- Email: [email protected]
MCT1
Biomedicine & Pharmacotherapy 121 (2020) 109610
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
3-Bromopyruvate inhibits the malignant phenotype of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment via miR-449a/MCT1
T
Yujing Shenga,1, Qianqian Jianga,1, Xuchen Donga,1, Jiachi Liua, Liang Liua, Haiyang Wanga, Liping Wanga, Haoran Lia, Xuejun Yangb, Jun Donga,* a b
Department of Neurosurgery, The Second Affiliated Hospital of Soochow University, 1055 Sanxiang Road, Suzhou 215004, China Department of Neurosurgery, Tianjin Medical University General Hospital, 154 Anshan Road, Tianjin 300052, China
A R T I C LE I N FO
A B S T R A C T
Keywords: 3-BrPA Glioma microenvironment Macrophages Dendritic cells MCT1
Bromopyruvate (3-BrPA) is a glycolysis inhibitor that has been reported to have a strong anti-tumour effect in many human tumours. Several studies have reported that 3-BrPA could inhibit glioma progression; however, its role on the interstitial cells in the glioma microenvironment has not been investigated. In previous studies, we found that in the glioma microenvironment, glioma stem cells can induce the malignant transformation of macrophages and dendritic cells. In this study, we focused on the effects of 3-BrPA on malignantly transformed macrophages and dendritic cells. First, we found that 3-BrPA inhibited the proliferation of malignantly transformed macrophages and dendritic cells in a dose-dependent and time-dependent manner. Further study indicated that 3-BrPA significantly decreased extracellular lactate and inhibited the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells. Using an online database and a series of experiments, we demonstrated that 3-BrPA inhibits the malignant progression of malignantly transformed macrophages and dendritic cells via the miR-449a/MCT1 axis. These findings built experimental basis for new approach against glioma.
1. Introduction Glioma is the most common primary tumour of the central nervous system [1,2]. The prognosis of patients with high-grade glioma is very poor, and the median survival time is approximately 15 months [3,4]. To make matters worse, high-grade glioma recurs frequently after surgery. With the continuous improvement of comprehensive treatments that consist of surgical resection, chemotherapy and radiation therapy, the treatment efficacy in patients with high-grade gliomas has been improved; however, the survival of patients is still limited [5]. Thus, it is urgent to explore the potential mechanism of glioma development. In addition to cancer cells, there are various interstitial cells that together constitute the tumour microenvironment in solid tumour tissues, including glioma [6]. One main reason for the lack of effective treatments for glioma is the existence of a subpopulation of cells with self-renewal and tumour-initiating abilities in the tumour microenvironment, namely, glioma stem cells (GSCs) [7,8]. Studies have
shown that GSCs can not only maintain self-renewal and promote tumour initiation but also induce the malignant transformation of other stromal cells in the tumour microenvironment, such as bone marrow mesenchymal stem cells (BMSCs), macrophages and dendritic cells [7,9,10]. Macrophages and dendritic cells are important components of the human immune response against glioma. In our previous studies, we demonstrated that macrophages and dendritic cells in the glioma microenvironment can be induced and undergo malignant transformation by GSCs, which is conducive to the survival and development of GSCs [11,12]. These studies suggest that malignantly transformed macrophages and dendritic cells can be applied as targets for the treatment of glioma. Further elucidating the mechanism of malignant progression of malignantly transformed macrophages and dendritic cells will provide new methods for glioma treatment. 3-Bromopyruvate (3-BrPA) is a glycolysis inhibitor and tumour energy blocker with strong anti-tumour effects in vitro and in vivo [13–15]. It induces apoptosis by inducing intracellular ATP depletion by cooperating with hexokinase II (HK2) and glyceraldehyde-3-
⁎
Corresponding author at: Department of Neurosurgery, The Second Affiliated Hospital of Soochow University, 1055 Sanxiang Road, Suzhou 215004, China. E-mail address: [email protected] (J. Dong). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.biopha.2019.109610 Received 8 August 2019; Received in revised form 24 October 2019; Accepted 25 October 2019 0753-3322/ © 2019 Second Affiliated Hospital of Soochow University. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
dehydrogenase (GAPDH) [16,17]. At the same time, it inhibits the activity of succinate dehydrogenase (SDH), resulting in an imbalance in the intracellular redox state [18]. The latest studies suggested that 3BrPA could inhibit the malignant progression of many types of tumours. For example, Pichla M showed that 3-BrPA could suppress the migration of human metastatic prostate cells [14]. Yamada M et al. reported that 3-BrPA is an innovative strategy for unresectable melanoma and possibly other skin cancers [19]. Yoo JJ et al. showed that 3-BrPA could increase the anti-tumour efficacy of sorafenib in hepatocellular carcinoma [20]. Studies have also demonstrated that 3-BrPA could inhibit the proliferation of glioma cell lines [21,22]; however, its effect on malignantly transformed macrophages and dendritic cells in the microenvironment of glioma has not been studied. Therefore, it is of great significance to further study the function and potential mechanism of 3BrPA in malignantly transformed macrophages and dendritic cells, which will provide a theoretical basis for the formulation of immunotherapy strategies for glioma. In our study, we found that 3-BrPA could significantly decrease extracellular lactate and inhibit the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells. Next, through a series of experiments, we showed that 3-BrPA affects these biological behaviours of malignantly transformed macrophages and dendritic cells through MCT1. Our study further suggested that in malignantly transformed macrophages and dendritic cells, MCT1 is regulated by miR-449a. Overall, we reported for the first time that 3BrPA inhibits the malignant phenotype of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment via miR-449a/MCT1, which may provide a novel strategy for glioma therapy.
Table 1 The primer sequences used in the present study. Gene
Primer Sequence
MCT1
forward primer: 5′- TTGTGGAATGCTGTCCTGTC -3′ reverse primer: 5′- ACATGTCATTGAGCCGACCT -3′ forward primer: 5′- TGGCAGTGTATTGTTA -3′ reverse primer: 5′- ATCCAGTGCAGGGTCCGAGG -3′ forward primer:5′- CTCCATCCTGGCCTCGCTGT -3′ reverse primer:5′- GCTGTCACCTTCACCGTTCC -3′ forward primer: 5′- CTCGCTTCGGCAGCACA -3′ reverse primer: 5′- AACGCTTCACGAATTTGCGT -3′
miR-449a β-actin U6
Finally, luciferase activities were normalized using renilla luciferase activities. 2.5. Western blot analysis Total protein was extracted from cells using RIPA lysis buffer (Beyotime, Shanghai, China) according to the manufacturer's protocol. Total protein was quantified using a BCA protein assay kit (Beyotime, Shanghai, China). Next, the proteins were separated by SDS-PAGE (10%). The separated proteins were transferred onto PVDF membranes (Millipore, MA, USA), followed by blocking for 2 h at room temperature with 5% skimmed milk. Then, the membranes were incubated with an MCT1 primary antibody (1:100, ab135593, Abcam, Cambridge, MA, USA) and next with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3,000, 7074S, CST, MA, USA). β-actin (1:1000, bs10966R, Bioss, Beijing, China) used as control. Finally, the bands were visualized under an Image Quant LAS 4000 min. (GE, CT, USA).
2. Materials and methods
2.6. Lactate measurement
2.1. Cell lines and cell culture
Lactate was quantified using an l-Lactic Acid (l-Lactate) Assay Kit (Megazyme, Ireland) according to the manufacturer’s protocol. In detail, cell samples were collected from the culture medium after centrifugation. The lactic acid concentration calibration reagents were added to the supernatant samples, and the samples were incubated for 5 min at 37 °C. The OD values at 340 nm were obtained from a plate reader, and the concentration of lactate was calculated following the formula specified in the manual. [23]
Malignantly transformed macrophages (tMø) and dendritic cells (tDC) induced by glioma stem cells in the glioma microenvironment were obtained and tested as described previously [11,12]. The two cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, NY, USA) supplemented with 10% foetal bovine serum (FBS, ScienCell, LA, USA) and maintained in a 37 °C, 5% CO2 incubator. 2.2. Oligonucleotides, cell transfection and plasmid construction
2.7. CCK-8 assays The oligonucleotides used in this study were all purchased from GenePharma (Shanghai, China). The relevant RNAs were chemically synthesized and inserted into the pHBLV-U6 lentivirus core vector (Hanbio, Shanghai, China). Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) was used for cell transfection according to the manufacturer’s protocols.
A CCK-8 (Beyotime, Shanghai, China) assay was performed according to the manufacturer's protocol. Cells were seeded into 96-well plates in 100 μl of culture media. The medium of each well was subsequently replaced with 100 μl of fresh culture media with 10% CCK-8 reagent at different times (1, 2, and 3 d), and the cells were then incubated for an additional 3 h. The absorbance was measured at an optical density of 450 nm using a microplate reader.
2.3. Real-time quantitative reverse transcription PCR
2.8. Clone formation assay
Total RNA was isolated with TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. cDNA was obtained using Fermentas reverse transcription reagent, and quantitative reverse transcription PCR (qRT-PCR) was conducted with SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, MA, USA) according to the manufacturer’s protocols. The primer sequences used in the present study are shown in Table 1.
Cells were seeded at a density of 100 cells/well in a culture dish (60 mm, Corning, NY, USA) and maintained at 37 °C in a 5% CO2 incubator. Twelve days later, the cells were fixed for 5 min with paraformaldehyde and stained for 20 min with crystal violet. 2.9. Migration and invasion assays
2.4. Luciferase reporter assay For the invasion assay, chamber inserts (Merck Millipore, Germany) were pre-coated with 45 μl of Matrigel (1:8 dilution; BD Bioscience, NJ, USA). For both assays, 5 × 104 cells in serum-free medium were seeded into the upper chambers, and DMEM containing 10% FBS was added to the lower chamber. After incubation for 48 h at 37 °C in a 5% CO2
Luciferase activity was analysed using the Dual‐Luciferase Reporter Assay System (Promega, WI, USA) according to the manufacturer's protocol. The luciferase vectors combined with miR-449a were transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). 2
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
incubator, the chambers were fixed using 4% paraformaldehyde for 5 min, stained with a crystal violet solution for 30 min and washed three times with PBS (Gibco, NY, USA). Stained cells were observed under an optical microscope and counted, and the mean was calculated. [24]
3.3. 3-BrPA regulates the lactate metabolism, clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells by suppressing MCT1 To further elucidate the potential mechanism by which 3-BrPA inhibits the progression of malignantly transformed macrophages and dendritic cells, we tried to find the effector target of 3-BrPA. As a downstream gene of the myelocytomatosis proto-oncogene (myc), numerous studies have shown that monocarboxylate transporters (MCTs) are closely related to the metabolism of various tumours and that MCT1 is an important member of the MCT family [25,26]. Existing studies have suggested that, in a variety of tumours, there is a very close relationship between MCT1 and 3-BrPA [27,28]. In addition, studies have shown that MCT1 is an important carrier of intracellular lactate [29]. Combining these findings together, we speculate that the inhibitory effect of 3-BrPA on malignantly transformed macrophages and dendritic cells may be closely related to MCT1. To test our hypothesis, we conducted a series of assays. First, qRT-PCR and Western blot showed that 3-BrPA could inhibit the expression of MCT1 in the two cell lines (Fig. 3A, B). The functional assays indicated that MCT1 could increase extracellular lactate and promote the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells. Moreover, the effect of 3-BrPA on malignantly transformed macrophages and dendritic cells could be restored by the MCT1 plasmid (Fig. 3C-I). Taken together, these results indicated that 3-BrPA regulates the lactate metabolism, clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells by suppressing MCT1.
2.10. Statistical analysis SPSS 13.0 software was used for statistical data analysis. All data are expressed as the mean ± standard error. A t-test (two groups) or oneway ANOVA (no less than three groups) was used to analyse the statistical significance. Differences of P < 0.05 (*) and P < 0.01 (**) were considered statistically significant and very significant, respectively. All experiments were repeated three times independently. 3. Results 3.1. 3-BrPA inhibits the proliferation of malignantly transformed macrophages and dendritic cells in a dose-dependent and time-dependent manner To explore the effect of 3-BrPA on malignantly transformed macrophages and dendritic cells, the two cell lines were treated with 3-BrPA at different concentrations. After 48 h or 72 h, cell viability was evaluated by CCK-8 assays. The results showed that 3-BrPA inhibited the proliferation of the two cell lines in a dose-dependent and time-dependent manner (Fig. 1). In addition, we checked the IC50 s of 3-BrPA on the two cell lines and found that the IC50 s were closer to 100 umol/ L than other concentrations. Thus, we used the indicated concentration (100 umol/L) for further study.
3.4. 3-BrPA suppresses MCT1 through miR-449a To reveal the potential mechanism by which 3-BrPA suppresses MCT1 expression, we performed further experiments. MicroRNAs (miRNAs) are an important type of non-coding RNA (ncRNA) that can interact with the 3′-untranslated region of their target message RNAs (mRNAs), resulting in gene expression changes [30,31]. In recent years, a large number of studies have shown that miRNA is closely related to the development of various human tumours [32,33]. Here, we suggest that MCT1 may be regulated by miRNAs. Using an online database, miR-449a was selected for the following study (Fig. 4A). To test the regulatory relationship between miR-449a and MCT1, miR-449a mimics were synthesized and transfected into malignantly transformed macrophages and dendritic cells. Western blot results showed that miR449a mimics suppress MCT1 expression (Fig. 4B). In addition, a luciferase reporter assay was conducted, and the results indicated that miR449a significantly suppressed the luciferase activity of cells transfected with the wild-type MCT1-3′UTR but had no significant effect on the luciferase activity of cells transfected with the mutant-type MCT13′UTR (Fig. 4C). We also detected the expression level of miR-449a in the two cell lines treated with 3-BrPA and found that 3-BrPA could upregulate the expression of miR-449a (Fig. 4D). Next, we verified the relationship between miR-449a and MCT1 through a series of functional assays. The validity of the miR-449a mimics and MCT1 plasmid was confirmed by qRT-PCR and western blot analysis (Fig. 5A-C). Moreover, functional assays showed that the miR-449a mimics decreased lactate secretion and inhibited clone formation, migration and invasion in malignantly transformed macrophages and dendritic cells. The effects of miR-449a mimics on lactate secretion, clone formation, migration and invasion were restored by the MCT1 plasmid (Fig. 5D-K). Thus, we conclude that 3-BrPA suppresses MCT1 in a miR-449a-dependent manner.
3.2. 3-BrPA significantly decreases extracellular lactate and inhibits the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells 3-BrPA is known to be a glycolysis inhibitor and energy blocker, so we wondered if it could affect energy metabolism in these two cell lines. To answer our question, we measured extracellular lactate in the cell lines after treated with negative control or 3-BrPA for 48 h respectively, and the results indicated that 3-BrPA could decrease these levels in both cell lines (Fig. 2A, B). Next, clone formation assays, migration assays and transwell assays were performed to evaluate the effect of 3-BrPA on cell clone formation ability, migration ability and invasion ability, respectively. The results showed that 3-BrPA significantly inhibited the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells (Fig. 2C-H). Based on these results, we concluded that 3-BrPA could inhibit the progression of malignantly transformed macrophages and dendritic cells.
Fig. 1. 3-BrPA inhibited the viability of tMø and tDC. (A) tMø were incubated with 3-BrPA at the indicated concentrations for 48 h or 72 h. (B) tDC were incubated with 3-BrPA at the indicated concentrations for 48 h or 72 h. *P < 0.05, **P < 0.01.
4. Discussion Glioma, the most common primary intracranial tumour, originates from the glial cells of the brain [34]. The annual incidence rate of 3
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
Fig. 2. 3-BrPA significantly decreased extracellular lactate and inhibited the clone formation, migration and invasion of tMø and tDC. (A–B) 3-BrPA (100 μmol/L) significantly decreased the extracellular lactate level of tMø and tDC. (C–D) 3-BrPA (100 μmol/L) inhibited the clone formation of tMø and tDC. (E–F) 3-BrPA (100 μmol/L) inhibited the migration of tMø and tDC. (G–H) 3-BrPA (100 μmol/L) inhibited the invasion of tMø and tDC. DMEM containing 10% FBS and 0.1% DMSO was used as the negative control. **P < 0.01.
transport of lactate between astrocytes and neurons in brain tissue [25,29,40]. Mounting evidence indicates that MCT1 is closely related to various human tumours. For example, Afonso et al. found that in diffuse large B cell lymphoma, MCT1 is associated with the clinicopathological profile [26]. Chen et al. reported that MCT1 could be used as a prognostic biomarker for oesophageal squamous cell carcinoma [41]. Guan et al. demonstrated that MCT1 is associated with the progression of breast cancer [42]. Through a literature search, we found that 3-BrPA and MCT1 are closely related in the progression of tumours. For example, Li et al. showed that MCT1 could enhance the sensitivity of breast cancer cells to 3-BrPA [27]. Liu et al. indicated that 3-BrPA enhanced daunorubicininduced cytotoxicity involved in MCT1 in breast cancer cells [28]. However, until now, the relationship between MCT1 and 3-BrPA in the glioma microenvironment has not been studied. In this study, we found that the inhibitory effect of 3-BrPA on the lactate metabolism, clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells could be altered by the MCT1 plasmid. MiRNAs, which are important ncRNAs, play critical roles in gene expression. Their role in tumours is well recognized by researchers. MCT1 has been reported to be regulated by numerous miRNAs. For example, miR-425 targets MCT1 to regulate liver damage [43]. MiR124 inhibits pancreatic ductal adenocarcinoma progression by targeting MCT1 [44]. To further elucidate the mechanism by which MCT1 promotes the malignant progression of malignantly transformed macrophages and dendritic cells, we used an online database and found that MCT1 may be regulated by miR-449a. Recent research has suggested that miR-449a can inhibit the progression of many tumours [45–47]. Through a series of experiments, we proved that 3-BrPA could upregulate the expression of miR-449a, which directly targets MCT1. To sum up, 3-Bromopyruvate inhibits the growth of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment via miR-449a/MCT1 axis.
glioma in China is 5-8/100,000, and the 5-year mortality rate is second to only pancreatic cancer and lung cancer for systemic tumours [35]. The treatment of glioma is a serious challenge in neuro-oncologist. It is a common goal of researchers to explore the occurrence and development of glioma to find more effective treatment. In our previous studies, we confirmed that GSCs could induced malignant transformation of macrophages and dendritic cells in the glioma microenvironment [11,12]. For further study, we cloned the malignantly transformed macrophages (tMø) and dendritic cells (tDC). Compared the biological behavior of macrophages and dendritic cells before or after malignant transformation with the wildly recognized glioma cell lines (U87, U251, LN229 and T98 G). We found that after malignant transformation, the clone formation, migration and invasion of macrophages and dendritic cells are enhanced and was similar to LN229 (Fig. S1). In addition, we co-cultured normal macrophages and normal dendritic cells with GSCs respectively, and the obtained cells were named cMø and cDC. Through a series of functional assays, we found that, compared with normal macrophages and dendritic cells, the clone formation, migration and invasion of cMø and cDC was significantly enhanced. More interesting, there is no statistical difference between malignantly transformed cells (tMø and tDC) and co-cultured cells (cMø and cDC) on clone formation, migration and invasion (Fig. S2). These results indicate that tMø and tDC play a vital role in glioma development. 3-BrPA, a small molecule and an analogue of pyruvate, could inactivate various key molecules related to metabolism. In 2001, Ko YH et al. reported for the first time that 3-BrPA has anti-liver cancer potential [36]. Since then, 3-BrPA has been shown to have therapeutic effects on a variety of tumours. For example, Wang et al. reported that 3-BrPA could suppress gastric cancer cell proliferation and decrease lactate production [37]. Zou et al. showed that 3-BrPA effectively induced nasopharyngeal carcinoma cell apoptosis by inhibiting glycolysis and ATP production [38]. Konstantakou et al. found that 3-BrPA could markedly reduce active bladder cancer cell apoptosis [39]. In this study, we found that 3-BrPA significantly decreased extracellular lactate and inhibited the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment. MCT1, also known as SLC16A1, plays an important role in the
5. Conclusions In this study, we showed that 3-BrPA could inhibit the progression of malignantly transformed macrophages and dendritic cells induced by 4
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
Fig. 3. 3-BrPA regulated the lactate metabolism, clone formation, migration and invasion of tMø and tDC by suppressing MCT1. B) qRT-PCR and Western blot show the MCT1 expression in tMø and tDC treated with 3-BrPA (100 μmol/L). (C) Lactate measurement assay shows the extracellular lactate level of cells treated with 3BrPA (100 μmol/L) in the presence or absence of MCT1 overexpression. (D–E) Clone formation assays show the clone formation ability of cells treated with 3-BrPA (100 μmol/L) in the presence or absence of MCT1 overexpression. (F–G) Migration assays show the migration ability of cells treated with 3-BrPA (100 μmol/ L) in the presence or absence of MCT1 overexpression. (H–I) Invasion assays show the migration ability of cells treated with 3-BrPA (100 μmol/ L) in the presence or absence of MCT1 overexpression. **P < 0.01.
Fig. 4. MCT1 was negatively regulated by miR-449a in tMø and tDC. (A) The putative binding sites between miR-449a and MCT1. (B) Western blot assay shows the expression of MCT1 in tMø and tDC transfected with NC or miR-449a mimics. (C) MiR-449a downregulated the luciferase activity of the wild-type MCT1 3′-UTR expression vector but did not reduce the expression of a mutant MCT1 3′-UTR. (D) qRT-PCR shows miR-449a expression in tMø and tDC treated with 3-BrPA (100 μmol/L). **P < 0.01. 5
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
Fig. 5. 3-BrPA suppressed MCT1 through miR-449a. C) Expression of MCT1 in tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. (D–E) A lactate measurement assay shows the extracellular lactate levels of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with the MCT1 plasmid. (F–G) Clone formation assays show the clone formation ability of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. (H–I) Migration assays show the migration ability of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. (J–K) Invasion assays show the invasion ability of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. **P < 0.01.
glioma stem cells in the glioma microenvironment and that the miR449a/MCT1 axis is involved in the mechanism. These findings built experimental basis for new approach against glioma.
[2] J.J. Miller, F. Loebel, T.A. Juratli, S.S. Tummala, E.A. Williams, T.T. Batchelor, I. Arrillaga-Romany, D.P. Cahill, Accelerated progression of IDH mutant glioma after first recurrence, Neuro Oncol. 21 (5) (2019) 669–677. [3] E.V. Walker, F.G. Davis, Malignant primary brain and other central nervous system tumors diagnosed in Canada from 2009 to 2013, Neuro Oncol. 21 (3) (2019) 360–369. [4] L. Liu, S. Cui, R. Zhang, Y. Shi, L. Luo, MiR-421 inhibits the malignant phenotype in glioma by directly targeting MEF2D, Am. J. Cancer Res. 7 (4) (2017) 857–868. [5] J. Wang, M. Zhang, W. Lu, Long noncoding RNA GACAT3 promotes glioma progression by sponging miR-135a, J. Cell. Physiol. 234 (7) (2019) 10877–10887. [6] T. Xie, B. Liu, C.G. Dai, Z.H. Lu, J. Dong, Q. Huang, Glioma stem cells reconstruct similar immunoinflammatory microenvironment in different transplant sites and induce malignant transformation of tumor microenvironment cells, J. Cancer Res. Clin. Oncol. 145 (2) (2019) 321–328. [7] Y. Zhao, J. Chen, X. Dai, H. Cai, X. Ji, Y. Sheng, H. Liu, L. Yang, Y. Chen, D. Xi, M. Sheng, Y. Xue, J. Shi, J. Liu, X. Li, J. Dong, Human glioma stem-like cells induce malignant transformation of bone marrow mesenchymal stem cells by activating TERT expression, Oncotarget 8 (61) (2017) 104418–104429. [8] S.M. Wang, H.Y. Lin, Y.L. Chen, T.I. Hsu, J.Y. Chuang, T.J. Kao, C.Y. Ko, CCAAT/ enhancer-binding protein delta regulates the stemness of glioma stem-like cells through activating PDGFA expression upon inflammatory stimulation, J. Neuroinflamm. 16 (1) (2019) 146. [9] S. Zhu, X. Lv, X. Zhang, T. Li, G. Zang, N. Yang, X. Wang, J. Wu, W. Chen, Y.J. Liu, J. Chen, An effective dendritic cell-based vaccine containing glioma stem-like cell lysate and CpG adjuvant for an orthotopic mouse model of glioma, Int. J. Cancer 144 (11) (2019) 2867–2879. [10] K. Gabrusiewicz, X. Li, J. Wei, Y. Hashimoto, A.L. Marisetty, M. Ott, F. Wang, D. Hawke, J. Yu, L.M. Healy, A. Hossain, J.C. Akers, S.N. Maiti, S. Yamashita, Y. Shimizu, K. Dunner, M.A. Zal, J.K. Burks, J. Gumin, F. Nwajei, A. Rezavanian, S. Zhou, G. Rao, R. Sawaya, G.N. Fuller, J.T. Huse, J.P. Antel, S. Li, L. Cooper, E.P. Sulman, C. Chen, C. Geula, R. Kalluri, T. Zal, A.B. Heimberger, Glioblastoma stem cell-derived exosomes induce M2 macrophages and PD-L1 expression on human monocytes, Oncoimmunology 7 (4) (2018) e1412909. [11] X. Fei, A. Wang, D. Wang, X. Meng, J. Ma, L. Hong, R. Qin, A. Wang, J. Dong, Q. Huang, Z. Wang, Establishment of malignantly transformed dendritic cell line SU3-ihDCTC induced by Glioma stem cells and study on its sensitivity to
Declaration of Competing Interest All authors agree with the content and the submission of this manuscript. All authors do not have any conflicts of interest. All authors declare that the material is original research and has not been previously published and is not currently being considered for publication elsewhere. Acknowledgements This study was supported by grants from National Natural Science Foundation of China (No. 81472739) and the Clinical Special Disease Diagnosis and Treatment Technology in Suzhou (No. LCZX201807) Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109610. References [1] L. Liu, Y. Shi, J. Shi, H. Wang, Y. Sheng, Q. Jiang, H. Chen, X. Li, J. Dong, The long non-coding RNA SNHG1 promotes glioma progression by competitively binding to miR-194 to regulate PHLDA1 expression, Cell Death Dis. 10 (6) (2019) 463.
6
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
1204–1211. [30] H. Chen, L. Liu, X. Li, Y. Shi, N. Liu, MicroRNA-1294 inhibits the proliferation and enhances the chemosensitivity of glioma to temozolomide via the direct targeting of TPX2, Am. J. Cancer Res. 8 (2) (2018) 291–301. [31] T. Xu, W. Yu, Q. Li, X. Li, Y. Shi, B. Cao, Y. Zhang, S. Wang, Y. Zhang, T. Wang, B. Huang, MicroRNA-524 inhibits the progress of glioma via the direct targeting of NCF2, Am. J. Transl. Res. 11 (3) (2019) 1605–1615. [32] W. Pan, L.J. Pang, H.L. Cai, Y. Wu, W. Zhang, J.C. Fang, MiR-1294 acts as a tumor suppressor in clear cell renal cell carcinoma through targeting HOXA6, Eur. Rev. Med. Pharmacol. Sci. 23 (9) (2019) 3719–3725. [33] G. Peng, C. Yang, Y. Liu, C. Shen, miR-25-3p promotes glioma cell proliferation and migration by targeting FBXW7 and DKK3, Exp. Ther. Med. 18 (1) (2019) 769–778. [34] L. Zhu, Q. Wang, Y. Hu, F. Wang, The circadian gene Per1 plays an important role in radiation-induced apoptosis and DNA damage in glioma, Asian Pac. J. Cancer Prev. 20 (7) (2019) 2195–2201. [35] L. Ma, H. Wang, Z. Li, X. Geng, M. Li, Chemokine (C-C motif) ligand 18 is highly expressed in glioma tissues and promotes invasion of glioblastoma cells, J. Cancer Res. Ther. 15 (2) (2019) 358–364. [36] J.F. Geschwind, Y.H. Ko, M.S. Torbenson, C. Magee, P.L. Pedersen, Novel therapy for liver cancer: direct intraarterial injection of a potent inhibitor of ATP production, Cancer Res. 62 (14) (2002) 3909–3913. [37] T.A. Wang, X.D. Zhang, X.Y. Guo, S.L. Xian, Y.F. Lu, 3-bromopyruvate and sodium citrate target glycolysis, suppress survivin, and induce mitochondrial-mediated apoptosis in gastric cancer cells and inhibit gastric orthotopic transplantation tumor growth, Oncol. Rep. 35 (3) (2016) 1287–1296. [38] X. Zou, M. Zhang, Y. Sun, S. Zhao, Y. Wei, X. Zhang, C. Jiang, H. Liu, Inhibitory effects of 3-bromopyruvate in human nasopharyngeal carcinoma cells, Oncol. Rep. 34 (4) (2015) 1895–1904. [39] E.G. Konstantakou, G.E. Voutsinas, A.D. Velentzas, A.S. Basogianni, E. Paronis, E. Balafas, N. Kostomitsopoulos, K.N. Syrigos, E. Anastasiadou, D.J. Stravopodis, 3BrPA eliminates human bladder cancer cells with highly oncogenic signatures via engagement of specific death programs and perturbation of multiple signaling and metabolic determinants, Mol. Cancer 14 (2015) 135. [40] T. Medin, H. Medin, M.B. Hefte, J. Storm-Mathisen, L.H. Bergersen, Upregulation of the lactate transporter monocarboxylate transporter 1 at the blood-brain barrier in a rat model of attention-deficit/hyperactivity disorder suggests hyperactivity could be a form of self-treatment, Behav. Brain Res. 360 (2019) 279–285. [41] X. Chen, X. Chen, F. Liu, Q. Yuan, K. Zhang, W. Zhou, S. Guan, Y. Wang, S. Mi, Y. Cheng, Monocarboxylate transporter 1 is an independent prognostic factor in esophageal squamous cell carcinoma, Oncol. Rep. 41 (4) (2019) 2529–2539. [42] X. Guan, V. Rodriguez-Cruz, M.E. Morris, Cellular uptake of MCT1 inhibitors ARC155858 and AZD3965 and their effects on MCT-mediated transport of L-Lactate in murine 4T1 breast tumor cancer cells, AAPS J. 21 (2) (2019) 13. [43] L. Lang, B. Xu, S.Z. Li, W. Guo, J. Yuan, S. Zang, Y. Chen, H.M. Yang, S. Lian, RnomiR-425-5p targets the DLST and SLC16A1 genes to reduce liver damage caused by excessive energy mobilization under cold stress, J. Anim. Physiol. Anim. Nutr. (Berl) 103 (4) (2019) 1251–1262. [44] D.H. Wu, H. Liang, S.N. Lu, H. Wang, Z.L. Su, L. Zhang, J.Q. Ma, M. Guo, S. Tai, S. Yu, miR-124 suppresses pancreatic ductal adenocarcinoma growth by regulating monocarboxylate transporter 1-mediated cancer lactate metabolism, Cell. Physiol. Biochem. 50 (3) (2018) 924–935. [45] D. Ishikawa, C. Takasu, H. Kashihara, M. Nishi, T. Tokunaga, J. Higashijima, K. Yoshikawa, K. Yasutomo, M. Shimada, The significance of MicroRNA-449a and its potential target HDAC1 in patients with colorectal cancer, Anticancer Res. 39 (6) (2019) 2855–2860. [46] H. Meng, Q. Huang, X. Zhang, J. Huang, R. Shen, B. Zhang, MiR-449a regulates the cell migration and invasion of human non-small cell lung carcinoma by targeting ADAM10, Onco. Ther. 12 (2019) 3829–3838. [47] A.Y. Wu, Y. Hu, W. Cang, D. Li, W.J. Wang, Q. Tian, L.Y. Gu, N. Zhang, F. Ji, L.H. Qiu, Suppressive effect of microRNA-449a on the NDRG1/PTEN/AKT axis regulates endometrial cancer growth and metastasis, Exp. Cell Res. (2019).
resveratrol, BMC Immunol. 19 (1) (2018) 7. [12] A. Wang, X. Dai, B. Cui, X. Fei, Y. Chen, J. Zhang, Q. Zhang, Y. Zhao, Z. Wang, H. Chen, Q. Lan, J. Dong, Q. Huang, Experimental research of host macrophage canceration induced by glioma stem progenitor cells, Mol. Med. Rep. 11 (4) (2015) 2435–2442. [13] S. Yadav, S.K. Pandey, Y. Goel, M.K. Temre, S.M. Singh, Diverse stakeholders of tumor metabolism: an appraisal of the emerging approach of multifaceted metabolic targeting by 3-bromopyruvate, Front. Pharmacol. 10 (2019) 728. [14] M. Pichla, J. Sroka, N. Pienkowska, K. Piwowarczyk, Z. Madeja, G. Bartosz, I. Sadowska-Bartosz, Metastatic prostate cancer cells are highly sensitive to 3-bromopyruvic acid, Life Sci. 227 (2019) 212–223. [15] E.J. Cho, S.J. Yu, K. Kim, H. Cho, Y.Y. Cho, Y.B. Lee, J.H. Lee, Y.J. Kim, H. Youn, J.H. Yoon, Carbonic anhydrase-IX inhibition enhances the efficacy of hexokinase II inhibitor for hepatocellular carcinoma in a murine model, J. Bioenerg. Biomembr. 51 (2) (2019) 121–129. [16] T.C. Chen, J. Yu, E. Nouri Nigjeh, W. Wang, P.T. Myint, E. Zandi, F.M. Hofman, A.H. Schonthal, A perillyl alcohol-conjugated analog of 3-bromopyruvate without cellular uptake dependency on monocarboxylate transporter 1 and with activity in 3-BP-resistant tumor cells, Cancer Lett. 400 (2017) 161–174. [17] Z. Tang, S. Yuan, Y. Hu, H. Zhang, W. Wu, Z. Zeng, J. Yang, J. Yun, R. Xu, P. Huang, Over-expression of GAPDH in human colorectal carcinoma as a preferred target of 3-bromopyruvate propyl ester, J. Bioenerg. Biomembr. 44 (1) (2012) 117–125. [18] S. Yadav, S.K. Pandey, A. Kumar, P.K. Kujur, R.P. Singh, S.M. Singh, Antitumor and chemosensitizing action of 3-bromopyruvate: implication of deregulated metabolism, Chem. Biol. Interact. 270 (2017) 73–89. [19] M. Yamada, M. Kagaya, N. Noguchi, S. Ueki, N. Hasunuma, S.I. Osada, M. Manabe, Topical 3-bromopyruvate is a novel targeted therapy for melanoma in a preclinical model, J. Dermatol. Sci. 92 (2) (2018) 134–142. [20] J.J. Yoo, S.J. Yu, J. Na, K. Kim, Y.Y. Cho, Y.B. Lee, E.J. Cho, J.H. Lee, Y.J. Kim, H. Youn, J.H. Yoon, Hexokinase-II inhibition synergistically augments the antitumor efficacy of sorafenib in hepatocellular carcinoma, Int. J. Mol. Sci. 20 (6) (2019). [21] Y. Ishiguro, M. Kobayashi, M. Ideno, K. Narumi, A. Furugen, K. Iseki, Valproate sensitizes human glioblastoma cells to 3-bromopyruvate-induced cytotoxicity, Int. J. Pharm. 551 (1-2) (2018) 97–102. [22] D. Chiasserini, M. Davidescu, P.L. Orvietani, F. Susta, L. Macchioni, M. Petricciuolo, E. Castigli, R. Roberti, L. Binaglia, L. Corazzi, 3-Bromopyruvate treatment induces alterations of metabolic and stress-related pathways in glioblastoma cells, J. Proteomics 152 (2017) 329–338. [23] C. Guo, T. Huang, Q.H. Wang, H. Li, A. Khanal, E.H. Kang, W. Zhang, H.T. Niu, Z. Dong, Y.W. Cao, Monocarboxylate transporter 1 and monocarboxylate transporter 4 in cancer-endothelial co-culturing microenvironments promote proliferation, migration, and invasion of renal cancer cells, Cancer Cell Int. 19 (2019) 170. [24] L. Liu, S. Cui, T. Wan, X. Li, W. Tian, R. Zhang, L. Luo, Y. Shi, Long non-coding RNA HOTAIR acts as a competing endogenous RNA to promote glioma progression by sponging miR-126-5p, J. Cell. Physiol. 233 (9) (2018) 6822–6831. [25] H.G. Zhou, J.D. Zhang, Y.F. Zhang, [The effect of downregulation of MCT1 on the proliferation of glioma cells], Zhonghua Zhong Liu Za Zhi 41 (3) (2019) 208–213. [26] J. Afonso, T. Pinto, S. Simoes-Sousa, F. Schmitt, A. Longatto-Filho, C. Pinheiro, H. Marques, F. Baltazar, Clinical significance of metabolism-related biomarkers in non-Hodgkin lymphoma - MCT1 as potential target in diffuse large B cell lymphoma, Cell. Oncol. (Dordr) 42 (3) (2019) 303–318. [27] Q.X. Li, P. Zhang, F. Liu, X.Z. Wang, L. Li, Z.K. Wang, C.C. Jiang, H.L. Zheng, H. Liu, [Monocarboxylate transporter 1 enhances the sensitivity of breast cancer cells to 3bromopyruvate in vitro], Nan Fang Yi Ke Da Xue Xue Bao 37 (5) (2017) 588–593. [28] Z. Liu, Y. Sun, H. Hong, S. Zhao, X. Zou, R. Ma, C. Jiang, Z. Wang, H. Li, H. Liu, 3bromopyruvate enhanced daunorubicin-induced cytotoxicity involved in monocarboxylate transporter 1 in breast cancer cells, Am. J. Cancer Res. 5 (9) (2015) 2673–2685. [29] A. Aspatwar, M.E.E. Tolvanen, H.P. Schneider, H.M. Becker, S. Narkilahti, S. Parkkila, J.W. Deitmer, Catalytically inactive carbonic anhydrase-related proteins enhance transport of lactate by MCT1, FEBS Open Bio 9 (7) (2019)
7
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
3-Bromopyruvate inhibits the malignant phenotype of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment via miR-449a/MCT1
T
Yujing Shenga,1, Qianqian Jianga,1, Xuchen Donga,1, Jiachi Liua, Liang Liua, Haiyang Wanga, Liping Wanga, Haoran Lia, Xuejun Yangb, Jun Donga,* a b
Department of Neurosurgery, The Second Affiliated Hospital of Soochow University, 1055 Sanxiang Road, Suzhou 215004, China Department of Neurosurgery, Tianjin Medical University General Hospital, 154 Anshan Road, Tianjin 300052, China
A R T I C LE I N FO
A B S T R A C T
Keywords: 3-BrPA Glioma microenvironment Macrophages Dendritic cells MCT1
Bromopyruvate (3-BrPA) is a glycolysis inhibitor that has been reported to have a strong anti-tumour effect in many human tumours. Several studies have reported that 3-BrPA could inhibit glioma progression; however, its role on the interstitial cells in the glioma microenvironment has not been investigated. In previous studies, we found that in the glioma microenvironment, glioma stem cells can induce the malignant transformation of macrophages and dendritic cells. In this study, we focused on the effects of 3-BrPA on malignantly transformed macrophages and dendritic cells. First, we found that 3-BrPA inhibited the proliferation of malignantly transformed macrophages and dendritic cells in a dose-dependent and time-dependent manner. Further study indicated that 3-BrPA significantly decreased extracellular lactate and inhibited the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells. Using an online database and a series of experiments, we demonstrated that 3-BrPA inhibits the malignant progression of malignantly transformed macrophages and dendritic cells via the miR-449a/MCT1 axis. These findings built experimental basis for new approach against glioma.
1. Introduction Glioma is the most common primary tumour of the central nervous system [1,2]. The prognosis of patients with high-grade glioma is very poor, and the median survival time is approximately 15 months [3,4]. To make matters worse, high-grade glioma recurs frequently after surgery. With the continuous improvement of comprehensive treatments that consist of surgical resection, chemotherapy and radiation therapy, the treatment efficacy in patients with high-grade gliomas has been improved; however, the survival of patients is still limited [5]. Thus, it is urgent to explore the potential mechanism of glioma development. In addition to cancer cells, there are various interstitial cells that together constitute the tumour microenvironment in solid tumour tissues, including glioma [6]. One main reason for the lack of effective treatments for glioma is the existence of a subpopulation of cells with self-renewal and tumour-initiating abilities in the tumour microenvironment, namely, glioma stem cells (GSCs) [7,8]. Studies have
shown that GSCs can not only maintain self-renewal and promote tumour initiation but also induce the malignant transformation of other stromal cells in the tumour microenvironment, such as bone marrow mesenchymal stem cells (BMSCs), macrophages and dendritic cells [7,9,10]. Macrophages and dendritic cells are important components of the human immune response against glioma. In our previous studies, we demonstrated that macrophages and dendritic cells in the glioma microenvironment can be induced and undergo malignant transformation by GSCs, which is conducive to the survival and development of GSCs [11,12]. These studies suggest that malignantly transformed macrophages and dendritic cells can be applied as targets for the treatment of glioma. Further elucidating the mechanism of malignant progression of malignantly transformed macrophages and dendritic cells will provide new methods for glioma treatment. 3-Bromopyruvate (3-BrPA) is a glycolysis inhibitor and tumour energy blocker with strong anti-tumour effects in vitro and in vivo [13–15]. It induces apoptosis by inducing intracellular ATP depletion by cooperating with hexokinase II (HK2) and glyceraldehyde-3-
⁎
Corresponding author at: Department of Neurosurgery, The Second Affiliated Hospital of Soochow University, 1055 Sanxiang Road, Suzhou 215004, China. E-mail address: [email protected] (J. Dong). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.biopha.2019.109610 Received 8 August 2019; Received in revised form 24 October 2019; Accepted 25 October 2019 0753-3322/ © 2019 Second Affiliated Hospital of Soochow University. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
dehydrogenase (GAPDH) [16,17]. At the same time, it inhibits the activity of succinate dehydrogenase (SDH), resulting in an imbalance in the intracellular redox state [18]. The latest studies suggested that 3BrPA could inhibit the malignant progression of many types of tumours. For example, Pichla M showed that 3-BrPA could suppress the migration of human metastatic prostate cells [14]. Yamada M et al. reported that 3-BrPA is an innovative strategy for unresectable melanoma and possibly other skin cancers [19]. Yoo JJ et al. showed that 3-BrPA could increase the anti-tumour efficacy of sorafenib in hepatocellular carcinoma [20]. Studies have also demonstrated that 3-BrPA could inhibit the proliferation of glioma cell lines [21,22]; however, its effect on malignantly transformed macrophages and dendritic cells in the microenvironment of glioma has not been studied. Therefore, it is of great significance to further study the function and potential mechanism of 3BrPA in malignantly transformed macrophages and dendritic cells, which will provide a theoretical basis for the formulation of immunotherapy strategies for glioma. In our study, we found that 3-BrPA could significantly decrease extracellular lactate and inhibit the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells. Next, through a series of experiments, we showed that 3-BrPA affects these biological behaviours of malignantly transformed macrophages and dendritic cells through MCT1. Our study further suggested that in malignantly transformed macrophages and dendritic cells, MCT1 is regulated by miR-449a. Overall, we reported for the first time that 3BrPA inhibits the malignant phenotype of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment via miR-449a/MCT1, which may provide a novel strategy for glioma therapy.
Table 1 The primer sequences used in the present study. Gene
Primer Sequence
MCT1
forward primer: 5′- TTGTGGAATGCTGTCCTGTC -3′ reverse primer: 5′- ACATGTCATTGAGCCGACCT -3′ forward primer: 5′- TGGCAGTGTATTGTTA -3′ reverse primer: 5′- ATCCAGTGCAGGGTCCGAGG -3′ forward primer:5′- CTCCATCCTGGCCTCGCTGT -3′ reverse primer:5′- GCTGTCACCTTCACCGTTCC -3′ forward primer: 5′- CTCGCTTCGGCAGCACA -3′ reverse primer: 5′- AACGCTTCACGAATTTGCGT -3′
miR-449a β-actin U6
Finally, luciferase activities were normalized using renilla luciferase activities. 2.5. Western blot analysis Total protein was extracted from cells using RIPA lysis buffer (Beyotime, Shanghai, China) according to the manufacturer's protocol. Total protein was quantified using a BCA protein assay kit (Beyotime, Shanghai, China). Next, the proteins were separated by SDS-PAGE (10%). The separated proteins were transferred onto PVDF membranes (Millipore, MA, USA), followed by blocking for 2 h at room temperature with 5% skimmed milk. Then, the membranes were incubated with an MCT1 primary antibody (1:100, ab135593, Abcam, Cambridge, MA, USA) and next with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3,000, 7074S, CST, MA, USA). β-actin (1:1000, bs10966R, Bioss, Beijing, China) used as control. Finally, the bands were visualized under an Image Quant LAS 4000 min. (GE, CT, USA).
2. Materials and methods
2.6. Lactate measurement
2.1. Cell lines and cell culture
Lactate was quantified using an l-Lactic Acid (l-Lactate) Assay Kit (Megazyme, Ireland) according to the manufacturer’s protocol. In detail, cell samples were collected from the culture medium after centrifugation. The lactic acid concentration calibration reagents were added to the supernatant samples, and the samples were incubated for 5 min at 37 °C. The OD values at 340 nm were obtained from a plate reader, and the concentration of lactate was calculated following the formula specified in the manual. [23]
Malignantly transformed macrophages (tMø) and dendritic cells (tDC) induced by glioma stem cells in the glioma microenvironment were obtained and tested as described previously [11,12]. The two cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, NY, USA) supplemented with 10% foetal bovine serum (FBS, ScienCell, LA, USA) and maintained in a 37 °C, 5% CO2 incubator. 2.2. Oligonucleotides, cell transfection and plasmid construction
2.7. CCK-8 assays The oligonucleotides used in this study were all purchased from GenePharma (Shanghai, China). The relevant RNAs were chemically synthesized and inserted into the pHBLV-U6 lentivirus core vector (Hanbio, Shanghai, China). Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) was used for cell transfection according to the manufacturer’s protocols.
A CCK-8 (Beyotime, Shanghai, China) assay was performed according to the manufacturer's protocol. Cells were seeded into 96-well plates in 100 μl of culture media. The medium of each well was subsequently replaced with 100 μl of fresh culture media with 10% CCK-8 reagent at different times (1, 2, and 3 d), and the cells were then incubated for an additional 3 h. The absorbance was measured at an optical density of 450 nm using a microplate reader.
2.3. Real-time quantitative reverse transcription PCR
2.8. Clone formation assay
Total RNA was isolated with TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. cDNA was obtained using Fermentas reverse transcription reagent, and quantitative reverse transcription PCR (qRT-PCR) was conducted with SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, MA, USA) according to the manufacturer’s protocols. The primer sequences used in the present study are shown in Table 1.
Cells were seeded at a density of 100 cells/well in a culture dish (60 mm, Corning, NY, USA) and maintained at 37 °C in a 5% CO2 incubator. Twelve days later, the cells were fixed for 5 min with paraformaldehyde and stained for 20 min with crystal violet. 2.9. Migration and invasion assays
2.4. Luciferase reporter assay For the invasion assay, chamber inserts (Merck Millipore, Germany) were pre-coated with 45 μl of Matrigel (1:8 dilution; BD Bioscience, NJ, USA). For both assays, 5 × 104 cells in serum-free medium were seeded into the upper chambers, and DMEM containing 10% FBS was added to the lower chamber. After incubation for 48 h at 37 °C in a 5% CO2
Luciferase activity was analysed using the Dual‐Luciferase Reporter Assay System (Promega, WI, USA) according to the manufacturer's protocol. The luciferase vectors combined with miR-449a were transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). 2
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
incubator, the chambers were fixed using 4% paraformaldehyde for 5 min, stained with a crystal violet solution for 30 min and washed three times with PBS (Gibco, NY, USA). Stained cells were observed under an optical microscope and counted, and the mean was calculated. [24]
3.3. 3-BrPA regulates the lactate metabolism, clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells by suppressing MCT1 To further elucidate the potential mechanism by which 3-BrPA inhibits the progression of malignantly transformed macrophages and dendritic cells, we tried to find the effector target of 3-BrPA. As a downstream gene of the myelocytomatosis proto-oncogene (myc), numerous studies have shown that monocarboxylate transporters (MCTs) are closely related to the metabolism of various tumours and that MCT1 is an important member of the MCT family [25,26]. Existing studies have suggested that, in a variety of tumours, there is a very close relationship between MCT1 and 3-BrPA [27,28]. In addition, studies have shown that MCT1 is an important carrier of intracellular lactate [29]. Combining these findings together, we speculate that the inhibitory effect of 3-BrPA on malignantly transformed macrophages and dendritic cells may be closely related to MCT1. To test our hypothesis, we conducted a series of assays. First, qRT-PCR and Western blot showed that 3-BrPA could inhibit the expression of MCT1 in the two cell lines (Fig. 3A, B). The functional assays indicated that MCT1 could increase extracellular lactate and promote the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells. Moreover, the effect of 3-BrPA on malignantly transformed macrophages and dendritic cells could be restored by the MCT1 plasmid (Fig. 3C-I). Taken together, these results indicated that 3-BrPA regulates the lactate metabolism, clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells by suppressing MCT1.
2.10. Statistical analysis SPSS 13.0 software was used for statistical data analysis. All data are expressed as the mean ± standard error. A t-test (two groups) or oneway ANOVA (no less than three groups) was used to analyse the statistical significance. Differences of P < 0.05 (*) and P < 0.01 (**) were considered statistically significant and very significant, respectively. All experiments were repeated three times independently. 3. Results 3.1. 3-BrPA inhibits the proliferation of malignantly transformed macrophages and dendritic cells in a dose-dependent and time-dependent manner To explore the effect of 3-BrPA on malignantly transformed macrophages and dendritic cells, the two cell lines were treated with 3-BrPA at different concentrations. After 48 h or 72 h, cell viability was evaluated by CCK-8 assays. The results showed that 3-BrPA inhibited the proliferation of the two cell lines in a dose-dependent and time-dependent manner (Fig. 1). In addition, we checked the IC50 s of 3-BrPA on the two cell lines and found that the IC50 s were closer to 100 umol/ L than other concentrations. Thus, we used the indicated concentration (100 umol/L) for further study.
3.4. 3-BrPA suppresses MCT1 through miR-449a To reveal the potential mechanism by which 3-BrPA suppresses MCT1 expression, we performed further experiments. MicroRNAs (miRNAs) are an important type of non-coding RNA (ncRNA) that can interact with the 3′-untranslated region of their target message RNAs (mRNAs), resulting in gene expression changes [30,31]. In recent years, a large number of studies have shown that miRNA is closely related to the development of various human tumours [32,33]. Here, we suggest that MCT1 may be regulated by miRNAs. Using an online database, miR-449a was selected for the following study (Fig. 4A). To test the regulatory relationship between miR-449a and MCT1, miR-449a mimics were synthesized and transfected into malignantly transformed macrophages and dendritic cells. Western blot results showed that miR449a mimics suppress MCT1 expression (Fig. 4B). In addition, a luciferase reporter assay was conducted, and the results indicated that miR449a significantly suppressed the luciferase activity of cells transfected with the wild-type MCT1-3′UTR but had no significant effect on the luciferase activity of cells transfected with the mutant-type MCT13′UTR (Fig. 4C). We also detected the expression level of miR-449a in the two cell lines treated with 3-BrPA and found that 3-BrPA could upregulate the expression of miR-449a (Fig. 4D). Next, we verified the relationship between miR-449a and MCT1 through a series of functional assays. The validity of the miR-449a mimics and MCT1 plasmid was confirmed by qRT-PCR and western blot analysis (Fig. 5A-C). Moreover, functional assays showed that the miR-449a mimics decreased lactate secretion and inhibited clone formation, migration and invasion in malignantly transformed macrophages and dendritic cells. The effects of miR-449a mimics on lactate secretion, clone formation, migration and invasion were restored by the MCT1 plasmid (Fig. 5D-K). Thus, we conclude that 3-BrPA suppresses MCT1 in a miR-449a-dependent manner.
3.2. 3-BrPA significantly decreases extracellular lactate and inhibits the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells 3-BrPA is known to be a glycolysis inhibitor and energy blocker, so we wondered if it could affect energy metabolism in these two cell lines. To answer our question, we measured extracellular lactate in the cell lines after treated with negative control or 3-BrPA for 48 h respectively, and the results indicated that 3-BrPA could decrease these levels in both cell lines (Fig. 2A, B). Next, clone formation assays, migration assays and transwell assays were performed to evaluate the effect of 3-BrPA on cell clone formation ability, migration ability and invasion ability, respectively. The results showed that 3-BrPA significantly inhibited the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells (Fig. 2C-H). Based on these results, we concluded that 3-BrPA could inhibit the progression of malignantly transformed macrophages and dendritic cells.
Fig. 1. 3-BrPA inhibited the viability of tMø and tDC. (A) tMø were incubated with 3-BrPA at the indicated concentrations for 48 h or 72 h. (B) tDC were incubated with 3-BrPA at the indicated concentrations for 48 h or 72 h. *P < 0.05, **P < 0.01.
4. Discussion Glioma, the most common primary intracranial tumour, originates from the glial cells of the brain [34]. The annual incidence rate of 3
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
Fig. 2. 3-BrPA significantly decreased extracellular lactate and inhibited the clone formation, migration and invasion of tMø and tDC. (A–B) 3-BrPA (100 μmol/L) significantly decreased the extracellular lactate level of tMø and tDC. (C–D) 3-BrPA (100 μmol/L) inhibited the clone formation of tMø and tDC. (E–F) 3-BrPA (100 μmol/L) inhibited the migration of tMø and tDC. (G–H) 3-BrPA (100 μmol/L) inhibited the invasion of tMø and tDC. DMEM containing 10% FBS and 0.1% DMSO was used as the negative control. **P < 0.01.
transport of lactate between astrocytes and neurons in brain tissue [25,29,40]. Mounting evidence indicates that MCT1 is closely related to various human tumours. For example, Afonso et al. found that in diffuse large B cell lymphoma, MCT1 is associated with the clinicopathological profile [26]. Chen et al. reported that MCT1 could be used as a prognostic biomarker for oesophageal squamous cell carcinoma [41]. Guan et al. demonstrated that MCT1 is associated with the progression of breast cancer [42]. Through a literature search, we found that 3-BrPA and MCT1 are closely related in the progression of tumours. For example, Li et al. showed that MCT1 could enhance the sensitivity of breast cancer cells to 3-BrPA [27]. Liu et al. indicated that 3-BrPA enhanced daunorubicininduced cytotoxicity involved in MCT1 in breast cancer cells [28]. However, until now, the relationship between MCT1 and 3-BrPA in the glioma microenvironment has not been studied. In this study, we found that the inhibitory effect of 3-BrPA on the lactate metabolism, clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells could be altered by the MCT1 plasmid. MiRNAs, which are important ncRNAs, play critical roles in gene expression. Their role in tumours is well recognized by researchers. MCT1 has been reported to be regulated by numerous miRNAs. For example, miR-425 targets MCT1 to regulate liver damage [43]. MiR124 inhibits pancreatic ductal adenocarcinoma progression by targeting MCT1 [44]. To further elucidate the mechanism by which MCT1 promotes the malignant progression of malignantly transformed macrophages and dendritic cells, we used an online database and found that MCT1 may be regulated by miR-449a. Recent research has suggested that miR-449a can inhibit the progression of many tumours [45–47]. Through a series of experiments, we proved that 3-BrPA could upregulate the expression of miR-449a, which directly targets MCT1. To sum up, 3-Bromopyruvate inhibits the growth of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment via miR-449a/MCT1 axis.
glioma in China is 5-8/100,000, and the 5-year mortality rate is second to only pancreatic cancer and lung cancer for systemic tumours [35]. The treatment of glioma is a serious challenge in neuro-oncologist. It is a common goal of researchers to explore the occurrence and development of glioma to find more effective treatment. In our previous studies, we confirmed that GSCs could induced malignant transformation of macrophages and dendritic cells in the glioma microenvironment [11,12]. For further study, we cloned the malignantly transformed macrophages (tMø) and dendritic cells (tDC). Compared the biological behavior of macrophages and dendritic cells before or after malignant transformation with the wildly recognized glioma cell lines (U87, U251, LN229 and T98 G). We found that after malignant transformation, the clone formation, migration and invasion of macrophages and dendritic cells are enhanced and was similar to LN229 (Fig. S1). In addition, we co-cultured normal macrophages and normal dendritic cells with GSCs respectively, and the obtained cells were named cMø and cDC. Through a series of functional assays, we found that, compared with normal macrophages and dendritic cells, the clone formation, migration and invasion of cMø and cDC was significantly enhanced. More interesting, there is no statistical difference between malignantly transformed cells (tMø and tDC) and co-cultured cells (cMø and cDC) on clone formation, migration and invasion (Fig. S2). These results indicate that tMø and tDC play a vital role in glioma development. 3-BrPA, a small molecule and an analogue of pyruvate, could inactivate various key molecules related to metabolism. In 2001, Ko YH et al. reported for the first time that 3-BrPA has anti-liver cancer potential [36]. Since then, 3-BrPA has been shown to have therapeutic effects on a variety of tumours. For example, Wang et al. reported that 3-BrPA could suppress gastric cancer cell proliferation and decrease lactate production [37]. Zou et al. showed that 3-BrPA effectively induced nasopharyngeal carcinoma cell apoptosis by inhibiting glycolysis and ATP production [38]. Konstantakou et al. found that 3-BrPA could markedly reduce active bladder cancer cell apoptosis [39]. In this study, we found that 3-BrPA significantly decreased extracellular lactate and inhibited the clone formation, migration and invasion of malignantly transformed macrophages and dendritic cells induced by glioma stem cells in the glioma microenvironment. MCT1, also known as SLC16A1, plays an important role in the
5. Conclusions In this study, we showed that 3-BrPA could inhibit the progression of malignantly transformed macrophages and dendritic cells induced by 4
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
Fig. 3. 3-BrPA regulated the lactate metabolism, clone formation, migration and invasion of tMø and tDC by suppressing MCT1. B) qRT-PCR and Western blot show the MCT1 expression in tMø and tDC treated with 3-BrPA (100 μmol/L). (C) Lactate measurement assay shows the extracellular lactate level of cells treated with 3BrPA (100 μmol/L) in the presence or absence of MCT1 overexpression. (D–E) Clone formation assays show the clone formation ability of cells treated with 3-BrPA (100 μmol/L) in the presence or absence of MCT1 overexpression. (F–G) Migration assays show the migration ability of cells treated with 3-BrPA (100 μmol/ L) in the presence or absence of MCT1 overexpression. (H–I) Invasion assays show the migration ability of cells treated with 3-BrPA (100 μmol/ L) in the presence or absence of MCT1 overexpression. **P < 0.01.
Fig. 4. MCT1 was negatively regulated by miR-449a in tMø and tDC. (A) The putative binding sites between miR-449a and MCT1. (B) Western blot assay shows the expression of MCT1 in tMø and tDC transfected with NC or miR-449a mimics. (C) MiR-449a downregulated the luciferase activity of the wild-type MCT1 3′-UTR expression vector but did not reduce the expression of a mutant MCT1 3′-UTR. (D) qRT-PCR shows miR-449a expression in tMø and tDC treated with 3-BrPA (100 μmol/L). **P < 0.01. 5
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
Fig. 5. 3-BrPA suppressed MCT1 through miR-449a. C) Expression of MCT1 in tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. (D–E) A lactate measurement assay shows the extracellular lactate levels of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with the MCT1 plasmid. (F–G) Clone formation assays show the clone formation ability of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. (H–I) Migration assays show the migration ability of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. (J–K) Invasion assays show the invasion ability of tMø and tDC transfected with NC, miR-449a mimics or miR-449a mimics together with MCT1 plasmid. **P < 0.01.
glioma stem cells in the glioma microenvironment and that the miR449a/MCT1 axis is involved in the mechanism. These findings built experimental basis for new approach against glioma.
[2] J.J. Miller, F. Loebel, T.A. Juratli, S.S. Tummala, E.A. Williams, T.T. Batchelor, I. Arrillaga-Romany, D.P. Cahill, Accelerated progression of IDH mutant glioma after first recurrence, Neuro Oncol. 21 (5) (2019) 669–677. [3] E.V. Walker, F.G. Davis, Malignant primary brain and other central nervous system tumors diagnosed in Canada from 2009 to 2013, Neuro Oncol. 21 (3) (2019) 360–369. [4] L. Liu, S. Cui, R. Zhang, Y. Shi, L. Luo, MiR-421 inhibits the malignant phenotype in glioma by directly targeting MEF2D, Am. J. Cancer Res. 7 (4) (2017) 857–868. [5] J. Wang, M. Zhang, W. Lu, Long noncoding RNA GACAT3 promotes glioma progression by sponging miR-135a, J. Cell. Physiol. 234 (7) (2019) 10877–10887. [6] T. Xie, B. Liu, C.G. Dai, Z.H. Lu, J. Dong, Q. Huang, Glioma stem cells reconstruct similar immunoinflammatory microenvironment in different transplant sites and induce malignant transformation of tumor microenvironment cells, J. Cancer Res. Clin. Oncol. 145 (2) (2019) 321–328. [7] Y. Zhao, J. Chen, X. Dai, H. Cai, X. Ji, Y. Sheng, H. Liu, L. Yang, Y. Chen, D. Xi, M. Sheng, Y. Xue, J. Shi, J. Liu, X. Li, J. Dong, Human glioma stem-like cells induce malignant transformation of bone marrow mesenchymal stem cells by activating TERT expression, Oncotarget 8 (61) (2017) 104418–104429. [8] S.M. Wang, H.Y. Lin, Y.L. Chen, T.I. Hsu, J.Y. Chuang, T.J. Kao, C.Y. Ko, CCAAT/ enhancer-binding protein delta regulates the stemness of glioma stem-like cells through activating PDGFA expression upon inflammatory stimulation, J. Neuroinflamm. 16 (1) (2019) 146. [9] S. Zhu, X. Lv, X. Zhang, T. Li, G. Zang, N. Yang, X. Wang, J. Wu, W. Chen, Y.J. Liu, J. Chen, An effective dendritic cell-based vaccine containing glioma stem-like cell lysate and CpG adjuvant for an orthotopic mouse model of glioma, Int. J. Cancer 144 (11) (2019) 2867–2879. [10] K. Gabrusiewicz, X. Li, J. Wei, Y. Hashimoto, A.L. Marisetty, M. Ott, F. Wang, D. Hawke, J. Yu, L.M. Healy, A. Hossain, J.C. Akers, S.N. Maiti, S. Yamashita, Y. Shimizu, K. Dunner, M.A. Zal, J.K. Burks, J. Gumin, F. Nwajei, A. Rezavanian, S. Zhou, G. Rao, R. Sawaya, G.N. Fuller, J.T. Huse, J.P. Antel, S. Li, L. Cooper, E.P. Sulman, C. Chen, C. Geula, R. Kalluri, T. Zal, A.B. Heimberger, Glioblastoma stem cell-derived exosomes induce M2 macrophages and PD-L1 expression on human monocytes, Oncoimmunology 7 (4) (2018) e1412909. [11] X. Fei, A. Wang, D. Wang, X. Meng, J. Ma, L. Hong, R. Qin, A. Wang, J. Dong, Q. Huang, Z. Wang, Establishment of malignantly transformed dendritic cell line SU3-ihDCTC induced by Glioma stem cells and study on its sensitivity to
Declaration of Competing Interest All authors agree with the content and the submission of this manuscript. All authors do not have any conflicts of interest. All authors declare that the material is original research and has not been previously published and is not currently being considered for publication elsewhere. Acknowledgements This study was supported by grants from National Natural Science Foundation of China (No. 81472739) and the Clinical Special Disease Diagnosis and Treatment Technology in Suzhou (No. LCZX201807) Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109610. References [1] L. Liu, Y. Shi, J. Shi, H. Wang, Y. Sheng, Q. Jiang, H. Chen, X. Li, J. Dong, The long non-coding RNA SNHG1 promotes glioma progression by competitively binding to miR-194 to regulate PHLDA1 expression, Cell Death Dis. 10 (6) (2019) 463.
6
Biomedicine & Pharmacotherapy 121 (2020) 109610
Y. Sheng, et al.
1204–1211. [30] H. Chen, L. Liu, X. Li, Y. Shi, N. Liu, MicroRNA-1294 inhibits the proliferation and enhances the chemosensitivity of glioma to temozolomide via the direct targeting of TPX2, Am. J. Cancer Res. 8 (2) (2018) 291–301. [31] T. Xu, W. Yu, Q. Li, X. Li, Y. Shi, B. Cao, Y. Zhang, S. Wang, Y. Zhang, T. Wang, B. Huang, MicroRNA-524 inhibits the progress of glioma via the direct targeting of NCF2, Am. J. Transl. Res. 11 (3) (2019) 1605–1615. [32] W. Pan, L.J. Pang, H.L. Cai, Y. Wu, W. Zhang, J.C. Fang, MiR-1294 acts as a tumor suppressor in clear cell renal cell carcinoma through targeting HOXA6, Eur. Rev. Med. Pharmacol. Sci. 23 (9) (2019) 3719–3725. [33] G. Peng, C. Yang, Y. Liu, C. Shen, miR-25-3p promotes glioma cell proliferation and migration by targeting FBXW7 and DKK3, Exp. Ther. Med. 18 (1) (2019) 769–778. [34] L. Zhu, Q. Wang, Y. Hu, F. Wang, The circadian gene Per1 plays an important role in radiation-induced apoptosis and DNA damage in glioma, Asian Pac. J. Cancer Prev. 20 (7) (2019) 2195–2201. [35] L. Ma, H. Wang, Z. Li, X. Geng, M. Li, Chemokine (C-C motif) ligand 18 is highly expressed in glioma tissues and promotes invasion of glioblastoma cells, J. Cancer Res. Ther. 15 (2) (2019) 358–364. [36] J.F. Geschwind, Y.H. Ko, M.S. Torbenson, C. Magee, P.L. Pedersen, Novel therapy for liver cancer: direct intraarterial injection of a potent inhibitor of ATP production, Cancer Res. 62 (14) (2002) 3909–3913. [37] T.A. Wang, X.D. Zhang, X.Y. Guo, S.L. Xian, Y.F. Lu, 3-bromopyruvate and sodium citrate target glycolysis, suppress survivin, and induce mitochondrial-mediated apoptosis in gastric cancer cells and inhibit gastric orthotopic transplantation tumor growth, Oncol. Rep. 35 (3) (2016) 1287–1296. [38] X. Zou, M. Zhang, Y. Sun, S. Zhao, Y. Wei, X. Zhang, C. Jiang, H. Liu, Inhibitory effects of 3-bromopyruvate in human nasopharyngeal carcinoma cells, Oncol. Rep. 34 (4) (2015) 1895–1904. [39] E.G. Konstantakou, G.E. Voutsinas, A.D. Velentzas, A.S. Basogianni, E. Paronis, E. Balafas, N. Kostomitsopoulos, K.N. Syrigos, E. Anastasiadou, D.J. Stravopodis, 3BrPA eliminates human bladder cancer cells with highly oncogenic signatures via engagement of specific death programs and perturbation of multiple signaling and metabolic determinants, Mol. Cancer 14 (2015) 135. [40] T. Medin, H. Medin, M.B. Hefte, J. Storm-Mathisen, L.H. Bergersen, Upregulation of the lactate transporter monocarboxylate transporter 1 at the blood-brain barrier in a rat model of attention-deficit/hyperactivity disorder suggests hyperactivity could be a form of self-treatment, Behav. Brain Res. 360 (2019) 279–285. [41] X. Chen, X. Chen, F. Liu, Q. Yuan, K. Zhang, W. Zhou, S. Guan, Y. Wang, S. Mi, Y. Cheng, Monocarboxylate transporter 1 is an independent prognostic factor in esophageal squamous cell carcinoma, Oncol. Rep. 41 (4) (2019) 2529–2539. [42] X. Guan, V. Rodriguez-Cruz, M.E. Morris, Cellular uptake of MCT1 inhibitors ARC155858 and AZD3965 and their effects on MCT-mediated transport of L-Lactate in murine 4T1 breast tumor cancer cells, AAPS J. 21 (2) (2019) 13. [43] L. Lang, B. Xu, S.Z. Li, W. Guo, J. Yuan, S. Zang, Y. Chen, H.M. Yang, S. Lian, RnomiR-425-5p targets the DLST and SLC16A1 genes to reduce liver damage caused by excessive energy mobilization under cold stress, J. Anim. Physiol. Anim. Nutr. (Berl) 103 (4) (2019) 1251–1262. [44] D.H. Wu, H. Liang, S.N. Lu, H. Wang, Z.L. Su, L. Zhang, J.Q. Ma, M. Guo, S. Tai, S. Yu, miR-124 suppresses pancreatic ductal adenocarcinoma growth by regulating monocarboxylate transporter 1-mediated cancer lactate metabolism, Cell. Physiol. Biochem. 50 (3) (2018) 924–935. [45] D. Ishikawa, C. Takasu, H. Kashihara, M. Nishi, T. Tokunaga, J. Higashijima, K. Yoshikawa, K. Yasutomo, M. Shimada, The significance of MicroRNA-449a and its potential target HDAC1 in patients with colorectal cancer, Anticancer Res. 39 (6) (2019) 2855–2860. [46] H. Meng, Q. Huang, X. Zhang, J. Huang, R. Shen, B. Zhang, MiR-449a regulates the cell migration and invasion of human non-small cell lung carcinoma by targeting ADAM10, Onco. Ther. 12 (2019) 3829–3838. [47] A.Y. Wu, Y. Hu, W. Cang, D. Li, W.J. Wang, Q. Tian, L.Y. Gu, N. Zhang, F. Ji, L.H. Qiu, Suppressive effect of microRNA-449a on the NDRG1/PTEN/AKT axis regulates endometrial cancer growth and metastasis, Exp. Cell Res. (2019).
resveratrol, BMC Immunol. 19 (1) (2018) 7. [12] A. Wang, X. Dai, B. Cui, X. Fei, Y. Chen, J. Zhang, Q. Zhang, Y. Zhao, Z. Wang, H. Chen, Q. Lan, J. Dong, Q. Huang, Experimental research of host macrophage canceration induced by glioma stem progenitor cells, Mol. Med. Rep. 11 (4) (2015) 2435–2442. [13] S. Yadav, S.K. Pandey, Y. Goel, M.K. Temre, S.M. Singh, Diverse stakeholders of tumor metabolism: an appraisal of the emerging approach of multifaceted metabolic targeting by 3-bromopyruvate, Front. Pharmacol. 10 (2019) 728. [14] M. Pichla, J. Sroka, N. Pienkowska, K. Piwowarczyk, Z. Madeja, G. Bartosz, I. Sadowska-Bartosz, Metastatic prostate cancer cells are highly sensitive to 3-bromopyruvic acid, Life Sci. 227 (2019) 212–223. [15] E.J. Cho, S.J. Yu, K. Kim, H. Cho, Y.Y. Cho, Y.B. Lee, J.H. Lee, Y.J. Kim, H. Youn, J.H. Yoon, Carbonic anhydrase-IX inhibition enhances the efficacy of hexokinase II inhibitor for hepatocellular carcinoma in a murine model, J. Bioenerg. Biomembr. 51 (2) (2019) 121–129. [16] T.C. Chen, J. Yu, E. Nouri Nigjeh, W. Wang, P.T. Myint, E. Zandi, F.M. Hofman, A.H. Schonthal, A perillyl alcohol-conjugated analog of 3-bromopyruvate without cellular uptake dependency on monocarboxylate transporter 1 and with activity in 3-BP-resistant tumor cells, Cancer Lett. 400 (2017) 161–174. [17] Z. Tang, S. Yuan, Y. Hu, H. Zhang, W. Wu, Z. Zeng, J. Yang, J. Yun, R. Xu, P. Huang, Over-expression of GAPDH in human colorectal carcinoma as a preferred target of 3-bromopyruvate propyl ester, J. Bioenerg. Biomembr. 44 (1) (2012) 117–125. [18] S. Yadav, S.K. Pandey, A. Kumar, P.K. Kujur, R.P. Singh, S.M. Singh, Antitumor and chemosensitizing action of 3-bromopyruvate: implication of deregulated metabolism, Chem. Biol. Interact. 270 (2017) 73–89. [19] M. Yamada, M. Kagaya, N. Noguchi, S. Ueki, N. Hasunuma, S.I. Osada, M. Manabe, Topical 3-bromopyruvate is a novel targeted therapy for melanoma in a preclinical model, J. Dermatol. Sci. 92 (2) (2018) 134–142. [20] J.J. Yoo, S.J. Yu, J. Na, K. Kim, Y.Y. Cho, Y.B. Lee, E.J. Cho, J.H. Lee, Y.J. Kim, H. Youn, J.H. Yoon, Hexokinase-II inhibition synergistically augments the antitumor efficacy of sorafenib in hepatocellular carcinoma, Int. J. Mol. Sci. 20 (6) (2019). [21] Y. Ishiguro, M. Kobayashi, M. Ideno, K. Narumi, A. Furugen, K. Iseki, Valproate sensitizes human glioblastoma cells to 3-bromopyruvate-induced cytotoxicity, Int. J. Pharm. 551 (1-2) (2018) 97–102. [22] D. Chiasserini, M. Davidescu, P.L. Orvietani, F. Susta, L. Macchioni, M. Petricciuolo, E. Castigli, R. Roberti, L. Binaglia, L. Corazzi, 3-Bromopyruvate treatment induces alterations of metabolic and stress-related pathways in glioblastoma cells, J. Proteomics 152 (2017) 329–338. [23] C. Guo, T. Huang, Q.H. Wang, H. Li, A. Khanal, E.H. Kang, W. Zhang, H.T. Niu, Z. Dong, Y.W. Cao, Monocarboxylate transporter 1 and monocarboxylate transporter 4 in cancer-endothelial co-culturing microenvironments promote proliferation, migration, and invasion of renal cancer cells, Cancer Cell Int. 19 (2019) 170. [24] L. Liu, S. Cui, T. Wan, X. Li, W. Tian, R. Zhang, L. Luo, Y. Shi, Long non-coding RNA HOTAIR acts as a competing endogenous RNA to promote glioma progression by sponging miR-126-5p, J. Cell. Physiol. 233 (9) (2018) 6822–6831. [25] H.G. Zhou, J.D. Zhang, Y.F. Zhang, [The effect of downregulation of MCT1 on the proliferation of glioma cells], Zhonghua Zhong Liu Za Zhi 41 (3) (2019) 208–213. [26] J. Afonso, T. Pinto, S. Simoes-Sousa, F. Schmitt, A. Longatto-Filho, C. Pinheiro, H. Marques, F. Baltazar, Clinical significance of metabolism-related biomarkers in non-Hodgkin lymphoma - MCT1 as potential target in diffuse large B cell lymphoma, Cell. Oncol. (Dordr) 42 (3) (2019) 303–318. [27] Q.X. Li, P. Zhang, F. Liu, X.Z. Wang, L. Li, Z.K. Wang, C.C. Jiang, H.L. Zheng, H. Liu, [Monocarboxylate transporter 1 enhances the sensitivity of breast cancer cells to 3bromopyruvate in vitro], Nan Fang Yi Ke Da Xue Xue Bao 37 (5) (2017) 588–593. [28] Z. Liu, Y. Sun, H. Hong, S. Zhao, X. Zou, R. Ma, C. Jiang, Z. Wang, H. Li, H. Liu, 3bromopyruvate enhanced daunorubicin-induced cytotoxicity involved in monocarboxylate transporter 1 in breast cancer cells, Am. J. Cancer Res. 5 (9) (2015) 2673–2685. [29] A. Aspatwar, M.E.E. Tolvanen, H.P. Schneider, H.M. Becker, S. Narkilahti, S. Parkkila, J.W. Deitmer, Catalytically inactive carbonic anhydrase-related proteins enhance transport of lactate by MCT1, FEBS Open Bio 9 (7) (2019)
7