- Email: [email protected]
27-Hydroxycholesterol inhibits neutral sphingomyelinase in cultured human endothelial cells
Life Sciences 75 (2004) 1567 – 1577 www.elsevier.com/locate/lifescie
27-Hydroxycholesterol inhibits neutral sphingomyelinase in cultured human endothelial cells Qi Zhou a, Mark R. Band b, Alvaro Hernandez b, Zonglin L. Liu c, Fred A. Kummerow a,d,e,* a The H.E. Moore Heart Research Foundation, 1208 W. Pennsylvania Avenue, Urbana, IL 61801, USA Functional Genomics Biotechnology Center, 1201 W. Gregory Drive, University of Illinois, Urbana, IL 61801, USA c National Center for Agricultural Utilization Research, 1815 N University Street, USDA-ARS, Peoria, IL 61604, USA d Burnsides Research Laboratory 205, University of Illinois, 1208 W. Pennsylvania Avenue, Urbana, IL 61801, USA e College of Veterinary Medicine, University of Illinois, Urbana, IL 61801, USA b
Received 9 September 2003; accepted 5 March 2004
Abstract To study the effect of 27-hydroxycholesterol (27OHC) on the catabolism of sphingomyelin, we cultured endothelial cells (ECs) from human umbilical veins with 27OHC, then measured activities of acid sphingomyelinase (ASMase) and neutral sphingomyelinase (NSMase) and sphingomyelin consumption by using [14C]sphingomyelin, and determined NSMase mRNA expressions by RT-PCR method. The results indicated that [14C]sphingomyelin accumulated in cells treated with 27OHC, and that the activities of both NSMase and ASMase were inhibited in ECs cultured with 27OHC. To further study the effect of 27OHC on NSMase, we used desipramine, an inhibitor of ASMase, to exclude the possible interference of ASMase’s residual activity at neutral condition. Also, we observed the significant inhibition of NSMase activity by using glutathione, an inhibitor of NSMase, but found no further impact when 27OHC was added later. To determine whether the inhibition of NSMase activity was directly due to the effect of 27OHC, we exposed cell homogenate to 27OHC, and found no inhibitive effect of 27OHC on the activity of NSMase. All of our data confirmed that 27OHC had only an indirect inhibitive effect on NSMase. Our finding that no change of the NSMase mRNA expression by 27OHC indicated that the inhibitive effect of 27OHC on NSMase activity occurred at a post-transcriptional level. We suggest that an altered membrane fluidity caused by 27OHC could be involved in the inhibited activity of NSMase. D 2004 Published by Elsevier Inc. Keywords: 27-hydroxycholesterol; Neutral sphingomyelinase; Sphingomyelin content; Cultured human endothelial cells
* Corresponding author. Burnsides Research Laboratory 205, University of Illinois, 1208 W. Pennsylvania Avenue, Urbana, IL 61801, USA. Tel.: +1-217-333-1806; fax: +1-217-333-7370. E-mail address: [email protected] (F.A. Kummerow). 0024-3205/$ - see front matter D 2004 Published by Elsevier Inc. doi:10.1016/j.lfs.2004.05.004
1568
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
Introduction The presence of oxysterols in human serum and lesions has been linked to the initiation and progression of atherogenesis (Brown and Jessup, 1999; Zhou et al., 2000). The oxysterol:cholesterol ratio in plaque is much higher than that in normal tissues or plasma (Brown and Jessup, 1999). 27Hydroxycholesterol (27OHC) is a major oxysterol in human coronary arteries and in carotid lesions (Vaya et al., 2001). It has been detected in normal human plasma (Kummerow et al., 2001), in human aortic tissue (Brown and Jessup, 1999) and in fatty streaks in atherosclerotic lesion (Garcia-Cruset et al., 2001). The concentration of 27OHC has also been observed to increase with the severity of atherosclerosis (Brown and Jessup, 1999) and it is more abundant in the core than in the cap of advanced lesions (Garcia-Cruset et al., 1999). In a previous study, we found that the plasma from coronary artery bypass grafting (CABG) patients had a higher concentration of 27OHC than that in the plasma from age and sex matched controls (Kummerow et al., 2001). The higher level of 27OHC could, moreover, increase the concentration of sphingomyelin. That is why an increase in sphingomyelin concentration has also been observed not only in the plasma from patients who had coronary artery disease (Jiang et al., 2000), but also in atheromatous aorta and coronary vessels (Kummerow et al., 2001). A phospholipid analysis indicated that the arterial tissue from CABG patients had 48.2% sphingomyelin in its phospholipid fraction compared to 10% in arterial tissue from umbilical cords (Kummerow et al., 2001). The increased sphingomyelin could then result in an accumulation of Ca+ + in arterial vessels, as reported in our previous studies (Fig. 1). We showed that the enhanced sphingomyelin concentration by oxysterols in the phospholipid component of cultured arterial cells cause a cellular calcium accumulation (Zhou et al., 1991; Zhou and Kummerow, 1997). This is because sphingomyelin is specifically located on the exterior of the plasma membrane (van Deenen, 1981) and the negative charge on sphingomyelin is accessible to ionic bonding with Ca+ +. The increased sphingomyelin comes from either an enhancement of sphingomyelin synthesis, or a decrease of sphingomyelin catabolism, or both of them. In previous studies, it has been repeatedly found that oxysterols stimulated sphingomyelin synthesis (Ridgway, 1995; Storey et al., 1998; Zhou and Kummerow, 1997), primarily at the level of ceramide conversion to sphingomyelin (Ridgway, 1995). No report about the effect of 27OHC on sphingomyelin catabolism has been published thus far. Moreover, it has been known that sphingomyelin is hydrolyzed by sphingomyelinase (SMase) in the initial step of the
L
Fig. 1. The relationships among 27-hydroxycholesterol (27OHC), sphingomyelin (SM) synthesis and intracellular Ca+ + concentration (constructed with data published by Zhou and Kummerow, 1997).
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1569
sphingomyelin-catabolic pathway. SMase is classified into two major groups, a lysosomal SMase called acid SMase (ASMase) and a cell membrane-associated Mg+ +-active SMase termed neutral SMase (NSMase) (Stoffel, 1999). NSMase contributes to the catabolism of sphingomyelin to ceramide and phosphocholine (Chatterjee and Ghosh, 1989). NSMase is related not only to the regulation of the concentration of sphingomyelin in the cell membrane, but also to the aggregation of LDL, resulting in plaque formation in atherosclerosis (Chatterjee, 1999). To determine whether 27OHC has an effect on sphingomyelin catabolism, we focused our experiment on the activity of NSMase and quantified mRNA expressions of NSMase. Specifically, this study had two objectives: (1) to discover whether 27OHC has a direct or indirect inhibitive effect on NSMase activity; and (2) to identify whether the inhibition occurs at a level of transcription or post-translation.
Materials and methods Materials [N-methyl-14C]sphingomyelin was obtained from Amersham Biosciences Corp. 27OHC, purchased from Research Plus Inc., was dissolved in absolute ethanol at a concentration of 10 mg/mL, stored at –20 jC and diluted in fetal bovine serum (FBS) immediately before use. Other reagents were purchased from Sigma-Aldrich Inc. Cell culture Endothelial cells (ECs) from human umbilical veins were obtained from American Type Culture Collection. Cells were cultured in Eagle’s minimum essential medium (MEM) supplemented with 10% FBS, 0.05 mg/mL endothelial cell growth supplement and 0.1 mg/mL heparin in an incubator with 5% CO2 at 37 jC. The cells were cultured in a medium containing 27OHC after reaching about 80% confluence. Control cells were incubated in the same medium containing 0.1% ethanol. Sphingomyelinase activity It has been reported that the total 27OHC in human serum normally ranges from 9.2 to 25.6 Ag/100 mL (Javitt et al., 1981). In in vitro studies, however, the 27OHC concentrations are commonly used at higher levels (Smith and Johnson, 1989). Since this experiment was performed in short incubating periods, the 27OHC concentrations used in this study were also above the normal physiological range. The cells were cultured with 27OHC (1) at a concentration of 10 Ag/mL for 6, 24 or 48 hours and (2) at 1, 2.5, 5, 7.5 and 10 Ag/mL for 24 hours. The cells were scraped from the flasks, harvested by centrifugation, re-suspended in hypotonic buffer containing 1 mM NaCO3, 2 mM CaCl2, 1 mM NaHSO3, 1 mM benzamidine and 0.1 mM phenylmethylsulfonyl fluoride. After the cells were sonicated for 20 seconds in ice water, the resultant homogenate (20 Ag of protein) was used for the assays of activity of ASMase or NSMase (Murate et al., 2002). Enzymatic activity of SMase was measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. The assay mixture for ASMase contained 0.1 mM acetate buffer, pH 5.8, 1 mM EDTA, 22 AM [N-methyl-14C]sphingomyelin (20,000 cpm, adjusted by cold sphingomyelin), 0.05% Triton X-100, 1.2 M KCl, and 20 Ag protein of
1570
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
cell homogenate in a total volume of 50 AL. The assay mixture for NSMase contained 0.1 M Tris/HCl, pH 7.0, 1 mM dithiothreitol, 10 mM MgCl2, 0.05% Triton X-100, 1.2 M KCl, 22 AM [Nmethyl-14C]sphingomyelin (20,000 cpm), and 20 Ag protein of cell homogenate in a total volume of 50 AL. After incubation for 30 minutes at 37 jC, reactions were terminated by the addition of 4 volumes of chloroform/methanol (2:1, v/v). The radioactivity of phosphocholine recovered from the upper aqueous layer was determined in a liquid scintillation counter. NSMase activity in the presence of 27OHC at a concentration of 10 Ag/mL was also measured under the following three conditions: (1) After the cells were cultured with 27OHC for 24 hours, 5 AM desipramine, an inhibitor of ASMase (Carignani and Corsi, 2002) was added into the medium. The cells were cultured with both 27OHC and desipramine for another 15 minutes. (2) The cells were cultured with 3 mM glutathione (GSH), an inhibitor of NSMase (Liu and Hannun, 1997), for 1 hour and then with/without 27OHC for another 24 hours. And (3) 20 Ag of protein from non-treated cell homogenate was cultured with 27OHC at 37 jC in a water bath for up to 5 hours. mRNA expression of NSMase Total RNA of NSMase was isolated by using RNeasy (Qiagen) and quantified by spectrophotometry. First-Strand of cDNA was synthesized by using Superscript II (Invitrogen). NSMase gene was amplified by Real-time quantitative PCR (RT-PCR). Primers for NSMase were designed from the published sequence of human NSMase (AJ222801) (Tomiuk et al., 1998). The sense and antisense primers (5V-3V) used were: GGCTGCTGCCTGCTGAA and GCCCTTCAAGTCCCGAGTTT, respectively. Glyceraldehyde-phosphate dehydrogenase (GAPDH) amplified using primers GAAGGTGAAGGTCGGAGTC and GAAGATGGTGATGGGATTTC was used as a control for normalization. RT-PCR was performed in an ABI PRISM 7700 Sequence Detection System instrument (Applied Biosystems) by using Sybr Green PCR core reagents (Applied Biosystems). The single 68 bp amplicon for NSMase was verified by both agarose gel electrophoresis and dissociation curve following the manufacturer’s protocol (Applied Biosystems). Relative quantification of the NSMase gene expression was determined by the difference between the cycle threshold (CT) of the NSMase gene in the control (A) and 27OHC-treated (B) samples, using the 2 D (CTA –CTB) formula, according to the manufacturer’s protocol (Applied Biosystems). [N-methyl-14C]Sphingomyelin consumption The effect of 27OHC on sphingomyelin consumption was studied according to the method (Maziere et al., 1983) with some modifications. In brief, cells used for the analysis of lipids were cultured with 22 AM [N-methyl-14C]sphingomyelin (35,000 dpm, adjusted with unlabeled sphingomyelin) for 24 hours at 37 jC. After the removal of the radioactive medium the monolayers were washed three times with MEM, cultured with 27OHC at a level of 10 Ag/mL for another 24 hours at 37 jC, harvested by brief trypsin treatment and re-suspended in 1 mL of methanol, and sonicated twice for 30 seconds on ice. Portions of the homogenous suspension were taken for determination of protein concentration. Total lipids were extracted from the remaining homogenate by addition of 15 mL of chloroform/methanol (2:1, v/v). Separation of sphingomyelin was accomplished by TLC on silica gel G plates using chloroform/methanol/glacial acetic acid/H2O (25:15:4:2, v/v/v/v) (Skipski et al., 1964). The spot of sphingomyelin on the plates was collected and its radioactivity counted in a scintillation counter. The non-specific activity obtained from the silica gel blank spaces was subtracted from the radioactivity.
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1571
Statistical analysis Data shown in figures were subjected to statistical analysis by ONE WAY ANOVA and StudentNewman-Keuls (SNK) method. Student’s t-test was used to detect significant differences of DCT and sphingomyelin consumption in the cells between two groups. A P value of less than 0.05 was considered significant. All data are presented as the mean F SE.
Results
N
Both the activities of ASMase (Fig. 2A) and NSMase (Fig. 2B) in ECs cultured with 27OHC were decreased significantly after 24 hours, compared to the control cells. When the effect of
Fig. 2. The effect of 27-hydroxycholesterol (27OHC) on activities of acid and neutral sphingomyelinase (ASMase and NSMase) in cultured endothelial cells. The cells were cultured in the presence of 27OHC (10 Ag/mL) for 6, 24 or 48 hours. The cells were then harvested and sonicated in a hypotonic buffer. The activities of ASMase (A) and NSMase (B) were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values at the same incubation periods with a letter are statistically different at level of P < 0.05, compared with control.
1572
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
different concentrations (1, 2.5, 5, 7.5 and 10 Ag/mL) of 27OHC on the enzyme activities was measured after 24 hours of the incubation period, we found ASMase was more sensitive than NSMase to 27OHC (Fig. 3). That is, 27OHC at 7.5 Ag/mL inhibited significantly the activity of ASMase (Fig. 3A), while 10 Ag/mL of 27OHC was needed to significantly reduce the activity of NSMase (Fig. 3B). The activity of ASMase in the ECs was found in this study to be much higher than that of NSMase. In order to exclude the possible interference of the residual activity of ASMase at neutral condition, we used desipramine to inhibit the activity of ASMase when the activity of the NSMase was measured. We found 50 AM of desipramine significantly reduced the activity of ASMase from 361.24 to 156.11 nM/Ag protein after 15 minutes of treatment. The result confirmed that 50 AM desipramine had the ability to inhibit significantly the activity of ASMase. However, desipramine at the same dose had no effect on NSMase, because NSMase activity was not further affected by desipramine after the cells were pretreated with/without 27OHC (Fig. 4). We also used GSH, an inhibitor of NSMase, to confirm the inhibitive effect of 27OHC on NSMase. When the cells were cultured with GSH, NSMase activity was significantly reduced (Fig. 5). The half of the cells exposed to GSH was then cultured with 27OHC, the activity of NSMase was not further inhibited by 27OHC, compared with the data from the cells only treated with GSH. These data indicated that 27OHC did have an inhibiting effect on NSMase in cultured ECs. To determine whether 27OHC had a direct or indirect effect on NSMase, we used the homogenate from normal ECs as an enzyme sample. No change of activity of NSMase was detected until 5 hours after the cell homogenate was incubated with 27OHC (Fig. 6). No significant difference of NSMase mRNA expression in 27OHC-treated cells was found, compared to the control cells.
Fig. 3. The effect of 27-hydroxycholesterol (27OHC) on activities of acid and neutral sphingomyelinase (ASMase and NSMase) in cultured endothelial cells. The cells were cultured in the medium containing 27OHC at 1, 2.5, 5, 7.5 and 10 Ag/mL for 24 hours. After the harvested cells were sonicated in a hypotonic buffer, the activities of ASMase (A) and NSMase (B) were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1573
Fig. 4. The effects of desipramine and 27-hydroxycholesterol (27OHC) on activity of neutral sphingomyelinase (NSMase) in cultured endothelial cells. The cells cultured in flasks were treated with 27OHC (10 Ag/mL) for 24 hours. Desipramine (5 AM) was then added into each half of the flasks containing control or 27OHC treated cells. The incubation was continued for 15 minutes. The cells were harvested and sonicated in a hypotonic buffer. The enzyme activities were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
The effect of 27OHC on cellular [N-methyl-14C]sphingomyelin consumption showed an increase in labeled sphingomyelin content in the cells after a 24-hour incubation with 27OHC. The cells accumulated 2658 F 194 DPM/mg protein of [N-methyl-14C]sphingomyelin, based on an average from eight separate experiments. After the cells were incubated with 27OHC, the accumulation of
Fig. 5. The effects of glutathione (GSH) and 27-hydroxycholesterol (27OHC) on activity of neutral sphingomyelinase (NSMase) in cultured endothelial cells. After the cells were cultured with/without GSH (3 mM) for 1 hour, 27OHC (10 Ag/mL) was added into each half of the flasks with or without GSH treatment. The incubation was continued for another 24 hours, the cells were then harvested and sonicated in a hypotonic buffer. The enzyme activities were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
1574
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
Fig. 6. The effect of 27-hydroxycholesterol (27OHC) on activity of neutral sphingomyelinase (NSMase) in cell homogenate. The proteins of cell homogenate from normal endothelial cells were exposed to 27OHC (10 Ag/mL) at 37 jC from 5 minutes to 5 hours. The enzyme activities in the cell homogenate were then measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
[N-methyl-14C]sphingomyelin significantly increased to 4173 F 420 DPM/mg protein, which is a 64% enhancement above the control.
Discussion The data from previous studies (Ridgway, 1995; Zhou and Kummerow, 1997) showed that the increase in cellular sphingomyelin content caused by oxysterols was due to the stimulation of sphingomyelin synthesis. The present study demonstrated that the higher accumulation of sphingomyelin in the cells treated with 27OHC also resulted from the inhibition of sphingomyelin catabolism, based on our findings that both ASMase and NSMase were inhibited by 27OHC. We focused this study mainly on NSMase for the following reasons: NSMase could regulate plasma concentration of sphingomyelin (Ridgway, 2000), and NSMase activity was changed in atherosclerotic plaque (Chatterjee, 1999). On the other hand, ASMase is a lysosomal enzyme. In humans, a deficiency of this enzymatic activity leads to the type A and B forms of Niemann-Pick disease (Ridgway, 2000), which was beyond the scope of our current study. In this study, we used GHS, an inhibitor of NSMase, and desipramine, an inhibitor of ASMase, to determine whether 27OHC would have an inhibitive effect on NSMase. We found that the NSMase activity was not attenuated by 27OHC after preincubating the cells with GSH. Desipramine, on the other hand, did not affect the NSMase activity at neutral condition. We conclude, therefore, that 27OHC had an inhibitory effect on the activity of NSMase itself. A previous study has shown that oxidized LDL taken up by macrophage inhibited lysosomal SMase. The inhibited lysosomal SMase, however, was not found in macrophage containing acetylated LDL because 7-ketocholesterol, an oxysterol, was present only in oxidized LDL, not in acetylated LDL (Maor et al., 1995). The effects of oxysterols on NSMase observed by different laboratories were inconsistent. For example, in human aortic smooth muscle cells, oxidized LDL was shown to have an activating effect
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1575
on NSMase (Chatterjee, 1999). The incorporation of 22R-hydroxycholesterol into the bovine erythrocyte membranes enhanced remarkably the degradation of sphingomyelin in erythrocyte membranes by the action of SMase from Bacillus cereus (Tomita et al., 1992). The structures of oxysterols might be responsible for these discrepancies (Bates et al., 1983; Neyses et al., 1985; Smith and Johnson, 1989; Tomita et al., 1992). In human erythrocytes different oxysterols had totally different effects on calcium influx (Neyses et al., 1985). Some of them stimulated calcium influx and others inhibited the influx (Neyses et al., 1985). The contradictory effects of oxysterols were also shown in the finding that 22hydroxycholesterol could block the stimulation of esterification of cholesterol by 25-hydroxycholesterol (Bates et al., 1983). The inhibition of NSMase activity by 27OHC was detected only in the cultured cells, not in the cell homogenate, indicating that the inhibitory effect of 27OHC on NSMase was indirect. The mechanisms by which 27OHC inhibited the NSMase have not been elucidated, although Maor et al. (1995) suggested that oxysterols might induce allosteric changes in sphingomyelin and the changes could then decrease its recognition of and/or affinity for the SMase. The data from our use of cell homogenate, however, did not support that suggestion. We did not find an attenuated activity of NSMase by 27OHC despite the fact that sphingomyelin did exist in the cell homogenate. There are other factors, including the inserted 27OHC into cell membrane, reduced cholesterol content in the membrane by 27OHC, and the modified fatty acids by 27OHC, in addition to allosteric changes in sphingomyelin, that may be responsible for the attenuated activity of NSMase. All of the factors mentioned above have been found to affect membrane fluidity, and the deterioration of membrane fluidity could result in a change of activity of membranebound enzymes, NSMase. Previous studies that would support our findings include the following: 27OHC could insert itself into the cell membrane (Kou et al., 1991; Zhou et al., 1995). The inserted oxysterols were so close to the lipid bilayer/water interface that they had a very strong effect on the lipid bilayer packing (Szostek et al., 1991). The inserted oxysterols could also expand the membrane interior through its polar group on the isoprenoid side chain (Szostek et al., 1991) and would change the surface shape of several cells (Yachnin et al., 1979). All of these changes of the cell membrane caused by oxysterols may decrease fluidity of the cell membrane and affect membrane-bound proteins (Peng and Morin, 1991), including NSMase. 27OHC could reduce cholesterol in the membrane through inhibition of LDL uptake and reduction of synthesis, resulting in a decrease in the molar ratio of cholesterol to phospholipid in the membrane (Peng and Morin, 1991). The fluidity of the plasma membranes was largely determined by its cholesterol content (Cooper, 1978). A change in membrane fluidity may affect the positioning and function of membrane-bound protein. A strong correlation was found between oxysterol inhibited Na+/K+ ATPase and 5V-nucleotidase, and their decreasing effect on cholesterol synthesis (Peng and Morin, 1987). Fatty acyl modification could influence the degree of ordering and motion in the hydrocarbon core of the lipid bilayer, a property that is commonly referred to as membrane fluidity (Spector and Yorek, 1985). Oxysterol could increase immobilization of fatty acyl chains within the cell membrane (Yachnin et al., 1979), resulting in changes of the membrane-associated functions and properties.
Conclusion Since no significant alteration of NSMase mRNA expression was found, 27OHC regulation of the NSMase activity in cultured cells might occur at a post-transcriptional level. That is, the inhibition of
1576
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
NSMase activity by 27OHC might come from an alteration of the cell membrane fluidity, as a consequence of changes in membrane lipid composition.
Acknowledgements We acknowledge the support of the Wallace Research Foundation, Cedar Rapids, Iowa.
References Bates, S.R., Jett, C.M., Miller, J.E., 1983. Prevention of the hyperlipidemic serum or LDL-induced cellular cholesterol ester accumulation by 22-hydroxycholesterol and its analogue. Biochimica et Biophysical acta 735, 281 – 293. Brown, A.J., Jessup, W., 1999. Oxysterols and atherosclerosis. Atherosclerosis 142, 1 – 28. Carignani, C., Corsi, M., 2002. Inhibition of SK3 channels in the TE671 human medulloblastoma cell line by desipramine and imipramine. European Journal of Pharmacology 448, 139 – 142. Chatterjee, S., Ghosh, N., 1989. Neutral sphingomyelinase from human urine. Purification and preparation of monospecific antibodies. Journal of Biological Chemistry 264, 12554 – 12600. Chatterjee, S., 1999. Neutral sphingomyelinase: past, present and future. Chemistry and Physics of Lipids 102, 79 – 96. Cooper, R.A., 1978. Influence of increased membrane cholesterol on membrane fluidity and cell function in human red blood cell. Journal Supramolecular Structure 8, 413 – 430. Garcia-Cruset, S., Carpenter, K.L.H., Guardiol, F., Stein, B.K., Mitchinson, M.J., 1999. Oxysterols in cap and core of human advanced atherosclerotic lesions. Free Radical Research 30, 341 – 350. Garcia-Cruset, S., Carpenter, K.L.H., Guardiol, F., Stein, B.K., Mitchinson, M.J., 2001. Oxysterol profiles of normal human arteries, fatty streaks and advanced lesions. Free Radical Research 35, 31 – 41. Javitt, N.B., Kok, E., Burstein, S., Cohen, B., Kutscher, J., 1981. 26-Hydroxycholesterol identification and quantitation in human serum. Journal of Biological Chemistry 256, 12644 – 12646. Jiang, X.C., Paultre, F., Pearson, T.A., Reed, R.G., Francis, C.K., Lin, M., Berglund, L., Tall, A.R., 2000. Plasma sphingomyelin level as a risk factor for coronary artery disease. Arteriosclerosis, Thrombosis and Vascular Biology 20, 2614 – 2618. Kou, I.-L., Pikul, J., Kummerow, F.A., 1991. Influence of 26-hydroxycholesterol on the composition and function of gelfiltered platelets. Journal of the American College of Nutrition 10, 114 – 122. Kummerow, F.A., Cook, L.S., Wasowicz, E., Jelen, H., 2001. Changes in the phospholipid composition of the arterial cell can result in severe atherosclerotic lesions. Journal of Nutritional Biochemistry 12, 602 – 607. Liu, B., Hannun, Y.A., 1997. Inhibition of the neutral magnesium-dependent sphingomyelinase by glutathione. Journal of Biological Chemistry 272, 16281 – 16287. Maor, I., Mandel, H., Aviram, M., 1995. Macrophage uptake of oxidized LDL inhibits lysosomal sphingomyelinase, thus causing the accumulation of unesterified cholesterol-sphingomyelin-rich particles in the lysosomes. A possible role for 7ketocholesterol. Arteriosclerosis, Thrombosis and Vascular Biology 15, 1378 – 1387. Maziere, J.C., Maziere, C., Mora, L., Gallie, F., Polonovski, J., 1983. Cholesterol and 7-dehydrosterol inhibit the in situ degradation of sphingomyelin by cultured human fibroblasts. Biochemical and Biophysical Research Communications 112, 860 – 865. Murate, T., Suzuki, M., Hattori, M., Takagi, A., Kojima, T., Tanizawa, T., Asano, H., Hotta, T., Saito, H., Yoshida, S., TamiyaKoizumi, K., 2002. Up-regulation of acid sphingomyelinase during retinoic acid-induced myeloid differentiation of NB4, a human acute promyelocytic leukemia cell line. Journal of Biological Chemistry 277, 9936 – 9943. Neyses, L., Locher, R., Stimpel, M., Streuli, R., Vetter, W., 1985. Stereospecific modulation of the calcium channel in human erythrocytes by cholesterol and its oxidized derivatives. Biochemical Journal 227, 105 – 112. Peng, S.K., Morin, R.J., 1987. Effects on membrane function by cholesterol oxidation derivatives in cultured aortic smooth muscle cells. Artery 14, 85 – 99. Peng, S.K., Morin, R.J., 1991. Effects of cholesterol oxides on cell membranes. In: Peng, S.K., Morin, R.J. (Eds.), Biological Effects of Cholesterol Oxides. CRC Press Inc., Boca Raton, FL, pp. 125 – 146.
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1577
Ridgway, N.D., 1995. 25-Hydroxycholesterol stimulates sphingomyelin synthesis in Chinese hamster ovary cells. Journal of Lipid Research 36, 1345 – 1358. Ridgway, N.D., 2000. Interactions between metabolism and intracellular distribution of cholesterol and sphingomyelin. Biochimica et Biophysical acta 1484, 129 – 141. Skipski, V.P., Peterson, R.F., Barclay, M., 1964. Quantitative analysis of phospholipids by thin-layer chromatography. Biochemical Journal 90, 374 – 378. Smith, L.L., Johnson, B.H., 1989. Biological activities of oxysterols. Free Radical Biology and Medicine 7, 285 – 332. Stoffel, W., 1999. Functional analysis of acid and neutral sphingomyelinases in vitro and in vivo. Chemistry and Physics of Lipids 102, 107 – 121. Storey, M.K., Byers, D.M., Cook, H.W., Ridgway, N.D., 1998. Cholesterol regulates oxysterol binding protein phosphorylation and Golgi localization in Chinese hamster ovary cells: correlation with stimulation of sphingomyelin synthesis by 25hydroxycholesterol. Biochemical Journal 336, 247 – 256. Spector, A.A., Yorek, M.A., 1985. Membrane lipid composition and cellular function. Journal of Lipid Research 26, 1015 – 1035. Szostek, R., Kucuk, O., Lis, L.J., Tracy, D., Mata, R., Dey, T., Kauffman, J.W., Yachnin, S., Westerman, M.P., 1991. Effect of inserted oxysterols on phospholipid packing in normal and sickle red blood cell membranes. Biochemical and Biophysical Research Communications 180, 730 – 734. Tomita, M., Togami, J., Fujimoto, Y., Ikekawa, N., Taguchi, R., Ikezawa, H., 1992. Effect of 22R-hydroxycholesterol on the action of sphingomyelinase from Bacillus cereus toward bovine erythrocytes. Toxicon. 30, 801 – 813. Tomiuk, S., Hofmann, K., Nix, M., Zumbansen, M., Stoffel, W., 1998. Cloned mammalian neutral sphingomyelinase: functions in sphingolipid signaling? Cell Biology 95, 3638 – 3643. Vaya, J., Aviram, M., Mahmood, S., Hayek, T., Grenadir, E., Hoffman, A., Milo, S., 2001. Selective distribution of oxysterols in atherosclerotic lesions and human plasma lipoproteins. Free Radical Research 34, 485 – 497. van Deenen, L.L.M., 1981. Topology and dynamics of phospholipids in membranes. FEBS Letters 123, 3 – 15. Yachnin, S., Streuli, R.A., Gordon, L.I., Hsu, R.C., 1979. Alteration of peripheral blood cell membrane function and morphology by oxygenated sterols: a membrane insertion hypothesis. Current Topics in Hematology 2, 245 – 271. Zhou, Q., Jimi, S., Smith, T.L., Kummerow, F.A., 1991. The effect of 25-hydroxycholesterol on accumulation of intracellular calcium. Cell Calcium 12, 467 – 478. Zhou, Q., Wasowicz, E., Kummerow, F.A., 1995. Failure of vitamin E to protect cultured human arterial smooth muscle cells against oxysterol-induced cytotoxicity. Journal of the American College of Nutrition 14, 169 – 175. Zhou, Q., Kummerow, F.A., 1997. Effect of 27-hydroxycholesterol on cellular sphingomyelin synthesis and Ca+ + content in cultured smooth muscle cells. Biomedical and Environmental Sciences 10, 369 – 376. Zhou, Q., Wasowicz, E., Handler, B., Fleischer, L., Kummerow, F.A., 2000. An excess concentration of oxysterols in the plasma is cytotoxic to cultured endothelial cells. Atherosclerosis 149, 191 – 197.
27-Hydroxycholesterol inhibits neutral sphingomyelinase in cultured human endothelial cells Qi Zhou a, Mark R. Band b, Alvaro Hernandez b, Zonglin L. Liu c, Fred A. Kummerow a,d,e,* a The H.E. Moore Heart Research Foundation, 1208 W. Pennsylvania Avenue, Urbana, IL 61801, USA Functional Genomics Biotechnology Center, 1201 W. Gregory Drive, University of Illinois, Urbana, IL 61801, USA c National Center for Agricultural Utilization Research, 1815 N University Street, USDA-ARS, Peoria, IL 61604, USA d Burnsides Research Laboratory 205, University of Illinois, 1208 W. Pennsylvania Avenue, Urbana, IL 61801, USA e College of Veterinary Medicine, University of Illinois, Urbana, IL 61801, USA b
Received 9 September 2003; accepted 5 March 2004
Abstract To study the effect of 27-hydroxycholesterol (27OHC) on the catabolism of sphingomyelin, we cultured endothelial cells (ECs) from human umbilical veins with 27OHC, then measured activities of acid sphingomyelinase (ASMase) and neutral sphingomyelinase (NSMase) and sphingomyelin consumption by using [14C]sphingomyelin, and determined NSMase mRNA expressions by RT-PCR method. The results indicated that [14C]sphingomyelin accumulated in cells treated with 27OHC, and that the activities of both NSMase and ASMase were inhibited in ECs cultured with 27OHC. To further study the effect of 27OHC on NSMase, we used desipramine, an inhibitor of ASMase, to exclude the possible interference of ASMase’s residual activity at neutral condition. Also, we observed the significant inhibition of NSMase activity by using glutathione, an inhibitor of NSMase, but found no further impact when 27OHC was added later. To determine whether the inhibition of NSMase activity was directly due to the effect of 27OHC, we exposed cell homogenate to 27OHC, and found no inhibitive effect of 27OHC on the activity of NSMase. All of our data confirmed that 27OHC had only an indirect inhibitive effect on NSMase. Our finding that no change of the NSMase mRNA expression by 27OHC indicated that the inhibitive effect of 27OHC on NSMase activity occurred at a post-transcriptional level. We suggest that an altered membrane fluidity caused by 27OHC could be involved in the inhibited activity of NSMase. D 2004 Published by Elsevier Inc. Keywords: 27-hydroxycholesterol; Neutral sphingomyelinase; Sphingomyelin content; Cultured human endothelial cells
* Corresponding author. Burnsides Research Laboratory 205, University of Illinois, 1208 W. Pennsylvania Avenue, Urbana, IL 61801, USA. Tel.: +1-217-333-1806; fax: +1-217-333-7370. E-mail address: [email protected] (F.A. Kummerow). 0024-3205/$ - see front matter D 2004 Published by Elsevier Inc. doi:10.1016/j.lfs.2004.05.004
1568
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
Introduction The presence of oxysterols in human serum and lesions has been linked to the initiation and progression of atherogenesis (Brown and Jessup, 1999; Zhou et al., 2000). The oxysterol:cholesterol ratio in plaque is much higher than that in normal tissues or plasma (Brown and Jessup, 1999). 27Hydroxycholesterol (27OHC) is a major oxysterol in human coronary arteries and in carotid lesions (Vaya et al., 2001). It has been detected in normal human plasma (Kummerow et al., 2001), in human aortic tissue (Brown and Jessup, 1999) and in fatty streaks in atherosclerotic lesion (Garcia-Cruset et al., 2001). The concentration of 27OHC has also been observed to increase with the severity of atherosclerosis (Brown and Jessup, 1999) and it is more abundant in the core than in the cap of advanced lesions (Garcia-Cruset et al., 1999). In a previous study, we found that the plasma from coronary artery bypass grafting (CABG) patients had a higher concentration of 27OHC than that in the plasma from age and sex matched controls (Kummerow et al., 2001). The higher level of 27OHC could, moreover, increase the concentration of sphingomyelin. That is why an increase in sphingomyelin concentration has also been observed not only in the plasma from patients who had coronary artery disease (Jiang et al., 2000), but also in atheromatous aorta and coronary vessels (Kummerow et al., 2001). A phospholipid analysis indicated that the arterial tissue from CABG patients had 48.2% sphingomyelin in its phospholipid fraction compared to 10% in arterial tissue from umbilical cords (Kummerow et al., 2001). The increased sphingomyelin could then result in an accumulation of Ca+ + in arterial vessels, as reported in our previous studies (Fig. 1). We showed that the enhanced sphingomyelin concentration by oxysterols in the phospholipid component of cultured arterial cells cause a cellular calcium accumulation (Zhou et al., 1991; Zhou and Kummerow, 1997). This is because sphingomyelin is specifically located on the exterior of the plasma membrane (van Deenen, 1981) and the negative charge on sphingomyelin is accessible to ionic bonding with Ca+ +. The increased sphingomyelin comes from either an enhancement of sphingomyelin synthesis, or a decrease of sphingomyelin catabolism, or both of them. In previous studies, it has been repeatedly found that oxysterols stimulated sphingomyelin synthesis (Ridgway, 1995; Storey et al., 1998; Zhou and Kummerow, 1997), primarily at the level of ceramide conversion to sphingomyelin (Ridgway, 1995). No report about the effect of 27OHC on sphingomyelin catabolism has been published thus far. Moreover, it has been known that sphingomyelin is hydrolyzed by sphingomyelinase (SMase) in the initial step of the
L
Fig. 1. The relationships among 27-hydroxycholesterol (27OHC), sphingomyelin (SM) synthesis and intracellular Ca+ + concentration (constructed with data published by Zhou and Kummerow, 1997).
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1569
sphingomyelin-catabolic pathway. SMase is classified into two major groups, a lysosomal SMase called acid SMase (ASMase) and a cell membrane-associated Mg+ +-active SMase termed neutral SMase (NSMase) (Stoffel, 1999). NSMase contributes to the catabolism of sphingomyelin to ceramide and phosphocholine (Chatterjee and Ghosh, 1989). NSMase is related not only to the regulation of the concentration of sphingomyelin in the cell membrane, but also to the aggregation of LDL, resulting in plaque formation in atherosclerosis (Chatterjee, 1999). To determine whether 27OHC has an effect on sphingomyelin catabolism, we focused our experiment on the activity of NSMase and quantified mRNA expressions of NSMase. Specifically, this study had two objectives: (1) to discover whether 27OHC has a direct or indirect inhibitive effect on NSMase activity; and (2) to identify whether the inhibition occurs at a level of transcription or post-translation.
Materials and methods Materials [N-methyl-14C]sphingomyelin was obtained from Amersham Biosciences Corp. 27OHC, purchased from Research Plus Inc., was dissolved in absolute ethanol at a concentration of 10 mg/mL, stored at –20 jC and diluted in fetal bovine serum (FBS) immediately before use. Other reagents were purchased from Sigma-Aldrich Inc. Cell culture Endothelial cells (ECs) from human umbilical veins were obtained from American Type Culture Collection. Cells were cultured in Eagle’s minimum essential medium (MEM) supplemented with 10% FBS, 0.05 mg/mL endothelial cell growth supplement and 0.1 mg/mL heparin in an incubator with 5% CO2 at 37 jC. The cells were cultured in a medium containing 27OHC after reaching about 80% confluence. Control cells were incubated in the same medium containing 0.1% ethanol. Sphingomyelinase activity It has been reported that the total 27OHC in human serum normally ranges from 9.2 to 25.6 Ag/100 mL (Javitt et al., 1981). In in vitro studies, however, the 27OHC concentrations are commonly used at higher levels (Smith and Johnson, 1989). Since this experiment was performed in short incubating periods, the 27OHC concentrations used in this study were also above the normal physiological range. The cells were cultured with 27OHC (1) at a concentration of 10 Ag/mL for 6, 24 or 48 hours and (2) at 1, 2.5, 5, 7.5 and 10 Ag/mL for 24 hours. The cells were scraped from the flasks, harvested by centrifugation, re-suspended in hypotonic buffer containing 1 mM NaCO3, 2 mM CaCl2, 1 mM NaHSO3, 1 mM benzamidine and 0.1 mM phenylmethylsulfonyl fluoride. After the cells were sonicated for 20 seconds in ice water, the resultant homogenate (20 Ag of protein) was used for the assays of activity of ASMase or NSMase (Murate et al., 2002). Enzymatic activity of SMase was measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. The assay mixture for ASMase contained 0.1 mM acetate buffer, pH 5.8, 1 mM EDTA, 22 AM [N-methyl-14C]sphingomyelin (20,000 cpm, adjusted by cold sphingomyelin), 0.05% Triton X-100, 1.2 M KCl, and 20 Ag protein of
1570
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
cell homogenate in a total volume of 50 AL. The assay mixture for NSMase contained 0.1 M Tris/HCl, pH 7.0, 1 mM dithiothreitol, 10 mM MgCl2, 0.05% Triton X-100, 1.2 M KCl, 22 AM [Nmethyl-14C]sphingomyelin (20,000 cpm), and 20 Ag protein of cell homogenate in a total volume of 50 AL. After incubation for 30 minutes at 37 jC, reactions were terminated by the addition of 4 volumes of chloroform/methanol (2:1, v/v). The radioactivity of phosphocholine recovered from the upper aqueous layer was determined in a liquid scintillation counter. NSMase activity in the presence of 27OHC at a concentration of 10 Ag/mL was also measured under the following three conditions: (1) After the cells were cultured with 27OHC for 24 hours, 5 AM desipramine, an inhibitor of ASMase (Carignani and Corsi, 2002) was added into the medium. The cells were cultured with both 27OHC and desipramine for another 15 minutes. (2) The cells were cultured with 3 mM glutathione (GSH), an inhibitor of NSMase (Liu and Hannun, 1997), for 1 hour and then with/without 27OHC for another 24 hours. And (3) 20 Ag of protein from non-treated cell homogenate was cultured with 27OHC at 37 jC in a water bath for up to 5 hours. mRNA expression of NSMase Total RNA of NSMase was isolated by using RNeasy (Qiagen) and quantified by spectrophotometry. First-Strand of cDNA was synthesized by using Superscript II (Invitrogen). NSMase gene was amplified by Real-time quantitative PCR (RT-PCR). Primers for NSMase were designed from the published sequence of human NSMase (AJ222801) (Tomiuk et al., 1998). The sense and antisense primers (5V-3V) used were: GGCTGCTGCCTGCTGAA and GCCCTTCAAGTCCCGAGTTT, respectively. Glyceraldehyde-phosphate dehydrogenase (GAPDH) amplified using primers GAAGGTGAAGGTCGGAGTC and GAAGATGGTGATGGGATTTC was used as a control for normalization. RT-PCR was performed in an ABI PRISM 7700 Sequence Detection System instrument (Applied Biosystems) by using Sybr Green PCR core reagents (Applied Biosystems). The single 68 bp amplicon for NSMase was verified by both agarose gel electrophoresis and dissociation curve following the manufacturer’s protocol (Applied Biosystems). Relative quantification of the NSMase gene expression was determined by the difference between the cycle threshold (CT) of the NSMase gene in the control (A) and 27OHC-treated (B) samples, using the 2 D (CTA –CTB) formula, according to the manufacturer’s protocol (Applied Biosystems). [N-methyl-14C]Sphingomyelin consumption The effect of 27OHC on sphingomyelin consumption was studied according to the method (Maziere et al., 1983) with some modifications. In brief, cells used for the analysis of lipids were cultured with 22 AM [N-methyl-14C]sphingomyelin (35,000 dpm, adjusted with unlabeled sphingomyelin) for 24 hours at 37 jC. After the removal of the radioactive medium the monolayers were washed three times with MEM, cultured with 27OHC at a level of 10 Ag/mL for another 24 hours at 37 jC, harvested by brief trypsin treatment and re-suspended in 1 mL of methanol, and sonicated twice for 30 seconds on ice. Portions of the homogenous suspension were taken for determination of protein concentration. Total lipids were extracted from the remaining homogenate by addition of 15 mL of chloroform/methanol (2:1, v/v). Separation of sphingomyelin was accomplished by TLC on silica gel G plates using chloroform/methanol/glacial acetic acid/H2O (25:15:4:2, v/v/v/v) (Skipski et al., 1964). The spot of sphingomyelin on the plates was collected and its radioactivity counted in a scintillation counter. The non-specific activity obtained from the silica gel blank spaces was subtracted from the radioactivity.
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1571
Statistical analysis Data shown in figures were subjected to statistical analysis by ONE WAY ANOVA and StudentNewman-Keuls (SNK) method. Student’s t-test was used to detect significant differences of DCT and sphingomyelin consumption in the cells between two groups. A P value of less than 0.05 was considered significant. All data are presented as the mean F SE.
Results
N
Both the activities of ASMase (Fig. 2A) and NSMase (Fig. 2B) in ECs cultured with 27OHC were decreased significantly after 24 hours, compared to the control cells. When the effect of
Fig. 2. The effect of 27-hydroxycholesterol (27OHC) on activities of acid and neutral sphingomyelinase (ASMase and NSMase) in cultured endothelial cells. The cells were cultured in the presence of 27OHC (10 Ag/mL) for 6, 24 or 48 hours. The cells were then harvested and sonicated in a hypotonic buffer. The activities of ASMase (A) and NSMase (B) were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values at the same incubation periods with a letter are statistically different at level of P < 0.05, compared with control.
1572
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
different concentrations (1, 2.5, 5, 7.5 and 10 Ag/mL) of 27OHC on the enzyme activities was measured after 24 hours of the incubation period, we found ASMase was more sensitive than NSMase to 27OHC (Fig. 3). That is, 27OHC at 7.5 Ag/mL inhibited significantly the activity of ASMase (Fig. 3A), while 10 Ag/mL of 27OHC was needed to significantly reduce the activity of NSMase (Fig. 3B). The activity of ASMase in the ECs was found in this study to be much higher than that of NSMase. In order to exclude the possible interference of the residual activity of ASMase at neutral condition, we used desipramine to inhibit the activity of ASMase when the activity of the NSMase was measured. We found 50 AM of desipramine significantly reduced the activity of ASMase from 361.24 to 156.11 nM/Ag protein after 15 minutes of treatment. The result confirmed that 50 AM desipramine had the ability to inhibit significantly the activity of ASMase. However, desipramine at the same dose had no effect on NSMase, because NSMase activity was not further affected by desipramine after the cells were pretreated with/without 27OHC (Fig. 4). We also used GSH, an inhibitor of NSMase, to confirm the inhibitive effect of 27OHC on NSMase. When the cells were cultured with GSH, NSMase activity was significantly reduced (Fig. 5). The half of the cells exposed to GSH was then cultured with 27OHC, the activity of NSMase was not further inhibited by 27OHC, compared with the data from the cells only treated with GSH. These data indicated that 27OHC did have an inhibiting effect on NSMase in cultured ECs. To determine whether 27OHC had a direct or indirect effect on NSMase, we used the homogenate from normal ECs as an enzyme sample. No change of activity of NSMase was detected until 5 hours after the cell homogenate was incubated with 27OHC (Fig. 6). No significant difference of NSMase mRNA expression in 27OHC-treated cells was found, compared to the control cells.
Fig. 3. The effect of 27-hydroxycholesterol (27OHC) on activities of acid and neutral sphingomyelinase (ASMase and NSMase) in cultured endothelial cells. The cells were cultured in the medium containing 27OHC at 1, 2.5, 5, 7.5 and 10 Ag/mL for 24 hours. After the harvested cells were sonicated in a hypotonic buffer, the activities of ASMase (A) and NSMase (B) were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1573
Fig. 4. The effects of desipramine and 27-hydroxycholesterol (27OHC) on activity of neutral sphingomyelinase (NSMase) in cultured endothelial cells. The cells cultured in flasks were treated with 27OHC (10 Ag/mL) for 24 hours. Desipramine (5 AM) was then added into each half of the flasks containing control or 27OHC treated cells. The incubation was continued for 15 minutes. The cells were harvested and sonicated in a hypotonic buffer. The enzyme activities were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
The effect of 27OHC on cellular [N-methyl-14C]sphingomyelin consumption showed an increase in labeled sphingomyelin content in the cells after a 24-hour incubation with 27OHC. The cells accumulated 2658 F 194 DPM/mg protein of [N-methyl-14C]sphingomyelin, based on an average from eight separate experiments. After the cells were incubated with 27OHC, the accumulation of
Fig. 5. The effects of glutathione (GSH) and 27-hydroxycholesterol (27OHC) on activity of neutral sphingomyelinase (NSMase) in cultured endothelial cells. After the cells were cultured with/without GSH (3 mM) for 1 hour, 27OHC (10 Ag/mL) was added into each half of the flasks with or without GSH treatment. The incubation was continued for another 24 hours, the cells were then harvested and sonicated in a hypotonic buffer. The enzyme activities were measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
1574
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
Fig. 6. The effect of 27-hydroxycholesterol (27OHC) on activity of neutral sphingomyelinase (NSMase) in cell homogenate. The proteins of cell homogenate from normal endothelial cells were exposed to 27OHC (10 Ag/mL) at 37 jC from 5 minutes to 5 hours. The enzyme activities in the cell homogenate were then measured by the formation of radioactive phosphocholine from [N-methyl-14C]sphingomyelin. Values are mean F SE of eight separate experiments. Mean values with a letter are statistically different at level of P < 0.05, compared with control.
[N-methyl-14C]sphingomyelin significantly increased to 4173 F 420 DPM/mg protein, which is a 64% enhancement above the control.
Discussion The data from previous studies (Ridgway, 1995; Zhou and Kummerow, 1997) showed that the increase in cellular sphingomyelin content caused by oxysterols was due to the stimulation of sphingomyelin synthesis. The present study demonstrated that the higher accumulation of sphingomyelin in the cells treated with 27OHC also resulted from the inhibition of sphingomyelin catabolism, based on our findings that both ASMase and NSMase were inhibited by 27OHC. We focused this study mainly on NSMase for the following reasons: NSMase could regulate plasma concentration of sphingomyelin (Ridgway, 2000), and NSMase activity was changed in atherosclerotic plaque (Chatterjee, 1999). On the other hand, ASMase is a lysosomal enzyme. In humans, a deficiency of this enzymatic activity leads to the type A and B forms of Niemann-Pick disease (Ridgway, 2000), which was beyond the scope of our current study. In this study, we used GHS, an inhibitor of NSMase, and desipramine, an inhibitor of ASMase, to determine whether 27OHC would have an inhibitive effect on NSMase. We found that the NSMase activity was not attenuated by 27OHC after preincubating the cells with GSH. Desipramine, on the other hand, did not affect the NSMase activity at neutral condition. We conclude, therefore, that 27OHC had an inhibitory effect on the activity of NSMase itself. A previous study has shown that oxidized LDL taken up by macrophage inhibited lysosomal SMase. The inhibited lysosomal SMase, however, was not found in macrophage containing acetylated LDL because 7-ketocholesterol, an oxysterol, was present only in oxidized LDL, not in acetylated LDL (Maor et al., 1995). The effects of oxysterols on NSMase observed by different laboratories were inconsistent. For example, in human aortic smooth muscle cells, oxidized LDL was shown to have an activating effect
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1575
on NSMase (Chatterjee, 1999). The incorporation of 22R-hydroxycholesterol into the bovine erythrocyte membranes enhanced remarkably the degradation of sphingomyelin in erythrocyte membranes by the action of SMase from Bacillus cereus (Tomita et al., 1992). The structures of oxysterols might be responsible for these discrepancies (Bates et al., 1983; Neyses et al., 1985; Smith and Johnson, 1989; Tomita et al., 1992). In human erythrocytes different oxysterols had totally different effects on calcium influx (Neyses et al., 1985). Some of them stimulated calcium influx and others inhibited the influx (Neyses et al., 1985). The contradictory effects of oxysterols were also shown in the finding that 22hydroxycholesterol could block the stimulation of esterification of cholesterol by 25-hydroxycholesterol (Bates et al., 1983). The inhibition of NSMase activity by 27OHC was detected only in the cultured cells, not in the cell homogenate, indicating that the inhibitory effect of 27OHC on NSMase was indirect. The mechanisms by which 27OHC inhibited the NSMase have not been elucidated, although Maor et al. (1995) suggested that oxysterols might induce allosteric changes in sphingomyelin and the changes could then decrease its recognition of and/or affinity for the SMase. The data from our use of cell homogenate, however, did not support that suggestion. We did not find an attenuated activity of NSMase by 27OHC despite the fact that sphingomyelin did exist in the cell homogenate. There are other factors, including the inserted 27OHC into cell membrane, reduced cholesterol content in the membrane by 27OHC, and the modified fatty acids by 27OHC, in addition to allosteric changes in sphingomyelin, that may be responsible for the attenuated activity of NSMase. All of the factors mentioned above have been found to affect membrane fluidity, and the deterioration of membrane fluidity could result in a change of activity of membranebound enzymes, NSMase. Previous studies that would support our findings include the following: 27OHC could insert itself into the cell membrane (Kou et al., 1991; Zhou et al., 1995). The inserted oxysterols were so close to the lipid bilayer/water interface that they had a very strong effect on the lipid bilayer packing (Szostek et al., 1991). The inserted oxysterols could also expand the membrane interior through its polar group on the isoprenoid side chain (Szostek et al., 1991) and would change the surface shape of several cells (Yachnin et al., 1979). All of these changes of the cell membrane caused by oxysterols may decrease fluidity of the cell membrane and affect membrane-bound proteins (Peng and Morin, 1991), including NSMase. 27OHC could reduce cholesterol in the membrane through inhibition of LDL uptake and reduction of synthesis, resulting in a decrease in the molar ratio of cholesterol to phospholipid in the membrane (Peng and Morin, 1991). The fluidity of the plasma membranes was largely determined by its cholesterol content (Cooper, 1978). A change in membrane fluidity may affect the positioning and function of membrane-bound protein. A strong correlation was found between oxysterol inhibited Na+/K+ ATPase and 5V-nucleotidase, and their decreasing effect on cholesterol synthesis (Peng and Morin, 1987). Fatty acyl modification could influence the degree of ordering and motion in the hydrocarbon core of the lipid bilayer, a property that is commonly referred to as membrane fluidity (Spector and Yorek, 1985). Oxysterol could increase immobilization of fatty acyl chains within the cell membrane (Yachnin et al., 1979), resulting in changes of the membrane-associated functions and properties.
Conclusion Since no significant alteration of NSMase mRNA expression was found, 27OHC regulation of the NSMase activity in cultured cells might occur at a post-transcriptional level. That is, the inhibition of
1576
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
NSMase activity by 27OHC might come from an alteration of the cell membrane fluidity, as a consequence of changes in membrane lipid composition.
Acknowledgements We acknowledge the support of the Wallace Research Foundation, Cedar Rapids, Iowa.
References Bates, S.R., Jett, C.M., Miller, J.E., 1983. Prevention of the hyperlipidemic serum or LDL-induced cellular cholesterol ester accumulation by 22-hydroxycholesterol and its analogue. Biochimica et Biophysical acta 735, 281 – 293. Brown, A.J., Jessup, W., 1999. Oxysterols and atherosclerosis. Atherosclerosis 142, 1 – 28. Carignani, C., Corsi, M., 2002. Inhibition of SK3 channels in the TE671 human medulloblastoma cell line by desipramine and imipramine. European Journal of Pharmacology 448, 139 – 142. Chatterjee, S., Ghosh, N., 1989. Neutral sphingomyelinase from human urine. Purification and preparation of monospecific antibodies. Journal of Biological Chemistry 264, 12554 – 12600. Chatterjee, S., 1999. Neutral sphingomyelinase: past, present and future. Chemistry and Physics of Lipids 102, 79 – 96. Cooper, R.A., 1978. Influence of increased membrane cholesterol on membrane fluidity and cell function in human red blood cell. Journal Supramolecular Structure 8, 413 – 430. Garcia-Cruset, S., Carpenter, K.L.H., Guardiol, F., Stein, B.K., Mitchinson, M.J., 1999. Oxysterols in cap and core of human advanced atherosclerotic lesions. Free Radical Research 30, 341 – 350. Garcia-Cruset, S., Carpenter, K.L.H., Guardiol, F., Stein, B.K., Mitchinson, M.J., 2001. Oxysterol profiles of normal human arteries, fatty streaks and advanced lesions. Free Radical Research 35, 31 – 41. Javitt, N.B., Kok, E., Burstein, S., Cohen, B., Kutscher, J., 1981. 26-Hydroxycholesterol identification and quantitation in human serum. Journal of Biological Chemistry 256, 12644 – 12646. Jiang, X.C., Paultre, F., Pearson, T.A., Reed, R.G., Francis, C.K., Lin, M., Berglund, L., Tall, A.R., 2000. Plasma sphingomyelin level as a risk factor for coronary artery disease. Arteriosclerosis, Thrombosis and Vascular Biology 20, 2614 – 2618. Kou, I.-L., Pikul, J., Kummerow, F.A., 1991. Influence of 26-hydroxycholesterol on the composition and function of gelfiltered platelets. Journal of the American College of Nutrition 10, 114 – 122. Kummerow, F.A., Cook, L.S., Wasowicz, E., Jelen, H., 2001. Changes in the phospholipid composition of the arterial cell can result in severe atherosclerotic lesions. Journal of Nutritional Biochemistry 12, 602 – 607. Liu, B., Hannun, Y.A., 1997. Inhibition of the neutral magnesium-dependent sphingomyelinase by glutathione. Journal of Biological Chemistry 272, 16281 – 16287. Maor, I., Mandel, H., Aviram, M., 1995. Macrophage uptake of oxidized LDL inhibits lysosomal sphingomyelinase, thus causing the accumulation of unesterified cholesterol-sphingomyelin-rich particles in the lysosomes. A possible role for 7ketocholesterol. Arteriosclerosis, Thrombosis and Vascular Biology 15, 1378 – 1387. Maziere, J.C., Maziere, C., Mora, L., Gallie, F., Polonovski, J., 1983. Cholesterol and 7-dehydrosterol inhibit the in situ degradation of sphingomyelin by cultured human fibroblasts. Biochemical and Biophysical Research Communications 112, 860 – 865. Murate, T., Suzuki, M., Hattori, M., Takagi, A., Kojima, T., Tanizawa, T., Asano, H., Hotta, T., Saito, H., Yoshida, S., TamiyaKoizumi, K., 2002. Up-regulation of acid sphingomyelinase during retinoic acid-induced myeloid differentiation of NB4, a human acute promyelocytic leukemia cell line. Journal of Biological Chemistry 277, 9936 – 9943. Neyses, L., Locher, R., Stimpel, M., Streuli, R., Vetter, W., 1985. Stereospecific modulation of the calcium channel in human erythrocytes by cholesterol and its oxidized derivatives. Biochemical Journal 227, 105 – 112. Peng, S.K., Morin, R.J., 1987. Effects on membrane function by cholesterol oxidation derivatives in cultured aortic smooth muscle cells. Artery 14, 85 – 99. Peng, S.K., Morin, R.J., 1991. Effects of cholesterol oxides on cell membranes. In: Peng, S.K., Morin, R.J. (Eds.), Biological Effects of Cholesterol Oxides. CRC Press Inc., Boca Raton, FL, pp. 125 – 146.
Q. Zhou et al. / Life Sciences 75 (2004) 1567–1577
1577
Ridgway, N.D., 1995. 25-Hydroxycholesterol stimulates sphingomyelin synthesis in Chinese hamster ovary cells. Journal of Lipid Research 36, 1345 – 1358. Ridgway, N.D., 2000. Interactions between metabolism and intracellular distribution of cholesterol and sphingomyelin. Biochimica et Biophysical acta 1484, 129 – 141. Skipski, V.P., Peterson, R.F., Barclay, M., 1964. Quantitative analysis of phospholipids by thin-layer chromatography. Biochemical Journal 90, 374 – 378. Smith, L.L., Johnson, B.H., 1989. Biological activities of oxysterols. Free Radical Biology and Medicine 7, 285 – 332. Stoffel, W., 1999. Functional analysis of acid and neutral sphingomyelinases in vitro and in vivo. Chemistry and Physics of Lipids 102, 107 – 121. Storey, M.K., Byers, D.M., Cook, H.W., Ridgway, N.D., 1998. Cholesterol regulates oxysterol binding protein phosphorylation and Golgi localization in Chinese hamster ovary cells: correlation with stimulation of sphingomyelin synthesis by 25hydroxycholesterol. Biochemical Journal 336, 247 – 256. Spector, A.A., Yorek, M.A., 1985. Membrane lipid composition and cellular function. Journal of Lipid Research 26, 1015 – 1035. Szostek, R., Kucuk, O., Lis, L.J., Tracy, D., Mata, R., Dey, T., Kauffman, J.W., Yachnin, S., Westerman, M.P., 1991. Effect of inserted oxysterols on phospholipid packing in normal and sickle red blood cell membranes. Biochemical and Biophysical Research Communications 180, 730 – 734. Tomita, M., Togami, J., Fujimoto, Y., Ikekawa, N., Taguchi, R., Ikezawa, H., 1992. Effect of 22R-hydroxycholesterol on the action of sphingomyelinase from Bacillus cereus toward bovine erythrocytes. Toxicon. 30, 801 – 813. Tomiuk, S., Hofmann, K., Nix, M., Zumbansen, M., Stoffel, W., 1998. Cloned mammalian neutral sphingomyelinase: functions in sphingolipid signaling? Cell Biology 95, 3638 – 3643. Vaya, J., Aviram, M., Mahmood, S., Hayek, T., Grenadir, E., Hoffman, A., Milo, S., 2001. Selective distribution of oxysterols in atherosclerotic lesions and human plasma lipoproteins. Free Radical Research 34, 485 – 497. van Deenen, L.L.M., 1981. Topology and dynamics of phospholipids in membranes. FEBS Letters 123, 3 – 15. Yachnin, S., Streuli, R.A., Gordon, L.I., Hsu, R.C., 1979. Alteration of peripheral blood cell membrane function and morphology by oxygenated sterols: a membrane insertion hypothesis. Current Topics in Hematology 2, 245 – 271. Zhou, Q., Jimi, S., Smith, T.L., Kummerow, F.A., 1991. The effect of 25-hydroxycholesterol on accumulation of intracellular calcium. Cell Calcium 12, 467 – 478. Zhou, Q., Wasowicz, E., Kummerow, F.A., 1995. Failure of vitamin E to protect cultured human arterial smooth muscle cells against oxysterol-induced cytotoxicity. Journal of the American College of Nutrition 14, 169 – 175. Zhou, Q., Kummerow, F.A., 1997. Effect of 27-hydroxycholesterol on cellular sphingomyelin synthesis and Ca+ + content in cultured smooth muscle cells. Biomedical and Environmental Sciences 10, 369 – 376. Zhou, Q., Wasowicz, E., Handler, B., Fleischer, L., Kummerow, F.A., 2000. An excess concentration of oxysterols in the plasma is cytotoxic to cultured endothelial cells. Atherosclerosis 149, 191 – 197.