

~:c~ ratio Bonferroni P values: +++, <0.001; ++, <0.01; ns, >0.05

D 26 ----SI'A/0~0~ 1.30_+0.11 1.47_+0.18

IX-THALASSAEMIA

67

between those observed in people heterozygous for the deletion of either one or two ct genes. The results shown in the table confirm again that MCH discriminates the different forms of tx-thatassaemia better than any other parameter (Williams et al, 1996b). The haematological approach does not allow a certain diagnosis of heterozygous ~÷-thalassaemia in any single individual carrier to be made. The routine measurement of the MCH and of the ~-globin: o~-globin ratios in reticulocytes can, however, give a useful contribution to the diagnosis of heterozygous tx+-thalassaemia due to point mutations. The systematic determination of the two parameters has allowed the assessment of the presence of point mutations of the cx genes in about 50% of a group of people in which, despite normal Southern blotting and the impossibility of carrying out family studies, the diagnosis of tx+-thalassaemia was maintained on the basis of borderline haematological abnormalities (Harteveld et al, 1997b). Homozygotes for some non-deletion mutations of the cxz gene, such as base substitutions of the poly(A) signal (Fei et al, 1992a) or mutations of the stop codon (Hb Constant Spring), have HbH disease (Pootrakul et al, 1981), whereas other non-deletion mutations would result in the trait phenotype. All these observations add to the phenotypic variability of the c~thalassaemia syndromes.

Haemoglobin H disease HbH disease is caused by the interaction of an cx° with an cx+ determinant. The prevalence and severity of this condition in different geographical areas are conditioned by the simultaneous presence of these two determinants and their frequencies and the nature of the mutations causing c~+thalassaemia. The disease is, in fact, virtually unknown in Africa because of the absence of the o~°-thalassaemia allele (Higgs et al, 1979). It is, on the contrary, very frequent in South-East Asia and rather common in the Mediterranean area because of the occurrence of different forms of deletions and point mutations. The clinical picture of HbH disease is that of a chronic haemolytic anaemia of variable severity. Haemoglobin levels are usually around 8-10g/dl but the variations can be much wider. The anaemia is accompanied by jaundice, hepatosplenomegaly and a number of complications such as leg ulcers, gallstones and folic acid deficiency. Electrophoresis of the haemolysate shows the presence of HbH in the range 0.8-40%. In the newborn Hb Bart's amounts to 20-40% of the total haemoglobin and during growth is gradually but not totally replaced by HbH, so that it is occasionally found in the peripheral circulation of adult individuals. The synthesis of o~ chains in reticulocytes is reduced to about 25% of the normal values. Examination of the blood smear reveals hypochromia, microcytosis, poikilocytosis, target cells and, after incubation of blood with brilliant cresyl blue, numerous red cells with HbH inclusion bodies. The number of these cells increases after splenectomy and is associated with the presence of large HbH inclusion bodies. Chronic

68

L. F. B E R N I N I A N D C. L. H A R T E V E L D

haemolysis is intensified during acute episodes owing to infections or administration of oxidizing drugs. In some cases a very mild, asymptomatic HbH disease has been revealed by the acute haemolysis following such events. In keeping with the lower ~-globin chain production of the ~T~ haplotype, homozygotes for such a haplotype (see before) may present with a mild HbH disease (Fei et al, 1992b). On the other hand, the haemolytic anaemia observed in patients with the genotype --/o~o~ is usually more severe than that found in HbH disease caused by deletional c~gene mutations (Galanello et al, 1992; Liu et al, 1994; Kanavakis et al, 1996). In rare cases the interaction of ~°-thalassaemia with a non-deletional cz÷ haplotype has led to hydrops fetalis (Chan et al, 1997). The severity of this combination has motivated in a number of cases the selective interruption of the pregnancy. It is important to notice, however, that in the case of interaction of the haplotype o~° with Hb Icaria or Constant Spring the clinical course has been favourably modified by splenectomy (Kanavakis et al, 1996). The coexistence of HbH disease with heterozygosity for HbS or HbC is associated with an unusual clinical and haematological picture (Matthay et al, 1979; Giordano et al, 1997).

Haemoglobin Bart's hydrops fetalis syndrome These lethal forms of o~-thalassaemia result almost invariably from the interaction of two o~°-thalassaemia determinants. With the exception of the rare case of HbH disease associated with hydrops fetalis, infants affected by this syndrome are completely unable to synthesize o~-globin chains. About 25% of the fetuses die in utero between 28 and 38 weeks of gestation and the rest at delivery or soon after (Weatherall and Clegg, 1981). The infants are oedematous or hydropic because of the congestive heart failure due to the profound anaemia; considerable enlargement of the liver and spleen is always present and is often associated with congenital cardiac malformations, genital abnormalities and terminal transverse limb defects (Chitayat et al, 1997). Pathological findings include placental hypertrophy, retardation of brain growth in many cases and extramedullary erythropoiesis. Clinical and haematological examinations reveal severely anaemic infants with variable haemoglobin levels (3-10g/dl) and marked anisopoikilocytosis with large hypochromic red cells and with the presence of numerous erythroblasts. The analysis of the haemolysate shows, in the hydrops caused by the deletion of four ~ genes, about 80% Hb Bart's (~/4) and 20% Hb Portland 1 (~272) with very small amounts, if any, of Hb Portland 2 (~2~2) and HbH (~4) (Kutlar et al, 1989b). Lower levels of Hb Portland 1 have been observed in genetic compounds for the SEA deletion and the large Fil deletion which also eliminates the ~ gene (Kutlar et al, 1989b). In the rare cases of HbH disease with hydrops fetalis, in addition to Hb Bart's and the embryonic Hb Portland 1 and 2, variable amounts of HbH, HbF and HbA can also be detected (Chan et al, 1997). The lack of haem-haem interaction and high oxygen affinity of Hb Bart's make this 7

~-THALASSAEMIA

69

tetramer unsuitable for the delivery of oxygen to the tissues. The ensuing hypoxia is the cause of fetal hydrops and intrauterine death. Prolonged survival of hydropic infants until delivery is sustained by Hb Portland 1 which is stable and has an oxygen dissociation curve within physiological limits. The absence even of Hb Portland in homozygotes for large deletions involving oc as well as ~ genes makes these genotypes lethal in the first stages of development. Toxaemia of pregnancy occurs in about 75% (R Wasi, personal communication) and ante- or postpartum haemorrhage in 10% of the mothers of hydropic infants. If these mothers are not properly treated a considerable number (up to 50%) are at risk of lethal complications. In the last 10 years a few hydropic infants have been kept alive with regular blood transfusions after premature delivery or even with intravascular intrauterine exchange transfusion during pregnancy (Bianchi et al, 1986; Lain et al, 1992). Although long-term survival of these children may allow later bone marrow transplantation (Carr et al, 1995), the high risk of complications in the mothers and of congenital malformations and neurological immaturity in the infants still suggests that prenatal diagnosis in the mothers at risk followed by termination of the pregnancy should be considered. THE M O L E C U L A R NATURE O F ol-THALASSAEMIAS

As in [3-thalassaemia the mutations responsible for the partial or total deficiency of o~ chains are represented either by deletions of variable size or by point mutations. In contrast with [3-thalassaemia, however, deletions are the predominant cause of cc-thalassaemia. This is due to the particular structure of the oc-gene cluster. The presence of the duplicated homologous regions makes possible, during meiosis, misalignment of chromosome pairs which may be followed by reciprocal recombination. This mechanism has generated the two most frequent deletion-duplication events causing the loss of a single a-globin gene (Figure 4). Recombination through the X blocks, which are separated by a DNA sequence of 4.2 kb, eliminates the entire a2 gene leaving only an intact ct~ gene (deletion -c0 .2 or 'leftward deletion') (Embury et al, 1980) and generates at the same time the triplicated anti-type 0~2(~20~1anti 4.2 (Trent et al, 1981). Unequal cross-over between the Z sequences, which are 3.7kb apart, results also in the deletion of a single cc gene (deletion -co3.7 or 'rightward deletion') (Embury et al, 1980) and in the reciprocal txoctxanti3.vproduct (Higgs et al, 1980b). Apa I restriction analysis of the gene products derived from the Z box cross-over has allowed the identification within the 'rightward deletion' of three subtypes, --0~3"71, __~3.7II and _1~3.7III, generated by the different localizations of the cross-over (Figure 4) (Higgs et al, 1984). Subtype I is an oqlike gene having 5'-UTR sequences belonging to the cc2 gene, subtype II is a hybrid gene o~2/oq and subtype III consists of an ~ gene which retains its original 5' and 3' flanking sequences.

70

L.F.

x

(A)

Y

Z

X

B E R N I N I A N D C. L. H A R T E V E L D 1 kb

Y Z DrMMMJ

I

I

I

A

l

A

~

A

A

z

g anti 3.7

'.~ 2

i

cL 1 l a 2

i i / i / / / / ~

A -

(;t

(l 1

rll/-zj///.~sL~=~ ~2~t

Drl,'////J

A

3.71

t --like

;F,...............

A

3.7tl 1 -like, 3'-UTR -fz

~

A

w

3.7111

A

cL2 -like, 3'-UTR IllLilllll

(B)

X

Y

Z

X

I

-

62

×

irr= m

~7-/-/777xmm~

Y -

Z

1 3 r i l l / i l l

.-;,4,

Dr/,'/.,'tlJ

X

g anti 4.2 Et(~o.

ct 2

o~ 2

rr,, i [ / / / / l l ~

i i / l / / i / l

4.2 -

Dr[I/,'lil

f~ 1

(~c

J[IE]I

I

Ort/itf'l

J

Figure 4, Schematic representation of homologous recombination between the duplicated ct-globin genes, The homology boxes are depicted as grey, unfilled and hatched boxes representing X, Y and Z boxes respectively. The genes are indicated as blocks with exons depicted in black and introns in white. The Apal restriction sites ('A') are indicated along the fragment. Crossed lines indicate the position of recombination, (A) The three subtypes of rightward deletion (--(3~3"71JI'111) resulting from unequal crossing over between two misaligned Z boxes of the (xj- and ct2-globin genes and the reciprocal event, the ot triplication, are indicated. The site of cross-over for the three different types of rightward deletions is indicated by a dotted line, (B) The leftward deletion (-o~4,2) and the ct triplication resulting from recombination between the two misaligned X homology boxes,

Considering that the relative expression of (Y-2and cq genes is, on the average, 2.7 to 1, one would expect a higher expression of o~-globin from the deletion haplotype -0~3.7III ((~2 gene) than from the haplotype -or ,2 (oq gene). Actually a small difference between the two haplotypes persists as indicated by the higher levels of Hb Bart's at birth in homozygotes for the _~4.2 deletion in comparison with homozygotes for the rightward -0~3.7 deletion (Bowden et al, 1987). A slightly higher o~-globin deficiency in the

O~-THALASSAEMIA

71

leftward when compared with the rightward deletion is also suggested by the HbS levels observed in homozygotes for these deletions associated with HbS trait (Fodde et al, 1988). The difference in expression between % and a~ genes is, however, definitely reduced in carriers of a single (x gene chromosome, so that the determinant -o~4.z produces more and the determinant -o~3-7 less o~-globin than expected (Liebhaber et al, 1985). The increased output of the downstream gene might be caused by the release of transcriptional interference, as suggested by Proudfoot (1986), or by decreased competition for a regulatory element. However, the decreased expression of the _a3.7 chromosome cannot be accounted for by the same mechanisms. The change of the chromosome conformation secondary to the deletion may provide an alternative explanation (Higgs, 1993). The rightward- and leftward-type deletions are the most common mutations of the gene cluster and their relative frequency seems to be positively correlated with the size of the DNA region in which the cross-over takes place (see Higgs et al, 1989). Because of selection in the presence of malaria, these frequencies may not reliably indicate the real cross-over rates. Population surveys have shown that the -o~3.7 allele is by far the predominant one in Africa, both -o9 ,7 and -(x4.2 are present in the Mediterranean area, -c~3.7~,_a3.vH and -o0 .2 are common in South-East Asia and -o~3.7mis exclusively found in Melanesian populations. The distribution of these deletions on different haplotypes indicates that they arose independently and more than once in these populations (Fodde et al, 1991). Also, the presence at low frequency of o~triplications in all the populations investigated suggests the recurrent formation of deletion haptotypes by unequal crossing-over (assuming neutrality of the triplicated allele). The common denominator for the generation of deletions and reshuffling of the restriction markers is, probably, the extensive presence of homologous areas and the increase of the recombination rates at the telomeric regions of chromosome 16. Recombinations between o~ triplications and the wild-type allele generate the very rare quadruplicated haplotypes (z(z[~(~anti3.7 and o~(~o~o~anti4-2 (Gu et al, 1987; De Angioletti et al, 1992). Heterozygosity or homozygosity for triplicated alleles does not seem to cause untoward phenotypic effects (GalaneUo et al, 1983). The simultaneous heterozygosity for 13-thalassaemia results, however, in 13thalassaemia intermedia with increased globin chain imbalance and mild anaemia (Camaschella et al, 1987; Traeger-Synodinos et al, 1996). Deletion m u t a n t s that cause c~-thalassaemia

Table 1 lists the o~ gene deletions described to date. The references for each mutant are reported in the same table. In the section (A) are entered all the deletions which eliminate only one ~x gene and give an o~+ haplotype. Section (B) includes the deletions of both ¢x genes. Section (C) illustrates the deletions which eliminate the ~-MRE with or without involvement of the o~ genes. The great majority of o~ gene deletions do not take place by recombination within large, homologous and misaligned genomic sequences, as

72

L.F.

B E R N I N I A N D C. L. H A R T E V E L D

previously described. These, usually large, rearrangements are indicated in the literature as the consequence of 'illegitimate' recombination. The term 'illegitimate' is used to emphasize the absence of obvious areas of homology which could justify, at the breakpoint junction, pairing followed by recombination. Deletions due to 'illegitimate' events can be classified into the following three groups.

Non-homologous breakage and re-union Five deletions are represented in this group: ----Medl, __SEA, _(~)20.5, _(~)52 and (C~)C~5,3. The latter mutant shows a clear flush junction of the 5' and 3' breakpoints. In the _M~d~ and _(~)5.2 determinants DNA sequences not derived from either of the parental strands are inserted during recombination in the junction area. The breakpoints of the _--SEa and (~)20.5 deletions are located in an Alu repeat sequence at the 3' and 5' parental side respectively (Nicholls et al, 1987). Only a very limited degree of homology is observed in the regions around the parental breakpoints. Chromosome truncation A number of large deletions are generated by the truncation of the tip of the short arm of chromosome 16. Two mechanisms have been proposed to account for the stabilization of the telomere after the deletion. In the first (Pologe and Ravetch, 1988; Brown, 1992; Flint et al, 1994) the reconstruction of the telomeric sequence, referred to as 'chromosome healing', is brought about by the enzyme telomerase. This specialized RNA-protein complex contains an internal RNA template complementary to the TG-rich strand of the telomere repeats. With this template the enzyme primes the extension of the leading strand of the damaged chromosome. Thereafter DNA polymerase ~ completes the repair, carrying through on the extended leading sequence the synthesis of the lagging strand. In five deletions reported in the table ((~)cMo, (c~o0I~F, (~)VAT, (~C~)TI and __Bo) the stabilization has probably been achieved by 'chromosome healing' because of the presence in the deletion breakpoints of short sequences complementary and in phase with the RNA template of the telomerase. The ( ~ ) ~ c deletion does not show any trace of telomerase repair and its origin has been attributed (Flint et al, 1994) to a recombination between subtelomeric repeats referred to as 'chromosome capture' (Corcoran et al, 1988).

Recombination between Alu repeats In this last group of deletions recombination takes place between Alu repeat sequences. In two of them, ----D"td~ and ----Medll, the deletion follows the recombination between two misaligned Alu repeats located 33 kb apart; __c~t is a somewhat larger deletion but the event takes place between the same series of repeats even if at a different positions. Also, (c~) RA and _(g)MB result from exchanges between direct Alu repeats.

~-THALASSAEMIA

73

The analysis of the breakpoints of these five deletions and of three deletions in which only one Alu repeat is involved in the recombination has revealed (Harteveld et at, 1997a) that the recombination occurs either within or near a very conserved 26 bp core sequence which has been proposed as a hot spot of recombination (Rtidiger et al, 1995). These reports suggest a significant role of Alu repeats in the generation of the deletions involving the c~-globin gene cluster. However, Alu repeats represent, on the average, almost 26% of the whole 284 000 bp telomeric region in which the c~ gene cluster and its flanking sequences are embedded (Flint et al, 1997). It is difficult, therefore, to exclude the possibility that recombination might have happened by chance within these repeats. The analysis of more deletion breakpoints might clarify this issue. P o i n t m u t a t i o n s that c a u s e ~ - t h a l a s s a e m i a

Point mutations, which include single-nucleotide substitutions as well as small deletions or insertions, may involve coding sequences, non-translated regulatory or signalling regions and critical areas whose integrity is necessary for a correct mRNA processing. The number of known point mutations has more than doubled since 1993, mainly because of the use of improved analytical methods. Table 3 presents an up-to-date list of these mutations, the phenotypes of heterozygous carriers and the references. It is important to point out that the phenotype refers to the total production of cx-globin chain from a given haplotype and not from a single mutated cx gene. Phenotype ~÷_~0 indicates a haplotype whose o~-globin output is severely reduced and intermediate between that of o~+ and cx°. Most of these mutations involve the c~2 gene, in agreement with the observed dominant expression of that gene.

RNA-processing mutants Of the eight mutations listed in Table 3, four involve an acceptor or a donor splice site and result in the complete suppression of ~-globin chain production. In the first one, ~ IVS1 (-5 nt), due to a deletion of five nucleotides, the splicing takes places at an activated cryptic donor site in the middle of exon 1 (Felber et al, 1982). The small deletion obliterates a restriction site (HphI) and can, therefore, be detected by Southern blotting. The A---~G mutation at c~ IVS 1 116 abolishes a correct splicing and induces the retention of the first exon. Probably the same effect on RNA processing is due to the ~1 IVS1 117 mutation. The other four mutants involve, by base substitutions or small deletions, the polyadenylation signal sequence of the o~2 gene. This kind of mutation alters the efficiency of cleavage--polyadenylation of the RNA transcripts and results in the production of very low amounts of normal mRNA and in a run-on transcript which extends far past the normal termination region (Molchanova et al, t995). Experiments with transient expression systems have shown, however, that the downstream cryptic polyA site is not an efficient transcription

74

L . F . BERNINI AND C, L. HARTEVELD Table 3. List of non-deletion t~-thatassaemia mutations.

Mutant class

Origin

Phenotype

Reference

Mediterranean Middle East North European

~÷

Orkin et al (1981)

~÷

Indian

c~÷

Harteveld et al (1996b) ~iirfik et al (1993a)

Thai

ct+

Harteveld et al (1998)

Middle East, Mediterranean Mediterranean Indian Arabian

c~+-c~°

Higgs et al (1983a)

o~÷-o~° ~÷_~o ~*-ct°

Yiiregir et al (1992) Harteveld et al (1994) Tamary et al (1997)

Gt÷ ct+ t~÷ G° ct÷-~ °

Pirastu et al (1984) Waye et al (1996) Moi et al (1987) Olivieri et al (1987) Morl6 et al (1985)

(I) RNA-proeessing mutants

(A ) Splice site mutations c~21VSI (-5 nt) donor (GAGGTGAGG---~GAGG. . . . . ~_~ 1VS1 116 acceptor (GCAGGA---~GCGGGA) oq IVS1 117 acceptor (GCAGGA---)GCAAGA) at IVS1 1 donor (AGGT--)AGAT)

)

(B) Polyadenylation signal mutations ~_~ (AATAAA---~AATAAG) c~2 (AATAAA--)AATGAA) c~2 (AATAAA--~AATA--) cq (- 16 bp giving rise to CATAAA)

(2) RNA-translation mutants (A) Initiation codon mutations ct2 (ATG--~ACG) cq (ATG--+A-G) ~ (ATG--->GTG) -0~3,7 (ATG-->GTG) -0~3.711(ACCATG---)--CATG)

Mediterranean Vietnamese Mediterranean Black North African, Mediterranean

(B) Termination codon mutations c~2 cd 142 (TAA--+CAA) Hb Constant Spring t~2 cd 142 (TAA---~AAA) Hb Icaria c~2 cd 142 (TAA---)TCA) Hb Koya Dora ~2 cd 142 (TAA-~GAA) Hb Seal Rock c~2 cd 142 (TAA--+TAT) Hb Paks6

Clegg et al (1971)

South-East Asian Mediterranean

o~+

Clegg et al (1974)

Indian

cx+

De Jong et al (1975) Bradley et al (1975)

Black Laotian

~+

Waye et al (1994)

c~2 ed 39-4I

Yemenite-Jewish

cx+

Oron-Kami ~ at (1997)

(-9 bp, + 8 bp duplication) -ct ~.7~cd 30-31

Black

Safaya and Rieder (1988)

Spanish

Ay~a ~ M (I997a)

Black

Liebhaber et al (1987)

( C) Framesh~fi mutations

(GAGAGG--~GAG--G) cq cd 51-55 (-13 bp deletion, stop at cd62)

(D) Nonsense mutation: ot2 cd 116 (GAG--)TAG)

(3) Mutants causing post-translational instability (A ) Unstable ~ chain variants due to point mutations ot~ cd 14 TGG---~CGG (Trp--)Arg)

Indian

o~+

Harteveld et al (unpublished)

75

~-THALASSAEMIA Table 3.--(cont.). Mutant class

Origin

Phenotype

Reference

-c0 .7 cd 14 TGG--->CGG (Trp--4Arg) Hb Evanston ~., cd 26 GCG-~ACG (Ala---~Thr) Hb Caserta ~x~cd 29 CTG--~CCG (Leu---~Pro) Hb Agrinio c~2 cd 59 GGC---~GAC (Gly-+Asp) o.~ cd 59 GGC-+GAC Hb Adana c~2 cd 93 GTG--~GGG (Val---~Gly) Hb Bronte c~2 cd 104 TGC---~TAC (Cys---~Tyr) Hb Sallanches ~ cd 109 CTG---)CGG (Leu---~Arg) Hb Suan Dok ot cd I t0 GCC-->GAC (Ata---)Asp) Hb Petah Tikva c~ cd 125 CTG---~CCG (Leu---)Pro) Hb Quong Sze -ec 37 cd 125 CTG--)CAG

Black

~+

Honig et al (1984)

Italian

c~+

Lacerra et al (1997)

Greek

e~+

Hall et al (1993)

South-East Asian Mediterranean

~÷ ct~

Chan et al (1997) ~iiriik et al (1993b)

Italian

ot+

Lacerra et al (1997)

Mediterranean

c~+

Mofl6 et al (1995)

South-East Asian

c~+

Iraqi-Jewish

cx÷

Sanguansennsri et al (1979) Honig et al (1981)

South-East Asian

ot+

Goossens et al (1982)

Kurdish-Jewish

~0

Oron-Karni et al (1997)

Unknown

~÷

Harteveld et al (1996a)

North African

ct÷

Darbellay et al (1995)

Indian-Pakistani

c~*

Harkness et al (1990)

Yugoslavian

c~+

Rochette et al (1995)

?

~÷

Wajcman et al (1993)

c~+ cx+

Chan et al (1997) Pobedimskaya et al (1994) Ayala et al (1997b) Harteveld et al (unpublished) Rahbar et al (1997) Vives Cottons et al (1996)

(Leu--~Gln) ot~_cd 129 CTG--)CCG (Leu---~Pro) Hb Utrecht oq cd 129 CTG--->CCG (Leu--)Pro) Hb Tunis-Bizerte ~2 cd 130 GCT--~CCT (Ala--~Pro) Hb Sun Prairie ~ cd 131 TCT--->CCT (Ser---)Pro) Hb Questembert cd 132 (HI5) (val--+Gly) Hb Caen

(B) Unstable a chain variants due to small deletions ~xz cd 30 (-GAG, Glu) South-East Asian s , cd 38 or 39 (-ACC, Thr) Arabian Hb Taybe oh cd 60-61 (-AAG, Lys) Spanish cq cd 62 (-GTG, Val) Greek ~ cd 74 or 75 (-GAC, Asp) ~2 cd 113-116 (-12 bp) Hb Lleida

Mexican Spanish

~+ c~+ c~~ c~÷

IVS, intervening sequence.

terminator. This suggests that the transcription might go through the intergenic region, reaching the oq gene and inhibiting its expression by a process of transcriptional interference (Whitelaw and Proudfoot, 1986). The further decreased output of at-globin from the haplotype bearing the mutation would account for the severity of the mutation in the homozygote (Thein et al, 1988).

76

L.F.

BERNINI AND C. L. H A R T E V E L D

RNA-translation mutants

The failure of RNA translation and premature termination is caused in three cases by frameshifts generated by the deletion of a few nucleotides and in one instance by a nonsense mutation. The levels of mRNAs with a termination mutation are often quite low (Baserga and Benz, 1988; Kugler et al, 1995), probably because of an intranuclear degradation of the mutant mRNA. The stability of the RNA is not similarly affected by different mutations. In the dinucleotide deletion of cd 30-31 a severe decrease of mutant mRNA has been observed (Safaya et al, 1992), whereas the amount of mRNA seems normal in the nonsense mutation at cd 116. Five mutations affect the initiation codon. These kinds of mutations eliminate completely the expression of the involved gene, as indicated by the phenotype of the -c~3-7 (ATG--)GTG) chromosome. Of the two Mediterranean mutations (Pirastu et al, 1984; Moi et al, 1987) the one involving the c~z gene is more severe than the other located on the ~1 gene. The _~3.7 (-AC) deletion within the conserved sequence 5' of the initiation codon is responsible for a severe but not complete ~-globin deficiency; homozygous carriers of this mutation have HbH disease. Out of the seven possible mutations of the termination codon of the 1~2 gene which would result in an extended ot chain, five have been found in different ethnic groups (see Merritt et al, 1997). All five mutations are associated with a severe reduction of the c~2 gene expression and with the presence, on electrophoresis, of small amounts of haemoglobin having a cathodic mobility. The different base substitutions in the termination codon result in a readthrough of the 3' untranslated sequence until a new in-phase termination codon, located within the normal polyadenylation signal, is reached 88 nucleotides downstream. Secondary to the mutation are, thus, the invasion of the major polyadenylation signal and the extension of transcription further downstream into the cryptic polyadenylation signal (see Morales et al, 1997). The reduced transcription and instability of the ~ Constant Spring messenger accounts for the small amount of abnormal ~ chain produced. The protein does not seem to be unstable, although the formation of several electrophoretic bands in stored blood and haemolysates suggests a greater susceptibility of the elongated chain to proteolytic degradation. Hb Constant Spring carriers show atypical feature of the red cells (almost normal MCV, increased membrane rigidity and mechanical stability) and a more severe anaemia in comparison with other o~-thalassaemia variants. Schrier et al (1997) have suggested that the particular pathology of this mutant is secondary to the precipitation, binding and oxidation of both c~ Constant Spring and 15 chain on the red cell membrane. Mutants that cause post-translational instability

An ever-increasing number of ~÷-thalassaemia determinants are generated by amino acid substitutions or small deletions which affect the stability of

~-THALASSAEMIA

77

the globin molecule. These mutations usually disrupt the organization of the polypeptide chain, destroy the contacts within the haem pocket, causing loss of haem, and hinder the proper formation of o~-[3 contacts. In a number of variants, such as Hb Quong Sze, Hb Utrecht or the Greek variant due to a deletion of codon 62, the instability is so extreme that the mutant haemoglobin cannot be detected in the haemolysate of the carrier even if a normal amount of mRNA is transcribed. Also in this class of mutants o~2 genes are those mostly involved; this confirms again the observation that the more severe phenotypes are associated with the 5' rather than the 3' gene. No mutations have been found to date within the promoter region of c~-globin genes. By analogy with the mildness of the promoter mutations of the ~-globin gene it is quite likely that such events may remain unnoticed and detectable as unusual phenotypes only in combination with other mutations. The detection of deletional and non-deletional molecular defects of the c~-globin genes by gene mapping and polymerase chain reaction based strategies has been reviewed by Kattamis et al (1996). GEOGRAPHICAL DISTRIBUTION OF ct-THALASSAEMIA AND T H E ' M A L A R I A H Y P O T H E S I S ' (see also Chapter 1) It is a widely accepted conclusion that the high frequency of thalassaemias and sickle cell anaemia observed in some tropical and subtropical areas of the Old World (Figure 5) is due to the resistance against malignant malaria (Plasmodium falciparum) conferred by these inherited defects to the heterozygous carriers (Haldane, 1949, Allison, 1954). According to the 'malaria hypothesis', the (clinically healthy) heterozygotes for HbS or a thalassaemic determinant are resistant to malaria and have a selective advantage over both homozygotes which have a higher chance of dying during the first years of life because of either malaria or anaemia. The preferential survival of the heterozygote thus makes possible the persistence at polymorphic fi'equencies of the abnormal genes in the population, provided that the selective agent (malaria) remains present and active. Because there is a loss of both normal and abnormal genes, an equilibrium between their frequency will be reached in a period of time which depends on the extent of the selective advantage (balanced polymorphism). The 'malaria hypothesis' is supported by the overlapping geographical distribution of these disorders and endemic malaria and by clinical and epidemiological studies showing a positive correlation between malaria endemicity and frequency of abnormal alleles (Siniscalco et al, 1961, 1966; Livingstone, 1983). The prevalence of (z°-thalassaemia in some populations (reviewed by Flint et al, 1993) may be attributed to the same mechanism of balanced polymorphism argued for in the case of [3-thalassaemia and sickle cell anaemia (Flint et al, 1986; Hill et al, 1987). It is worth considering that o~°thalassaemia not only is lethal for the homozygous carrier but also involves a high mortality of the heterozygous pregnant mothers.

78

L. F. BERNINI AND C. L. HARTEVELD

(A)

(B)

Figure 5. The geographical distribution of (A) malaria ( n ) and (B) t~-thalassaemia (D, ct+-thalas saemia; II, ct0-thalassaemia). Because of migration, haemoglobinopathies ([]) are imported into areas where malaria has never been endemic.

On the other hand, homozygosity for ~÷-thalassaemia has virtually no clinical consequences. One would expect, therefore, the fixation of the abnormal gene in populations at high malaria endemicity. In other words, t~÷-thalassaemia would represent in those populations a transient, rather than a balanced, polymorphism, tending to replace completely the normal allele. This expectation has been borne out by the frequencies of ct÷thalassaemic alleles in some populations in which malaria was or still is highly endemic. These frequencies vary from 0.80-0.90 found in the tribal communities in Andhra Pradesh (India) (Fodde et al, 1988, 1991) to 0.80 in the Tharu (Nepal) (Modiano et al, 1991) to 0.68 in the northern coastal area of Papua New Guinea (Flint et al, 1986). The results of the study of the Melanesian population are particularly in favour of the malaria hypothesis. In this population the frequency of t~÷thalassaemia decreases from New Guinea to new Caledonia following a

~-THALASSAEMIA

79

south-east direction in parallel with the decline of malaria endemicity (Flint et al, 1986). In addition, the -(x 3.7III deletion is found only in these populations on a haplotype common in the area but relatively rare in other populations. This argues for a local origin of the deletion and against gene flow from other malarious regions. Finally, several genetic markers unlinked to the o~ cluster do not show any correlation with either malaria endemicity or altitude. In spite of the very strong hint provided by epidemiological investigations, conclusive evidence is still lacking because the mechanism(s) involved in the protection against malaria is (are) still unknown. In vitro experiments have shown that P. falciparum parasites invade and develop normally in thalassaemic erythrocytes (Luzzi et al, 1990). Oppenheimer et al (1987) observed that newborns with the presence of Hb Bart's in cord blood had significantly higher parasite rates than normal at the ages of 6 and 12 months. Recently Williams et al (1996a) have reported that in Vanuatu the incidence of uncomplicated malaria caused by P. falciparum and, particularly, Plasmodium vivax is higher in young children homozygous for c~+thalassaemia than in normal children. Both observations are at variance with the assumption that protection against malaria during the first years of life would depend on a decreased rate of infestation by the parasite and/or a rapid removal of parasitized red cells from the circulation. The latter mechanism has been indeed demonstrated in heterozygotes for the [~s gene (reviewed by Luzzatto, 1979). Williams et al suggest that just the increased morbidity during early childhood functions as an early vaccination, contributing to develop the protective immunity (cross-immunity in the case of P.vivax infection) against P.falciparum. An argument in favour of this hypothesis is that parasitized c~-thalassaemic red cells have a surface parasite antigen expression roughly twice that exhibited by normal erythrocytes (Luzzi et al, 1991). They might, therefore, be able to present more efficiently these antigens to the immune system and/or to clear them more rapidly from the circulation. At the same time the impaired rosette formation associated with the small size of the thalassaemic red cells might protect against the development of cerebral malaria by decreasing the frequency of sequestration in the nervous tissue (Carlson et al, 1994). The available population data indicate that the increase of fitness in malarial regions is mainly restricted to o~+-thalassaemia homozygotes; the absence of selective advantage in heterozygotes might, however, be only apparent and due to the fact that the increment of fitness in such individuals is too small to be demonstrated (Williams et al, 1996a). A more recent microepidemiological investigation has been carried out by Allen et al (1997) in the north coastal area of Papua New Guinea, where malaria is hyperendemic and the frequency of ot÷-thalassaemia extremely high. The matched case-control study has revealed that, on comparison with c~(~/o~o~ individuals, the risk of severe malaria is 0.40 in or.÷homozygous children and 0.66 in heterozygotes. An unexpected finding is that thalassaemic children are also protected against infections other than

80

L . F . BERNINI AND C. L. HARTEVELD

malaria. In particular, this last observation hints at an involvement (even if difficult to define) of the immune response. Many other genetic factors, particularly those involved in the building up of anti P. falciparum immunity, are certainly important in generating resistance against malaria (see Pasvol, 1996; Hill et al, 1994). Although the mechanisms responsible for the resistance against malaria remain undetermined, the recently provided evidence confirms the protective effect of ct-thalassaemia against malaria morbidity. The protection also conferred against other infections puts in a larger perspective the role played by t~thalassaemia in the morbidity and mortality during childhood in tropical regions. Because of the epidemiological evidence, it is difficult to challenge the role played by thalassaemias in the protection against malaria. The recent findings of increased susceptibility of t~-thalassaemic children to uncomplicated malaria might constitute a turning point for re-interpreting the mechanism of protection conferred by thalassaemic disorders. ¢~-THALASSAEMIA AND MENTAL ~ T A R D A T I O N Two forms of t~-thalassaemia associated with MR have been describeA, the ATR-16 and the ATR-X syndromes (Gibbons and Higgs, 1996). ATR-16 is a contiguous gene syndrome caused by the loss of DNA from the tip of the short arm of chromosome 16. The phenotype of this rare syndrome is ill defined and varies from ~-thalassaemia with mild or moderate MR to an associated broad spectrum of dysmorphic features and developmental abnormalities. Part of this variability is likely to be due to additional aneuploidy seen in these patients (Wilkie et al, 1990a). Two deletions were important to define the region critically associated with MR. These were the ----aR deletion, which is the largest t~0-thalassaemia deletion without mental retardation, removing 250 kb from the tip of chromosome 16 p, and the 2 Mb ----BO deletion associated with ct-thalassaemia, MR and a variety of minor congenital abnormalities. It is thought that the gene(s) deleted in this syndrome encode for proteins whose effects are critically dependent on the amount produced. These so-called dosage-sensitive genes might exert their effects on, for example, developmental pathways which are sensitive to critical levels of trans-acting factors, receptor or signal transduction molecules (Gibbons and Higgs, 1996). The ATR-X syndrome results from mutations in the XHz gene located at Xq13.3, which gene encodes for a trans-acting factor that regulates gene expression (Gecz et al, 1994; Stayton et al, 1994; Gibbons et al, 1995). A variety of mutations, including two premature in-phase stop codons and seven missense mutations, give rise to a surprisingly uniform phenotype in affected males. They show severe MR, similar patterns of facial dysmorphism, genital abnormalities and an unusually mild form of HbH disease (Wilkie et al, 1990c; Donnai et al, 1991; Gibbons et al, 1991). The XI-t2 belongs to the SNF2 subgroup of a superfamily of proteins, showing similar DNA-dependent ATPase and DNA helicase domains. These proteins are involved in a variety of cellular functions, including mitotic

O~-THALASSAEMIA

81

chromosome segregation, DNA recombination and repair and global regulation of transcription. The consistent association of ATR-X with down-regulation of ct-globin gene expression suggests that XH 2 is a regulator of gene expression. The study of similar global transcriptional regulator proteins (Tamkun et al, 1992; Winston and Carlson, 1992) suggests that they might do so via interactions with gene-specific activators, probably by altering chromatin structure to relieve repression (Carlson and Laurent, 1994). Because all the diverse XH2 mutations cause ~-thalassaemia, it seems likely that this protein is normally necessary for correct regulation of ~ gene expression (Gibbons et al, 1995). THE ACQUIRED FORM OF ot-THALASSAEMIA It has been suggested that this rare atypical form of HbH disease is acquired during the evolution of pre-leukaemia or myeloproliferative disease. These patients (mostly aged males) were haematologically normal before the onset of their disease (Higgs, 1993). The disorder is characterized by a variable amount of HbH and variation in the [3-globin: t~-globin synthesis ratios, which may fluctuate during the course of disease. The reduction in ct-globin synthesis can be less than 10% of the normal o~-globin production, which is considerably lower than in the genetic forms of HbH disease in which the t~ chain production from one instead of four functional c~-globin genes is still responsible for 2 0 - 5 0 % of the normal o~-globin production level (Higgs et al, 1983b). The presence within the cell population of reticulocyte fractions producing balanced ~-globin:t~-globin ratios and others with almost no detectable 0~ chain production in the peripheral blood of the patient clearly demonstrates the clonal origin of the abnormal cells and explains how the variability in the HbH levels depends on the relative amount of cells still producing ~-globin. The absence of rearrangements or deletions of the normal ot-giobin gene organization, the normal post-transcriptional RNA processing and the unchanged hypomethylation of the o~-globin gene cluster in both pre-leukaemia cells and control bone marrow DNA suggest that the marked reduction in ~ chain synthesis probably results from a down-regulation of transcription of the ~ genes on both chromosomes 16 (Anagnou et al, 1983; Higgs et al, 1983b). The nature of the specific defect is unknown but two different mechanisms may be invoked to explain the decreased expression of all four structurally intact ct-globin genes. The first mechanism would involve a cisacting effect of two independent structural mutations on each chromosome 16, which results in a decreased expression of the normal complement of t~-globin genes on both clusters. This could involve a rearrangement outside the tz-gtobin gene complex or a point mutation affecting important regulatory elements. This mechanisms seems less likely, however, because this has to occur on both homologous chromosomes. Alternatively, a mutation that modifies the expression of trans-acfing factors involved in cz-globin gene regulation is likely to repress or to prevent activation of all

82

L. F. BERNINI AND C. L. HARTEVELD

four c~-globin genes simultaneously. The latter explanation is supported by experimental evidence from mouse erythroteukaemia cells containing the human chromosome 16 as the only human chromosome. The chromosome 16 from pre-leukaemic patients with acquired HbH disease was transferred to mouse erythroleukaemia cells and transcription activity of the human ot-globin genes compared with that of a chromosome 16 from a normal individual. The expressions in both types of cells were similar, suggesting that the altered expression of a gene in t r a n s may be responsible for the acquisition of HbH disease in these patients (Helder and Deisseroth, 1987), although the lineage of the cell of origin for the fused chromosome 16 in these experiments is uncertain (Higgs, 1993). REFERENCES Albitar M, Cash FE, Peschle C et al (t992) Developmental switch in the relative expression of the (zl- and o~2-globin genes in humans and in transgenic mice. Blood 79: 247t-2474. Allen S J, O'Donnell A, Alexander NDE et al (1997) c~*-Thalassemia protects children against disease caused by other infections as well as malaria. Proceedings of the National Academy of Sciences of the USA 94: 14736-14741. Allison AC (1954) Protection afforded by sickle-cell trait against subtertian malarial infection. British Medical Journal i: 290-294. Anagnou NP, Ley TJ, Chesbro B et al (1983) Acquired ct-thalassemia in preleukemia is due to decreased expression of all ibnr ot-globin genes. Proceedings of the National Academy of Seiences of the USA 80:6051-6055. De Angioletti M, Lacerra G, Castaldo C et al (1992) A (x~o~a't~-3-7type I1: a new o~-globin gene rearrangement suggesting that the ~-globin gene duplication could be caused by intrachromosomal recombination, lluman Genetics 89: 37-41. Ayala S, Colomer D, Aymerich M e t al (1997a) First description of a frameshift mutation in the e~lglobin gene associated with c~-thalassaemia. British Journal of Haematology 98: 47-50. Ayala S, Colomer D, Gelpi JL et al (1997b) ~-Thalassaemia due to a single codon deletion in the ~lglobin gene. Computational structural analysis of the new s-chain variant. Human Mutation (Mutation in Brief 132). Barton P, Malcolm S, Murphy C et al (1982) Localization of the human alpha-globin gene cluster to the short arm of chromosome 16 (16 p 12-16 pter) by hybridization in situ. Journal of Molecular Biology 156: 269-278. Baserga SJ & Benz EJ (1988) Nonsense mutations in the human beta-globin gene affect mRNA metabolism. Proceedings of the National Academy of Sciences of the USA 85: 2056-2060. Bernal"di G (1989) The isochore organization of the human genome. Annual Review of Genetics 23: 637-661. Bernet A, Sabatier S, Picketts DJ et al (1995) Targeted inactivation of the major positive regulatory element (HS-40) of the human ot-globin gene locus. Blood 86: 1202-1211. Bernini LF, de Jong WW & Meera Khan P (1970) Haemoglobin variants in the tribal population of Andhra Pradesh; evidence for the duplication of the ~Hb lOCUSin man. Atti della Associazione Genetica ltaliana XV: 191 - 194. Bianchi DW, Beyer EC, Stark AR et al (1986) Normal long-term survival with c~-thalassemia. Journal of Pediatrics 108: 716-718. B inninger D & Weber LA (1984) Coordinate regulation of polypeptide chain initiation and elongation in rabbit reticulocytes. Journal of Cellular Physiology 118: 267-276. Bowden DK, Hill AVS, Higgs DR et al (1987) Different hematologic phenotypes are associated with the leftward (-o~4.2) and rightward (--O~3"7) (x+-thalassemia deletions. Journal of Clinical Investigation 79: 39-43. Bradley TB, Wohl RC & Smith GJ (1975) Elongation of the c~-globin chain in a black family: interaction with HbG Philadelphia. Clinical Research 23:131A. Breuning MH, Madan K, Veljaal M et al (1987) Human ac-globin maps to pter-pl3.3 in chromosome 16 distal to PGP. Human Genetics 76: 287-289.

~-THALASSAEMIA

83

Brown WRA (1992) Telomerase and chromosome healing. Current Biology 2:127-129. Bunn HF & Forget BG (1986) Hemoglobin: Molecular, Genetic and Clinical Aspects, pp 223-303. Philadelphia, PA: WB Saunders. CamzLschella C, Bertero MT, Sen'a A et al (1987) A benign form of thalassaemia intermedia may be determined by the interaction of triplicated alpha locus and heterozygous beta-thalassaemia. British Journal of Haematology 66:103-107. Carlson J, Nash GB, Gabutti Vet al (1994) Natural protection against severe Plasmodiumfalciparum malaria due to impaired rosette formation. Blood 84: 3909-3914. Carlson M & Laurent BC (1994) The SNFISWI family of global transcriptional activators. Current Opinion on Cellular Biology 6: 396-402. Cart S, Rubin L, Dixon D et al (1995) Intrauterine therapy for homozygous c¢-thalassemia. Obstetrics and Gynecology 85: 876-879. Chan V, Wan-Yin CV, Tang M e t al (1997) Molecular defects in Hb H hydrops fetalis. British Jou~vzal of Haematology 96: 224-228. Chang J, Lu RH, Xu SM et al (1996) Inactivation of mouse alpha-globin gene by homologous recombination: mouse model of hemoglobin H disease. Blood 88:1846-1851. Chen H, l.~3wrey CH & Stamatoyannopoulos G (1997) Analysis of enhancer function of the HS-40 core sequence of the human t~-globin cluster. Nucleic Acids Research 25:2917-2922. Chitayat D, Silver MM, O'Brien K et al (1997) Limb defects in homozygous alpha-thalassemia: report of three cases. American Journal of Medical Genetics 68: 162-167. Chui DH, Luo HY, Clarke BJ et al (1988) Potential application of a new screening test for alphathalassemia-1 carriers. Hemoglobin 12: 459-463. Clegg JB, Weatherall DJ & Milner PF (1971) Haemoglobin Constant Spring: a chain termination mutant? Nature 234: 337-340. Clegg JB, Weatherall DJ, Contopolou GI et al (1974) Haemoglobin Icaria, a new chain-termination mutant which causes ~ thalassaemia. Nature 251: 245-247. Collins FS & Weissman SM (1984) The molecular genetics of human hemoglobin. Progress in Nucleic Acid Research and Molecular Biology 31:315-438. Corcoran LM, Thompson JK, Walliker D et al (1988) Homologous recombination within subtelomeric repeat sequences generates chromosome size polymorphisms in P.falciparum. Cell 53: 807-813. ~iJrtik MA, Baysal E, Gupta RB et al (1993a) An IVS-I-117 (G- +A) acceptor splice site mutation in the cq-globin gene is a nondeletional t~-thalassaemia-2 determinant in an Indian population. British Journal of Haematology 85: 148-152. (~tiriik MA, Dimovski AJ, Baysal E et al (1993b) Hb Adana or cc 2(59)(ES)Gly--~Asp I] 2, a severely unstable cq-globin variant, observed in combination with the -(c~)20.5kb co-thai-1 deletion in two Turkish patients. American Journal of Hematology 44: 270-275. Darbellay R, Mach PS, Rose K et al (1995) Haemoglobin Tunis-Bizerte: a new ~1 globin 129 Leu--~Pro unstable variant with thalassaemic phenotype. British Journal of Haematology 90:71-76. Deisseroth A, Nienhuis A, Turner P e t al (1977) Localization of the human cc-globin structural gene to chromosome 16 in somatic cell hybrids by molecular hybridization. Cell 12: 205-218. Donnai D, Clayton Smith J, Gibbons RJ et al (1991) The non-deletion cc thalassaemia/mental retardation syndrome: further support for X linkage. Journal of Medical Genetics 28: 742745. Embury SH, Miller JA, Dozy AM et al (1980) Two different molecular organizations account for the single cc-globin gene of the oc-thalassemia-2 genotype. Journal of Clinical Investigation 66: 1319-1325. Fei YJ, Liu JC, Walker ELD III & Huisman THJ (1992a) A new gene deletion involving the cc2, ocl and 0l-globin genes in a black family with HbH disease. American Journal of Hematology 39: 299-303. Fei YJ, Oner R, Bozkurt G e t al (1992b) Hb H disease caused by a homozygosity for the AATAAA---)AATAAG mutalion in the polyadenylation site of the alpha 2-globin gene: hematological observations. Acta Haematologica 88: 82-85. Felber BK, Orkin SH & Hamer DH (1982) Abnormal RNA splicing causes one from of ~t thalassemia. Cell 29: 895-902. Felice AE, Cleek MP, McKie K et al (1984) The rare cc-thalassemia-1 of Blacks is a ~cc-thalassemia1 associated with deletion of all oc- and ~-globin genes. Blood 63: 1253-1257. Fichera M, Spalletta A, Fiorenza F et al (1997) Molecular basis of ~-thalassemia in Sicily. Human Genetics 99:381-386.

84

L. F. BERNINI AND C. L. HARTEVELD

Fischel Ghodsian N, Vickers MA, Seip M e t al (1988) Characterization of two deletions that remove the entire human ~-~ globin gene complex (-Thai and -Fil). British Journal of Haematology 70: 233-238. Flint J, Harding RM, Boyce AJ & Clegg JB (1993) The population genetics of the haemoglobinopathies, BaiUikre's Clinical Haematotogy 6:215-262. Flint J, Hill VS, Bowden DK et al (1986) High frequencies of ct-thalassemia are the result of natural selection by malaria. Nature 321: 744-750. *Flint J, Craddock CF, Villegas A et al (1994) Healing of broken human chromosomes by the addition of telomeric repeats. American Journal of Human Genetics 55:505-512. Flint J, Rochette J, Craddock CF et al (1996) Chromosomal stabilisation by a subtelomeric rearrangement involving two closely related Alu elements. Human Molecular Genetics 5:1163-1169. *Flint J, Thomas K, Micklem G e t al (1997) The relationship between chromosome structure and function at a human telomeric region. Nature Genetics 15: 252-257. Fodde R, Losekoot M, van den Brook MH et al (1988) Prevalence and molecular heterogeneity of ~t+thalassemia in two tribal populations from Andhra Pradesh, India. Human Genetics 80: 157160. Fodde R, Harteveld CL, Losekoot M e t al (1991) Multiple recombinants events are responsible for the heterogeneity of ct*-thalassemia haplotypes among the forest tribes ofAndhra Pradesh, India. Annals t~'Hun~tn Genetics 55: 43-50. Galanello R, Ruggeri P, Paglietti E et al (1983) A family with segregating triplicated c~-gtobin loci and 13-thalassemia. Blood 62:1035-1040. Galanello R, Paglietti E, Melis MA et al (1984) Hemoglobin inclusions in heterozygous c~-thalassemia according to their ct-globin genotype. Acta Haematologica 72: 34-36. Galanello R, Aru B, Dessi C et al (1992) Hb H disease in Sardinia: molecular, hematological and clinical aspects, Acta Haematologica 88: 1-6. Gecz J, Pollard H, Consalez G e t al (1994) Cloning and expression of the murine homologue of a putative human X-linked nuclear protein gene closely linked to PGK1 in Xq13.3. Human Molecular Genetics 3: 39-44. *Gibbons RJ & Higgs DR (1996) The o~-thalassemia/mental retardation syndromes. Medicine (Baltimore) 75: 45-52. Gibbons RJ, Wilkie AO, Weatherall DJ et al (1991) A newly defined X linked mental retardation syndrome associated with ot thalassaemia. Journal of Medical Genetics 28: 729-733. Gibbons R J, Picketts D J, Villard L et al (1995) Mutations in a putative global transcriptional regulator cause X-linked mental retardation with ~-thalassemia (ATR-X syndrome). Cell 80: 837-845. Giordano PC, Harteveld CL, Michiels JJ et al (1997) Atypical Hb H disease in a Surinamese patient resulting from a combination of the - SEA and _~3.7 deletions with Hb C heterozygosity. British Journal of Haematology 96: 801-805. Gonzalez-Redondo JM, Gilsanz F & Ricard P (1989) Characterization of a new ct-thalassemia-I deletion in a Spanish family. Hemoglobin 13: 103-116. Gonzalez-Redondo JM, Diaz-Chico JC, Malcorra-Azpiazu JJ et al (t988) Characterization of a newly discovered ct-thalassemia-I in two Spanish patients with HbH disease. British Journal of Haematology 70: 459-463. Goossens M, Lee KY, Liebhaber SA & Kan YW (1982) Globin structural mutant t~ 125Leu leads to Pro is a novel cause of c~-thalassaemia. Nature 296: 864-865. Gouttas A, Fessas P, Tsevrenis H & Xefteri E (1955) Description d'une nouvelle varirt6 d'anemie hemolytique congenitale. Sang 26- 911-919. Gu YC, Landman H & Huisman TH (1987) Two different quadruplicated ct-globin gene arrangements. British Journal of Haematology 66: 245-250. Haldane JBS (1949) Disease and evolution. Ricerca Scientifica 19 (supplement 1): 3-10. Hall GW, Thein SL, Newland AC et al (1993) A base substitution (T--~C) in codon 29 of the t~2-globin gene causes ot thalassaemia. British Journal of Haematology 85: 546-552. Harkness M, Harkness DR, Kutlar F et al (1990) Hb Sun Prairie or t~, 130(Hl3)Ala---)Pro 13z,a new unstable variant occurring in low quantities. Hemoglobin 14: 479-489. Harris PC, Barton NJ, Higgs DR et al (1990) A long range restriction map between the o~-gtobin complex and a marker closely linked to the poly cystic kidney disease I (PKDI) locus. Genomics 7: 195-206. Harteveld CL, Losekoot M, Haak HL et al (1994) A novel polyadenylation signal mutation in the ct2globin gene causing ct thalassaemia. British Journal of Haematology 87: 139-143. Harteveld CL, Giordano PC, Losekoot M e t al (1996a) Hb Utrecht let 2 129(H12)Leu----)Pro], a new

~-THALASSAEMIA

85

unstable ~2-chain variant associated with a mild ct-thalassaemic phenotype. British Journal of Haematology 94: 483-485. Harteveld CL, Heister JGAM, Giordano PC et al (1996b) An IVSI-ll6 (A--~G) acceptor splice site mutation in the ~2 globin gene causing c~÷thalassaemia in two Dutch families. British Journal of Haematology 95:461-466. *Harteveld CL, Losekoot M, Fodde R et al (1997a) The involvement of Alu repeats in recombination events at the c~-globingene cluster: characterization of two o~°-thalassaemiadeletion breakpoints. Human Genetics 99: 528-534. Harteveld CL, Losekoot M, Heister AJ et al (1997b) c~-Thalassemia in The Netherlands: a heterogeneous spectrum of both deletions and point mutations. Human Genetics 100:465-471. Harteveld CL, Giordano PC, van Delft Pet al (1998) A novel splice donor site mutation of the ~jglobin gene causing ~-thalassaemia. British Journal of Haematology 102:50 (abstract P-0200). Hatton CS, Wilkie AO, Drysdale HC et al (1990) c~-Thalassemiacaused by a large (62 kb) deletion upstream of the human ~ globin gene cluster. Blood 76: 221-227. Helder J & Deisseroth A (1987) S1 nuclease analysis of ~-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells. Proceedings of the National Academy of Sciences of the USA 84: 2387-2390. Heywood JD, Karon M & Weissman S (1964) Aminoacids incorporation into c~and ~ chains of hemoglobin by normal and thalassemic reticulocytes. Science 146: 530-532. *Higgs DR (1993) ot-Thalassaemia. In Higgs DR & Weatherall DJ (eds) The Haemoglobinopathies. London: Bailli6re Tindall. Higgs DR, Pressley L, Old JM et al (1979) Negro ~-thalassaemia is caused by deletion of a single t~globin gene. Lancet 2: 272-276. Higgs DR, Old JM, Pressley Let al (1980a) A novel o~-globingene rearrangement in man. Nature 284: 632-635. Higgs DR, Pressley L, Clegg JB et al (1980b) Detection of ~-thalassaemia in Negro infants. British Journal of Haematology 46: 39-46. Higgs DR, Goodboum SE, Lamb Jet al (1983a) ~x-Thalassaemiacaused by a polyadenylation signal mutation. Nature 306: 398-400. Higgs DR, Wood WG, Barton C et al (1983b) Clinical features and molecular analysis of acquired hemoglobin H disease. American Journal of Medicine 75:181-191. Higgs DR, Hill AV, Bowden DK et al (1984) Independent recombination events between the duplicated human c~globin genes; implications for their concerted evolution. Nucleic Acids Research 12: 6965-6977. Higgs DR, Ayyub H, Clegg JB et al (1985) ~-Thalassaemia in British people. British Medical Journal 290: 1303-1306. Higgs DR, Vickers MA, Wilkie AOM et al (1989) A review of the molecular genetics of the human c~-globin gene cluster. Blood 73: 1081-1104. Higgs DR, Wood WG, Jarman AP et al (1990) A major positive regulatory region located far upstream of the human o~-globingene. Genes and Development 4:1588-1601. Hill AVS, Flint J, Weatherall DJ et al (1987) c~-Thatassaemia and the malaria hypothesis. Acta Haematologica 78:173-179. Hill AV, Aidoo M, Alsopp CE et al (1994) Interactions between Plasmodium falciparum and HLA molecules. Biochemical Society Transactions 22: 282-285. Hotlan SR, Jones RT & Koler RD (I972) Duplication of haemoglobin genes. Biochimie 54: 639-648. Honig GR, Sh0Jnsuddin M, Zaizov R et al (1981) Hemoglobin Petah Tikva (or 110 ata replaced by asp): a new unstable variant with ot-thalassaemia-like expression. Blood 57: 705-711. Honig GR, Shamsuddin M, Vida LN et al (1984) Hemoglobin Evanston (~ 14 Trp--->Arg).An unstable o~-chain variant expressed as oc-thalassaemia. Journal of Clinical Investigation 73: 17401749. Hunt JA & Lehmann H (1959) Haemoglobin 'Bart's': a foetal haemoglobin without c~chains. Nature 184: 872-873. Hunt DM, Higgs DR, Old JM et al (1980) Determination of c~-thalassaemiaphenotypes by messenger RNA analysis. British Journal of Haematology 45: 53-64. Indrak K, Gu Y-C, Navotny Jet al (1993)A new ct-thalassaemia-2 deletion resulting in microcytosis and hypochromia and in vitro chain imbalance in the heterozygote. American Journal of Hematology 43: 144-145. Ingram VM & Stretton AOW (1959) Genetic basis of the thalassaemia diseases. Nature 184: 1903-1909.

86

L. F. BERNINI AND C. L. HARTEVELD

Jarman AR Wood WG, Sharpe JA et al (1991) Characterization of the major regulatory element upstream of the human c~-globin cluster. Molecular and Cell Biology 11: 4679-4689. Jones RT, Schroeder WA, Balog JE & Vinograd JR (1959) Gross structure of hemoglobin H. Journal (~fthe American Chemical Society 81:3161. De Jong WWW, Meera Khan P & Bernini LF (1975) Hemoglobin Koya Dora: high frequency of a chain termination mutant. American Journal of Human Genetics 27:81-90. Kan YW, Schwartz E & Nathan DG (1968) Globin chain synthesis in ct-thalassaemia syndromes. Journal of Clinical Investigation 47:2512- 2522. Kan YW, Dozy AM, Varmus HE et al (1975) Deletion of c~ globin genes in haemoglobin H disease demonstrates multiple ~x globin structural loci. Nature 255: 255-256. Kanavakis E, Traeger-Synodinos J, Papasotiriou I e t at (1996) The interaction of alpha zero thalassaemia with Hb Icaria: three unusual cases of haemoglobinopathy H. British Journal of Haematology 92: 332-335. *Kattamis C & Lehmann H (1970) The genetical interpretation of haemoglobin H disease. Human Heredity 20:156-164. Kattamis AC, Camaschella C, Sivera P e t al (1996) Human o~-thalassaemia syndromes: detection of molecular defects. American Journal of Haematology 53:81-91. * Kielman MF, Smits R & Bernini LF (1994) Localization and characterization of the mouse ~x-globin locus control region. Genomics 21:431-433. Kielman MF, Smits R, Devi TS et al (1993) Homology of a 130 kb region enclosing the ~-globin gene cluster, the ~-locus controlling region, and two non-globin genes in human and mouse. Mammalian Genome 4:314-323. Kielman ME Smits R, Hof I et al (1996) Characterization and comparison of the human and mouse Dist 1/a-globin complex reveals a tightly packed multiple gene cluster containing differentially expressed transcription units. Genomics 32: 341-351. Kozak M (1991) Structural features in eukaryotic mRNAs that modulate the initialion of translation. Joul~al of Biolngical Chemistry 266: 19867-19870. Kozak M (1994) Features in the 5' non-coding sequences of rabbit ~ and 13-globin mRNA that affect translational efficiency. Journal of Molecular Biology 235: 95-110. Kugler W, Enssle J, Hentze MW et aI (1995) Nuclear degradation of nonsense mutated beta-globin mRNA: a postm~nscriptional mechanism to protect heterozygotes from severe clinical manifestation of beta-thalassemia? Nucleic Acid Research 23:413-418. Knlozik AE, Kar BC, Serjeant GR et al (1988) The molecular basis of ~ thalassaemia in India. Its interaction with the sickle cell gene. Blood 71: 467-472. Kutlar F, Gonzalez-Redondo JM, Kuttar Aet al (1989a) The levels of ~, T and 8-chains in patients with HbH disease. H, tman Genetics 82: 179-t86. Kutlar E Reese AL, Hsia YE et al (1989b) The types of hemoglobins and globin chains in hydrops fetalis. Hemoglobin 13:671-683. Lacerra G, Fioretti G, De Angioletti M e t al (1991) (A)c~ 5.3: a novel c~(+)-thalassemia deletion with the breakpoints in the c~2-globin gene and in close proximity to an Alu family repeat between the ~F~x2- and Woh-globin genes. Blood 78: 2740-2746. Lacerra G, De Angioletti M, Di Girolamo R et al (1997) HbCaserta and HbBronte: two novel hemoglobin variants caused by ot2-globin gene mutations. 6th International Con[erence on Thalassaemia and the Haemoglobinopathies, Malta, 1997, abstract 15 I. Lam TK, Chan V, Li CK et al (1992) Long-term survival of a baby with homozygous ct-thalassemia. Acta Haematologica 88: 198-200. Lamb J, Wilkie AOM, Hart:is PC et al (1989) Detection of breakpoints in submicroscopic chromosomal translocation, illustrating an important mechanism for genetic disease, l~mcet 2: 819-824. Lamb J, Harris PC, Wi|kie AO et al (1993) De novo truncation of chromosome 16p and healing with (TTAGGG)n in the ~-thalassemia/mental retardation syndrome (ATR-I6). American Journal of Human Genetics 52: 668-676. Lauer J, Shen CKJ & Maniatis T (1980) The chromosomal arrangement of hmnan ~-like globin genes: sequence homology and ~-globin gene deletions. Cell 20:119-130. Leder A, Daugherty C, Whitney B e t al (1997) Mouse zeta- and alpha-globin genes: embryonic survival, alpha-thalassemia, and genetic background effects. Blood 90: 1275-1282. Liebhaber SA, Cash FE & Main DM (1985) Compensatory increase in alpha I-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion, Journal of Clinical htvestigation 76: 1057-1064. Liebhaber SA, Cash FE & Ballas SK (1986) Human c~-globin gene expression. The dominant role of

O~-THALASSAEMIA

87

the o~2-1ocus in mRNA and protein synthesis. Journal of Biological Chemistry 261: 15327-15333. Liebhaber SA, Coleman MB, Adams JG et al (1987) Molecular basis for nondeletion ct-thalassemia in American blacks, o~2(116GAG--)UAG). Journal of Clinical Investigation 80: 154-159. Liebhaber SA, Griese EU, Weiss Iet al (1990) Inactivation of human ct-globin gene expression by a de novo deletion located upstream of the o~-globin gene cluster. Proceedings of the National Academy ¢~'Sciences of the USA 87:9431-9435. Lin SE Liu TC, Chen TP et al (1994) Diagnosis of thalassaemia by non-isotope detection of alpha/beta and zeta/alpha mRNA ratios. British Journal of Haematology 87: 133-138. Liu TC, Chiou SS, Lin SF et al (1994) Molecular basis and hematological characterization of Hb H disease in southeast Asia. American Journal of Hematology 45: 293-297. Livingstone FB (1983) 'The Malaria hypothesis'. In Bowman JE (ed.) Distribution and Evolution of the Hemoglobin and Globhz Loci pp 15-44. New York: Elsevier. Lodish HF (1976) Translational control of protein synthesis. Annual Review of Biochemistry 665: 39 -72. Luzzatto L (1979) Genetics of red cells and susceptibility to malaria. Blood 54:961-976. Luzzi GA, Torii M, Aikawa M et al (1990) Unrestricted growth of Plasmodiumfalciparum in microcytic erythrocytes in iron deficiency and thalassaemia. British Journal of Haematology 74: 51%524. Luzzi GA, Merry AH, Newbold CJ et al (1991) Surface antigen expression on Plasmodium falciparum-infected erythrocytes is modified in beta- and alpha-thalassemia. Journal of Experimental Medicine 173: 785-791. Matthay KK, Mentzer WC, Dozy AM et al (1979) Modification of hemoglobin H disease by sickle trait. Journal of Clinical Investigation 64: 1024-1032. Meloni T, Pilo G, Camardella L et al (1980) Coexistence of three hemoglobins with different a-chains in two unrelated children (with family studies indicating polymorphism in the number of ctglobin genes in the Sardinian population). Blood 55: 1025-1032. Merritt D, Jones RT, Head C et al (1997) Hb Seal Rock [(alpha2) 142 term ---)Glu, codon 142 TAA--~GAA]: an extended alpha chain variant associated with anemia, microcytosis, and alphathalassemia-2 (-3.7 kb). Hemoglobin 21:331-344. Mesker WE, Ouwerkerk-v. Velzen MCM, Oosterwijk JC et al (in press) Two color immunocytochemical staining of gamma (T) and epsilon (e) globin chains in fetal red cells. Prenatal

Diagnosis. Michelson AM & Orkin SH (1983) Boundaries of gene conversion within the duplicated human c~-globin genes. Concerted evolution by segmental recombination. Journal of Biological Chemistry 258: 15245-15254. Milner PF, Ctegg JB & Weatherall DJ (1971) Haemoglobin H disease due to a unique haemoglobin variant with an elongated c~-ehain. Lancet I: 729-732. Minnich V, Na-Nakom S, Chongchareonsuk S & Kochaseni S (1954) Mediterranean anemia. A study of thiay-two cases in Thailand. Blood 9: 1-23. Modiano G, Morpurgo G, Terrenato Let al (1991) Protection against malaria morbidity: near fixation of the t~-thalassemia gene in a Nepalese population. American Journal of Human Genetics 48: 390-397. Moi P, Cash FE, Liebhaber SA et al (1987) An initiation codon mutation (AUG--~GUG) of the human cq-globin gene. Structural characterization and evidence for a mild thalassemic phenotype. Journal of Clinical hzvestigation 80: 1416-1421. Molchanova TP, Pobedimskaya DD & Huisman THJ (1994) The differences in quantifies of ~2- and ~l-globin gene variants in heterozygotes. British Journal of Haematology 88: 300-306. Molchanova TP, Smetanina NS & Hisman TH (1995) A second, elongated o~2-globinmRNA is present in reticulocytes from normal persons and subjects with terminating codon or poly A mutations. Biochemical and Biophysical Research Communications 214:1184-1190. Morales J, Russell JE & Liebhaber SA (1997) Destabilization of human ct-globin mRNA by translation anti-termination is controlled during erythroid differentiation and is paralleled by phase shortening of the poly(A) tail. Journal of Biological Chemistry 272: 6607-6613. Morl6 F, Lopez B, Henni T et al (1985) ~-Thalassaemia associated with the deletion of two nucleotides at position - 2 and -3 preceding the AUG codon. EMBO Journal 4: 1245-t 250. Morl6 F, Francina A, Ducrocq R et al (1995) A new t~ chain variant Hb Sallanches [or 2 104(GII) Cys--+Tyr] associated with HbH disease in one homozygous patient. British Journal of Haematology 91: 608-611.

88

L. F. BERNINI AND C. L. HARTEVELD

Na-Nakorn S, Wasi P & Suingdumgrong A (1965) Hemoglobin H disease in Thailand: clinical and hematological studies in 138 cases. Israel Journal of Medical Sciences 1: 762-764. Nicholls RD, Higgs DR, Clegg JB et al (1987) cc0-Thalassemia due to recombination between the c~lglobin gene and an AluI repeat. Blood 65: 1434-1438. Olivieri NK Chang LS, Pooh AO et al (1987) An cc-globin gene initiation codon mutation in a black family with HbH disease. Blood 70: 729-732. Oppenheimer S J, Hill AVS, Gibson FD et aI (t987) The interaction of alpha thalassemia with malaria. Transactions of the Royal Society of Tropical Medicine and Hygiene 81: 322-326. Orkin SH, Goff SC & Hechtman RL (1981) Mutation in an intervening sequence splice junction in man. Proceedings of the National Academy of Sciences of the USA 78: 5041-5045. Oron-Kami V, Filon D, Oppenheim A e t al (1997) Three novel mutations causing c~-thalassemia in various Israeli ethnic groups. Blood 88: 153a (abstract). Ottolenghi S, Lanyon W, Paul J e t al (1974) The severe form of oc-thalassemia is caused by a hemoglobin gene deletion. Nature 251: 389-392. Pagnier J, Elion J, Lapoum6roulie C et al (1982) Homozygous deletional c~+ thalassaemia associated with unequal expression of the two remaining ~1 genes (~1 ^ and (~IQ). British Journal of Haematology 52:115-125. *Pasvol G (1996) Malaria and resistance genes--they work in wondrous ways. Lancet 348: 1532-1534. Peschte C, Mavilio t:7, Migliaccio G e t al (1985) Erythropoietic development and hemoglobin switching in human embryos: cellular and molecular aspects. Progress in Clinical and Biological Research 191: 383-396. Pirastu M, Saglio G, Chang JC et al (1984) Initiation codon mutation as a cause of oc thalassemia. Journal of Biological Chemist~. 259: 12315-12317. Van der Plneg L, Konings A, Oort M e t al (1992) 713 thalassaemia: deletion of the y and ~5 genes influences [~-globin expression in man. Cell 38: 265-273. Pobedimskaya DD, Molchanova TP, Streichman S e t al (1994) Compound heterozygosity for two alpha-globin gene defects, Hb Taybe (~ 1; 38 or 39 minus Thr) and a poty A mutation (ec 2: AATAAA--~AATAAG), results in a severe hemolytic anemia. American Journal of Hematology 47: 198-202. Potoge LG & Ravetch JV (1988) Large deletions result from breakage and healing of P. falciparum chromosomes. Cell 55: 869-874. Pootrakul S, Wasi P & Na-Nakorn S {1967) Haemoglobin Bar','s hydrops foetalis in Thailand. Annals of Human Genetics 30:293-311. Pootrakul R Winichagoon P, Fucharoen S e t al (1981) Homozygous haemoglobin Constant Spring: a need for revision of concept. Human Genetics 59: 250-255. Pressley L, Higgs DR & Weathemll DJ (1980) Gene deletions in ec-thalassemia prove that the 5' ~-locus is functional. Proceedings of the National Academy of Sciences ~'the USA 77: 3586-3589. Proudfoot NJ (1986) Transcriptional interference and termination between duplicated o~-globin gene constructs suggests a novel mechanism for gene regulation. Nature 322: 562-565. Rahbar S, Lee C, Fairbanks VF et al (1997) Hb Watts [o~ 74(EF3) or cc 75(EF4)Asp-~0]: a shortened alpha chain variant due to the deletion of three nucleotides in exon 2 of the c¢ 2-globin gene. Hemoglobin 21:321-330. Rigas DA, Kohler RD & Osgood EE (1955) New hemoglobin possessing a higher electrophoretic mobility than normal adult hemoglobin. Science 121: 372-374. Rochette J, Barnetson R, Thein SL et al (1995) Hb Questembert is due to a base substitution (T- +C) in codon 131 of the c~.2-globin gene and has an ~-thalassemia biosynthetic ratio. American Journal of Hematology 48:289-290 (letter). Romao L, Osorio Almeida L, Higgs DR et al (1991) cc-Thalassemia resulting from deletion of regulatory sequences far upstream of the c(-globin structural genes. Blood 78: 1589-1595. Romao L, Cash E Weiss 1 et al (1992) Human o:-globin gene expression is silenced by terminal truncation of chromosome 16p beginning immediately 3' of the ~-globin gene. Human Genetics 89: 323-328. Rtidiger NS, Gregersen N & Kielland Brandt MC (1995) One short well conserved region of Alusequences is included in human gene rearrangements and has homology with prokaryotic chi. Nucleic Acid Research 23: 256-260. Sabath DE, Detter JC & Tait JF (1994) A novel deletion of the entire c~-globin locus causing ccthalassemia-I in a Northern European family. Hematopathology 102: 650-654. Safaya S & Rieder RF (1988) Dysfunctional c¢-globin gene in hemoglobin H disease in blacks. A

~-THALASSAEMIA

89

dinucleotide deletion produces a frameshift and a termination codon. Journal of Biological Chemistry 263: 4328-4332. Safaya S, Trauber DR & Rieder RF (1992) Studies on the in vitro and in vivo expression of a dysfunctional cz-globin gene. American Journal of Hematology 39: 188-193. Sanguansermsri T, Matragoon S, Changloah L et at (1979) Hemoglobin Suan-Dok (cz 2 109 (GI6) Leu replaced by Arg 13 2): an unstable variant associated with c¢-thalassemia. Hemoglobin 3: 161174. Schrier SL, Bunyal~tvej A, Khuhapinant A et al (1997) The unusual pathobiology of hemoglobin Constant Spring red blood cells. Blood 89: 1762-1769. Shakin SH & Liebhaber SA (1986) Translational profiles of alpha 1-, alpha 2-, and beta-globin messenger ribonucleic acids in human reticulocytes. Journal of Clinical Investigation 78: 1125-1129.

Shalmon L, Kirschmann C & Zaizov R (1994) A new deletional ~-thalassemia detected in Yemenites with hemoglobin H disease. American Journal of Hematology 45:201-204. Sharpe JA, Chan Thomas PS, Lida Jet al (1992) Analysis of the human ~-globin upstream regulatory element (HS-40) in transgenic mice. EMBO Journal 11: 4565-4572. Siniscalco M, Bernini LF, Latte B et al ( 1961 ) Favism and thalassemia in Sardinia and their relationship to malaria. Nature 190: 1179-1180. Siniscalco M, Bernini LF, Filippi G et al (1966) Population genetics of haemoglobin variants, thalassaemia and glucose-6-phosphate dehydrogenase deficiency, with particular reference to the malaria hypothesis. Bulletin of the Worm Health Organization 34: 379-393. Smetanina NS, Leonova JY, Levy Net al (1996) The og[3 and cz2/czl-globin mRNA ratios in different forms of cz-thalassemia. Biochimica et Biophysica Acta 1315: 188-192. Snyder LRG (1980) Closely linked alpha-chain hemoglobin loci in peromyscus and other animals: speculations on the evolution of duplicated loci. Evolution 34" 1077. Stamatoyannopoulos G, Constantoulakis P, Brice M e t al (1987) Coexpression of embryonic, fetal and adult globins in erythroid cells of human embryos: relevance to the cell-lineage models of globin switching. Developmental Biology 123: 191-197. Stayton CL, Dabovic B, Gulisano M e t al (1994) Cloning and characterization of a new human Xq l 3 gene, encoding a putative helicase. Human Molecular Genetics 3: 1957-1964. Tamary H, Klinger G, Shalmon L e t al (1997) o~-Thalassemia caused by a 16 bp deletion in the 3' untranslated region of the o¢2-globin gene including the first nucleotide of the poly A signal sequence. Hemoglobin 21: 121-130. Tamkun JW, Deuring R, Scott MP et al (1992) Brahma: a regulator of Drosophila homeotic genes structurally related to the yeast transcriptional activator SNF2/SWI2. Cell 68:561-572. Tang W, Luo HY, Eng B e t al (1993) Immunocytological test to detect adult carriers of (-SEA/) deletional c¢-thalassaemia. Lancet 342:1145-1147. Thein SL, Wallace RB, Pressley Let al (1988) The polyadenylation site mutation in the et-globin gene cluster. Blood 71: 313-319. Traeger-Synodinos J, Kanavakis E, Vrettou C et al (1996) The triplicated alpha-globin gene locus in beta-thalassaemia heterozygotes: clinical, haematological, biosynthetic and molecular studies. British Journal of Haematology 9 5 : 4 6 7 - 4 7 1 . Trent R J, Higgs DR, Clegg JB et al (198I) A new triplicated ~-globin gene in man. British Journal of Haematology 49: 149-I52. Vandenplas S, Higgs DR, Nicholls RD et at (1987) Characterization of a new otO-thalassemia defect in the South African population. British Journal of Haermttology 66: 539-542. Vestri R, Giordano PC & Bernini LF (1983a) Duplication of the hemoglobin cz-chain in sheep: characterization of a new c~-variant present in animals possessing the cd~" and the H~H~chains. Biochemical Genetics 21: 25-35. Vestri R, Giordano PC & Bernini LF (1983b) Different quantitative expression of the hemoglobin orgenes in sheep. Biochemical Genetics 21: 1089-1099. Vestri R, Pieragostini E & Ristaldi M (1994) Expression gradient in sheep ~ot and ~tcz~tglobin gene haplotypes: mRNA levels. Blood 83: 2317-2322. Vickers MA & Higgs DR (1989) A novel deletion of the entire 0t-globin gene cluster in a British individual. British Journal of Haematology 72: 471-473. Villegas A, Calero F, Vickers MA et al (1990) cz-Thalassemia in two Spanish families. European Journal of Haematology 44:109-114. ViUegas A, Sanchez J, Ricard P e t al (1994) Characterization of a new cz-thalassemia- 1 mutation in a Spanish family. Hemoglobin 18: 29-37.

90

L . F . BERNINI AND C. L. HARTEVELD

Vives Corrons JL, Ayala S, Colomer Det ai (1996) ~-Thalassaemia in Spain, first description ofnondeletional mutations and of a new globin variant. Blood 88: 27b (abstract). Vyas P, Vickers MA, Picketts DJ et al (1995) Conservation of position and sequence of a novel, widely expressed gene containing the major human c~-globin regulatory element. Genomics 29: 679-689. Wajcman H, Vasseur C, Blouquit Yet al (1993) Unstable a-chain hemoglobin variants with factitious ]]-thalassemia biosynthetic ratio: Hb Questembert (c~ 131 [H14]Ser---~Pro) and Hb Caen (cx 132[H 15]Val---~Gly).American Journal of Hematology 42: 367-374. Wasi E Na-Nakorn S, Pootrakul Set al (1969) Alpha- and beta-thalassemia in Thailand. Annals of the New York Academy of Sciences 165: 60-82. Waye JS & Eng B (1994) Allelic stability of VNTR locus 3' alpha HVR: linkage disequilibrium with the common alpha-thalx~saemia-I deletion of South-East Asia (-SEA). Human Heredity 44: 6t-67. Waye JS, Eng B & Chui DHK (1992) Identification of an extensive ~-ct globin gene deletion in a Chinese individual. British Journal of Haematology 80: 378-380. Waye JS, Eng B, Patterson M e t al (1994) Identification of a novel termination codon mutation (TAA---)TAT, Term---rTyr) in the o~2 globin gone of a Laotian girl with hemoglobin H disease. Blood 83:3418-3420 (letter). Waye JS, Eng B, Patterson M e t al (1996) Novel mutation of the a2-globin gene initiation codon (ATG---~A-G) in a Vietnamese girl with HbH disease. Blood 88: 28b (abstract). *Weatherail DJ & Clegg JB (1981) The Thalassaemia Syndromes, 3rd edn. Oxford: Blackwell. Weatherall DJ, Clegg JB & Nanghton M (1965) Globin synthesis in thalassemia: an in vitro study. Nature 208:1061 - 1065. Whitelaw E & Proudfoot NJ (1986) Alpha-thalassemia caused by a poly(A) site mutation reveals that transcriptional termination is linked to 3' end processing in the human alpha 2 globin gene. EMBO Journal 5: 2915-2922. Wilkie AO, Buckle VJ, Harris PC et al (1990a) Clinical features and molecular analysis of the thalassemia/mental retardation syndromes. I. Cases due to deletions involving chromosome band 16p 13.3. American Journal of Human Genetics 46:1112-1126. Wilkie AOM, Lamb J, Harris PC et al (1990b) A truncated human chromosome I6 associated with ct thalassaemia is stabilized by addition of telomeric repeat (TTAGGG)n. Nature 346: 868-871. Wilkie AO, Zeitlin HC, Lindenbaum RH et al (1990c) Clinical features and molecular analysis of the thalassemia/mental retardation syndromes. II. Cases without detectable abnormality of the c~ globin complex. American Journal of Human Genetics 46:1127-1140. Williams TN, Maitland K, Bennett S e t al (1996a) High incidence of malaria in o~-thalassaemic children. Nature 383: 522-525. Williams TN, Maitland K, Ganczakowski M e t al (1996b) Red blood cell phenotypes in the alpha+ thalassaemias from early childhood to maturity. British Journal of Haematology 95: 266-272. Winston F & Carlson M (1992) Yeast SNF/SWI transcriptional activators and the SPT/SIN chromatin connection. Trends in Genetics 8: 387-391. Yiiregir GT, Aksoy K, (~tiriik MA et al (1992) Hb H disease in a Turkish family resulting from the interaction of a deletional (~-thalassaemia-1 and a newly discovered poly A mutation. British Journal of Haematology 80: 527-532. Zhao JB, Zhao L, Fei YJ et al (1991 ) A novel c~-thalassemia-2 (-2.7-kb) observed in a Chinese patient with Hb H disease. American Journal of Hematology 38: 248-249.