3-Iodothyronamine increases transient receptor potential melastatin channel 8 (TRPM8) activity in immortalized human corneal epithelial cells

Cellular Signalling 28 (2016) 136–147

Contents lists available at ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

3-Iodothyronamine increases transient receptor potential melastatin channel 8 (TRPM8) activity in immortalized human corneal epithelial cells Alexander Lucius a, Noushafarin Khajavi a, Peter S. Reinach b, Josef Köhrle c, Priyavathi Dhandapani d, Philipp Huimann a, Nina Ljubojevic a, Carsten Grötzinger d, Stefan Mergler a,⁎ a

Klinik für Augenheilkunde, Charité — Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany School of Ophthalmology and Optometry, Wenzhou Medical University, Wenzhou 325027, PR China c Institut für Experimentelle Endokrinologie, Charité — Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany d Gastroenterology, Charité — Universitätsmedizin Berlin, Augustenburger Platz 1, 13353, Berlin, Germany b

a r t i c l e

i n f o

Article history: Received 27 July 2015 Received in revised form 25 November 2015 Accepted 8 December 2015 Available online 10 December 2015 Keywords: Human corneal epithelium Calcium Transient receptor potential melastatin 8 channel Intracellular Ca2+ Thyronamine Dry eye disease Planar patch-clamp technique

a b s t r a c t 3-Iodothyronamine (3T1AM) is an endogenous thyroid hormone metabolite that interacts with the human trace amine-associated receptor 1 (hTAAR1), a G-protein-coupled receptor, to induce numerous physiological responses including dose-dependent body temperature lowering in rodents. 3T1AM also directly activates coldsensitive transient receptor potential melastatin 8 (TRPM8) channels in human conjunctival epithelial cells (HCjEC) at constant temperature as well as reducing rises in IL-6 release induced by transient receptor potential vanilloid 1 (TRPV1) activation by capsaicin (CAP). Here, we describe that 3T1AM-induced TRPM8 activation suppresses through crosstalk TRPV1 activation in immortalized human corneal epithelial cells (HCEC). RT-PCR and immunofluorescent staining identified TRPM8 gene and protein expression. Increases in Ca2+ influx induced by the TRPM8 agonists either 3T1AM (0.1–10 μM), menthol (500 μM), icilin (15–60 μM) or temperature lowering (either b 17 °C or N17 °C) were all blocked by 10–20 μM BCTC, a mixed TRPV1/TRPM8 antagonist. BCTC blocked 3T1AM-induced recombinant TRPM8 activation of Ca2+ transients in an osteosarcoma heterologous expression system. The effects of BCTC in HCEC were attributable to selective TRPM8 inhibition since whole-cell patchclamp currents underlying Ca2+ rises induced by 20 μM CAP were BCTC insensitive. On the other hand, Ca2+ transients induced by activating TRPV1 with either CAP or a hyperosmolar medium were suppressed during exposure to either 1 μM 3T1AM or 15 μM icilin. All of these modulatory effects on intracellular Ca2+ regulation induced by the aforementioned agents were attributable to changes in underlying inward and outward current. Taken together, TRPM8 activation by 3T1AM markedly attenuates and even eliminates hyperosmolar and CAP induced TRPV1 activation through crosstalk. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Corneal transparency and visual acuity maintenance are dependent on continuous epithelial renewal sustaining tissue integrity [1]. In dry eye disease (DED), ocular surface desiccation causes pain, inflammation and loss of visual acuity [2], leading to increases in epithelial shedding and compromise of tight junctional barrier function [1]. There is Abbreviations: HCEC, human corneal epithelial cells; DED, dry eye disease; TAM, thyronamine, 3T 1 AM = 3-iodothyronamine; TRPV, transient receptor potential vanilloid; TRPM, transient receptor potential melastatin; CAP, capsaicin; BCTC, N(4-tertiarybutyl-phenyl)-4-(3-chloropyridin-2-yl) tetrahydropyrazine-1(2H)carboxamide; La 3 + , lanthanum-III-chloride; AMTB, N-(3-aminopropyl)-2-[(3methylphenyl)methoxy]-N-(2-thienylmethyl)benzamide hydrochloride. ⁎ Corresponding author at: Department of Ophthalmology, Campus Virchow-Clinic, Charité — Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany. E-mail address: [email protected] (S. Mergler).

http://dx.doi.org/10.1016/j.cellsig.2015.12.005 0898-6568/© 2015 Elsevier Inc. All rights reserved.

suggestive evidence that in some of these individuals there may be an association between these symptoms and exposure to tear film hyperosmolarity resulting from declines in either tear fluid formation and/or Meibomian glandular lipid secretory activity [3]. Such dysfunction induces epithelial cell volume shrinkage [4], disrupts tight junctional integrity [1] and can lead to innate immune cell activation and tissue infiltration [5]. If this immune response becomes dysregulated and chronic rather than self-limiting, visual impairment may be very severe. The options for treating DED are limited for the most part to providing symptomatic relief rather than offsetting its underlying causes. There is emerging evidence that drug targeting of epithelial transient receptor potential (TRP) channels is a viable approach for treating this disease [6]. Characterization of members of the TRP channel superfamily in ocular tissues indicates that some of its isoforms are viable drug targets for reducing DED symptomatology [5,7–9]. The TRP superfamily members

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

functionally expressed in the corneal epithelium and in the sensory nerves innervating this layer include the heat sensitive TRP vanilloid 1 (TRPV1; capsaicin receptor) and cold sensitive TRP melastatin 8 (TRPM8; menthol receptor) (reviewed by P.S. Reinach, S. Mergler et al.) [10–12]. TRPV1 channels are expressed in human, rabbit and mouse corneal epithelial cells, stromal fibroblasts as well as endothelial cells [13–17]. There is some suggestive evidence that TRPV1 activation in DED may contribute to ocular inflammation since in human corneal epithelial cells (HCEC) exposure to a hyperosmotic challenge similar to that identified in the tears of some DE patients' enhanced pro-inflammatory cytokines, e.g. interleukin-6 (IL-6) and IL-8 release. The downstream events mediating these responses include increases in intracellular Ca2+ influx and mitogen activated protein kinase (MAPK) as well as NF-κB activation [5,13,16,18]. Another indication of TRPV1 involvement in mediating responses to ocular stress is that in an alkali burn mouse corneal wound healing model, TRPV1 activation on stromal fibroblasts resulted in losses in corneal transparency caused by fibrosis and initiation of chronic immune responses [19]. Furthermore, TRPV1 activation on the ophthalmic branch of corneal trigeminal nerve endings contributes to nociception experienced in DED [20]. On the other hand, subsequent to a mild epithelial injury involving corneal epithelial debridement, TRPV1 stimulation by such stress instead promotes re-epithelialization through stimulation of cell proliferation and migration [17]. Like TRPV1, TRPM8 is another thermo-sensitive TRP channel activated by temperatures lower than 28 °C whereas TRPV1 undergoes activation above 43 °C [21–23]. TRPM8 functional activity is present on corneal nerve fibers based on increases in lacrimation and blinking rate induced by cooling and suppressed by BCTC, a mixed TRPV1/ TRPM8 antagonist [24]. TRPM8 is also expressed in endothelial cells because cooling as well as icilin and menthol induced increases in Ca2+ influx and underlying ionic currents [25]. Interestingly, an endogenous thyroid hormone metabolite, 3-iodothyronamine, 3T1AM, directly activated TRPM8 in human conjunctival epithelial cells (HCjEC) [6] and in a mouse model of colitis TRPM8, activation on gastroepithelial cells by icilin attenuated inflammatory responses to TRPV1 activation by capsaicin (CAP) [26]. Another indication of TRPM8 activation suppressing TRPV1-induced Ca2+ influx through negative feedback was described in eye tumor cells [27]. There are no reports indicating such an interaction between TRPM8 and TRPV1 in the cornea. 3T1AM is present in human serum [28,29] and it is chemically closely related to the thyroid hormones T3 and T4 [30]. This metabolite elicits numerous physiological effects [31] including reductions in cardiac drive [32] and the respiratory quotient along with hyperglycemia [33,34]. Notably, 3T1AM rapidly induces hypothermia in rodents [30,35]. Furthermore, there is a correlation in diabetics between increases in 3T1AM and HbA1c concentration [36]. 3T1AM interacts in several brain regions containing monoaminergic nuclei and the limbus with hTAAR1 as well as with mitochondrial targets [37]. This metabolite also interacts with alpha2-adrenergic receptors and acts as a specific dopamine and norepinephrine reuptake inhibitor [38]. Furthermore, 3T1AM also selectively activates TRPM8 channels in human conjunctival epithelial cells [6]. We describe here functional TRPM8 expression in HCEC since icilin, menthol and 3T1AM induced similar intracellular Ca2+ transients and underlying increases in ionic currents that BCTC inhibited. TRPM8 involvement in these responses was validated based on replicating many of them in an osteosarcoma cell line expressing recombinant TRPM8. Furthermore, TRPM8 stimulation by these agonists suppressed CAP and hyperosmolar-induced TRPV1 activation through a negative feedback effect. 2. Materials and methods 2.1. Materials Icilin was obtained from the Cayman Chemical Company (Ann Arbor, Michigan, U.S.A.). BCTC and AMTB were purchased from TOCRIS

137

Bioscience (Bristol, United Kingdom). Medium and supplements for cell culture were obtained from Life Technologies Invitrogen (Karlsruhe, Germany) or Biochrom AG (Berlin, Germany). 3T1AM was synthetized by Dr. R. Smits, ABX Advanced Biochemical Compounds, D-01454 Radeberg, Germany and highly purified by preparative HPLC (Dr. Rudi Thoma, Formula GmbH, Berlin, Germany). Accutase was purchased from PAA Laboratories (Pasching, Austria). All other reagents (e.g. menthol) were purchased from Sigma (Deisenhofen, Germany). 2.2. Cell culture SV40-adenovirus immortalized human corneal epithelial cells (HCEC) were kindly provided by Friedrich Paulsen (Institute of Anatomy, University of Nuremberg (Germany) and grown in Dulbecco modified Eagle medium DMEM/HAMs F12 1:1 supplemented with 10% fetal calf serum (FCS) and antibiotics in a humidified 5% CO2 incubator at 37 °C [5,15,39]. 2.3. RNA isolation and reverse transcription polymerase chain reaction (RTPCR) Total RNA was extracted using TRIzol® Reagent RT (Ambion, Austin, TX) according to manufacturer's instructions. NanoDrop ND-2000 spectrophotometer (PEQLAB, Germany) quantified extracted RNA. RNA (2 μg) was transcribed into cDNA using the high capacity cDNA reverse transcription kit (Applied Biosystems, Darmstadt, Germany). cDNA was denatured (95 °C, 5 min), first strand synthesized (42 °C, 50 min) and the reaction was terminated by heating to 70 °C for 15 min. RT-PCR, 2 μl cDNA mixture was used as a template in subsequent amplification reactions in a 30 μl total volume containing specific primers for TRPM8 generating 621 bp and a 119 bp glyceraldehyde-3-phosphate dehydrogenase (GAPDH) product for expression normalization. Genespecific intron-spanning primer sequences, annealing temperatures and product sizes are given in Table 1. Each reaction also contained red PCR Master Mix (Stratec Biomedical AG, Birkenfeld, Germany). PCR reaction underwent an initial cycle at 95 °C for 5 min followed by 35 cycles at 95 °C for 15 s. Primer specific annealing temperatures used were: a) TRPM8 58 °C, b) TRPV1 58 °C and c) GAPDH 60 °C for 30 s, followed by 72 °C for 45 s, and elongation at 72 °C for 7 min and finally temperature holding at 4 °C. 8 μl of the PCR product were loaded on a 1.5% agarose gel and after electrophoresis they were visualized via ethidium bromide staining under UV light. 2.4. Quantitative RT-PCR TRPM8 and TRPV1 specific primers (sequences shown in Table 1) generated 149 and 138 bp products, respectively. LightCycler® 480 SYBR Green I Master (Roche, Germany) was used. Amplification was carried out using the Mx 3000P qPCR system real-time cycler (Stratagene, Waldbronn, Germany) for 45 cycles of 15 s (95 °C) and 30 s (60 °C) [6,8]. GAPDH expression levels normalized TRPM8 and TRPV1 gene expression levels. 2.5. Immunocytochemistry Cells were cultured at 37 °C in a humidified 5% CO2 incubator until they were 50–70% confluent. Then they were fixed on ice in 4% (w/v) paraformaldehyde for 20 min and rinsed twice with PBS. Triton X-100 (0.1%) was used for permeabilization. Nonspecific antibody binding was blocked with 1% BSA. Cells were then incubated overnight at 4 °C with a rabbit anti-TRPM8 monoclonal antibody (Abcam plc, Cambridge, UK). After washing twice with PBS, they were then exposed to the antirabbit secondary antibody for 1 h and mounted with 4′6-diamidino-2phenylindole (DAPI) for 5 min. For fluorescence visualization, a Zeiss AxioImager M2 inverted microscope (Zeiss, Oberkochen, Germany) was used.

138

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

Table 1 Primers used for RT-PCR and Real time RT-PCR analysis. Gene

Primer

Sequence (5′–3′)

Size

Annealing temp.

TRPM8

Fwd Rev Fwd Rev Fwd Rev FWD Rev Fwd Rev

CCTGTTCCTCTTTGCGGTGTGGAT TCCTCTGAGGTGTCGTTGGCTTT CTCTGGTGGCTAGCCTGTCCTGACA TGGGATCCCGGAGCTTCTCA ATGGCCGGGACGAGATGGACA AGCCCCTGGTCTGCTCCCAAA TCGCCCTCATGGGTGAGACTGT CACCTGCAGCAGCTTGCCTGA TCAACGACCACTTTGTCAAGCTCA GCTGGTGGTCCAGGGGTCTTACT

621 bp

58 °C

285 bp

58 °C

138 bp

60 °C

149 bp

60 °C

119 bp

60 °C

TRPV1 qTRPM8 qTRPV1 qGAPDH

2.6. Fluorescence calcium imaging After cells had reached 80–90% confluence in an incubator on glass cover slips, they were pre-incubated with culture medium containing fura-2/AM (2 μM) for 15–45 min at 37 °C. Loading was stopped with a Ringer-like (control) solution containing (mM): 150 NaCl, 6 CsCl, 1 MgCl2, 10 glucose, 10 HEPES and 1.5 CaCl2 at pH 7.4. This solution is specifically suited for detection of TRPs [40]. Cells were then washed several times with this solution and placed in a chamber containing the same solution on the stage of an inverted microscope (Olympus BW50WI, Olympus Europa Holding GmbH, Hamburg, Germany) connected to a digital imaging system (TILL Photonics, Munich, Germany) suited for UV excitation. Fura-2/AM fluorescence was alternately excited at 340 nm and 380 nm for different times [41]. The exposure time was not equal for the two wavelengths. The 340 and 380 nm response signals were always sufficient and did not distort the ratio. The measuring field was adapted to the amount of cells (TILL Photonics view finding system). Before the experiments, cells were routinely tested to determine whether the control baseline was constant for 8–20 min. The control measurements are shown with open circles in the diagrams. The emission was detected from small cell clusters every 500 ms at 510 nm. All experiments were performed at a constant room temperature (≈20–23 °C) since experiments running at higher temperatures led to increased Ca2 + levels due to increased open probability of thermo-TRPs in ocular cells [42,43]. If stabilization had not occurred within the first 5 min (data not shown), adaptation to room temperature was prolonged. Results are shown as mean traces of the f340 nm/ f380 nm ratio ± SEM with n-values indicating the number of experiments per data point. For 8 to 20 min, measurements were obtained from groups of 5–10 cells at least three times. Drugs were dissolved in dimethyl sulfoxide (DMSO) to obtain a stock solution and diluted to obtain a working concentration that did not exceed 0.1%. At this working concentration, Ca2+ regulation was unchanged (data not shown).

2.7. Planar patch-clamp recordings The whole-cell mode of a high throughput semi-automated planar patch-clamp setup (“Port-a-Patch”; Nanion, Munich, Germany) was used in conjunction with an EPC 10 patch-clamp amplifier (HEKA, Lamprecht, Germany) and PatchMaster software (version 2.4; HEKA, Lamprecht, Germany). A standard intracellular solution containing (mM): 50 CsCl, 10 NaCl, 60 CsF, 20 EGTA, and 10 HEPES-acid at pH ≈ 7.2 and ≈288 mOsM was applied to the microchip (both provided by Port-a-Patch©, Nanion, Munich, Germany). The external solution contained (mM): 140 NaCl, 4 KCl, 1 MgCl2, 2 CaCl2, 5 D-glucose monohydrate and 10 HEPES, pH ≈ 7.4 and osmolarity ≈ 298 mOsM. Five microliters of a single cell suspension were placed onto a microchip having a 2.5–3 MΩ diminutive aperture (1–3 μm). A negative pressure applied by a software-controlled pump (Nanion) adhered a single cell atop the aperture. Mean membrane capacitance (16 pF ± 1 pF; n = 36) and mean access resistance (8 ± 1 MΩ; n = 36) were software

calculated. Series resistances, fast and slow capacitance transients were compensated by the software of the patch-clamp amplifier. Current recordings were all leak-subtracted and cells with leak currents above 100 pA were excluded from analysis. All experiments were performed at ≈22 °C room temperature, unless stated otherwise. The current response patterns were generated through application of specific voltage step-protocols, which resolved TRP-like whole-cell currents [40]. Holding potential (HP) was set to 0 mV in order to eliminate any possible contribution of voltage-dependent Ca2+ channel activity. Whole-cell currents were recorded using 10 mV voltage steps over a range from −60 to +130 mV (10 mV increments) for 400 ms each. Currents were also recorded through a voltage ramp protocol of −60 to +130 mV range and 500 ms duration every 5 s. Resulting currents were normalized with respect to cell membrane capacitance to obtain current density (pA/pF). 2.8. Transfection experiments Osteosarcoma cells contained a plasmid into which the full-length TRPM8 cDNA was inserted. JetPEI transfected wild-type U2os cells (Polyplus, Illkirch, France) were prepared according to the manufacturer's protocol. Single clones were obtained under antibiotic selection and functional TRPM8 expression was evaluated based on agonist-induced intracellular calcium transients. TRPM8 expressing clones were used in subsequent experiments. 2.9. Statistical analysis Significance was determined using Student's t-test for paired data (p-values: two-tailed) provided they passed a normality test according to Kolmogorov–Smirnov. If the normality test failed, non-parametric Wilcoxon matched pairs were used. For non-paired data, Student's ttest for unpaired data was used, if it passed a normality test. If this was not the case, non-parametric Mann–Whitney-U test was performed. Welch's correction was applied if data variance of the two groups were not at the same level. Probabilities of p b 0.05 (indicated by asterisks (*) and hash tags (#)) were considered to be significant. The number of repeats is shown in each case in brackets, near the traces or bars. All values are means ± SEM. All plots were generated with SigmaPlot software version 12.0 (Systat Software, San Jose, California, U.S.A.). Bar charts were plotted with GraphPad Prism (version 5). 3. Results 3.1. Gene, protein and functional TRPM8 expression RT-PCR identified the predicted TRPM8 amplicon (621 bp, Fig. 1A), which was confirmed by qPCR (Fig. 1B) based on generation of a size identical with its positive control in the LNCaP cell line [44,45]. Immunostaining identified cell membrane and peri-nuclear TRPM8 protein expression (Fig. 1C–E). Absence of immunostaining caused by omission of the primary antibody excluded nonspecific secondary antibody staining.

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

Functional TRPM8 expression was identified based on Ca2+ transients induced by exposure to either: cold (either b17 °C or N17 °C) (Fig. 2), the specific TRPM8 agonist menthol (500 μM) or the super cooling agent icilin (60 μM) (Fig. 3). These responses were all blocked by a TRPM8/TRPV1 antagonist BCTC (10–20 μM). In addition, TRPM8 activation by moderate cooling could be blocked by the TRPM8 selective blocker AMTB (10 μM; Fig. 2B; right panel). For TRPM8 activation, experiments were performed at room temperature (≈ 20–23 °C) (Fig. 2A–B, upper traces). For strong cold stimulation (b 17 °C), this procedure did not significantly change the f340 nm/f380 nm ratio (Fig. 2A, left panel). For moderate cooling (N17 °C) excluding possible TRPA1 activation, this procedure temporarily increased the f340 nm/f380 nm ratio to higher levels at 210 s, but also reduced the ratio to lower levels below the baseline at a later time indicating complex Ca2 + regulation when the temperature was recovering to its baseline level (Fig. 2B, left panel). This effect could be blocked by 10 μM BCTC (n = 6; p b 0.05 at 210 s; Fig. 2B, middle panel; Fig. 2C), but not clearly with 10 μM AMTB (Fig. 2B, right panel; Fig. 2C). However, AMTB clearly suppressed the cold-induced Ca2 + change at a later time (n = 11; p b 0.05 at 300 s; Fig. 2B, right panel; Fig. 2D). A larger f340 nm/f380 nm increase occurred if menthol was used instead of moderate cooling. Specifically, 500 μM menthol increased this ratio from 1.2034 ± 0.0036 to 1.2788 ± 0.011 after 300 s (n = 7, p = 0.0001; Fig. 3A, left panel), while in the presence of 10 μM BCTC the ratio merely increased from 1.2042 ± 0.0089 to 1.2363 ± 0.0103 in the same time (n = 6, p = 0.1034) (Fig. 3A, right panel). Notably, 500 μM menthol and 60 μM icilin produced a larger response than cold stimulation (e.g. icilin: 1.372 ± 0.002; n = 5; 400 s; Fig. 3B, left panel). With BCTC, the ratio remained at its baseline value of 1.218 ± 0.01284 (n = 5–8; p b 0.0001; unpaired tested; Fig. 3B, right panel). Icilin (15 μM) irreversibly increased inward currents (− 60 mV) from −6 ± 1 to −13 ± 2 pA/pF (p b 0.0005; n = 14–17) characteristic of TRPM8-like whole-cell currents (Fig. 4). The non-selective TRP channel blocker lanthanum-III-chloride (La3+) (500 μM) without icilin suppressed this rise to − 7 ± 3 pA/pF (p b 0.05; n = 10–14). Correspondingly, outward currents (+130 mV) increased from 66 ± 13 up to 105 ± 21 pA/pF (p b 0.01; n = 12–15) after application of icilin and they fell after application of La3+ to 50 ± 7 pA/pF (p b 0.05; n = 7; Fig. 4D–F). In summary, these results document functional TRPM8 expression.

139

3.2. T1AM activated TRPM8 channels 3T1AM (1 μM) increased the f340 nm/f380 nm ratio from 1.200 ± 0.003 to 1.219 ± 0.010 (p b 0.001; n = 14) within 600 s. (Fig. 5A). These rises were completely blocked by 10 μM BCTC (1.204 ± 0.008 (p b 0.01; n = 7; Fig. 5B) but not by 10 μM AMTB (Fig. 5C–D). 3T1AM elicited dose dependent increases in [Ca2 +]i between 300 nM and 10 μM (n = 3–8; Fig. 5E). The estimated EC50 value is 1.2 ± 0.0 μM. 3T1AM also increased whole-cell currents at − 60 mV from − 6.44 ± 0.91 to − 14.78 ± 2.10 pA/pF (p b 0.0005; n = 18–26). Similarly, 1 μM 3T1AM increased whole-cell inward currents (−60 mV) from −8 ± 2 pA/pF to −15 ± 3 pA/pF (p b 0.01; n = 7–9) and outward currents (+ 130 mV) from 63 ± 8 pA/pF to 108 ± 14 pA/pF (p b 0.01; n = 7) (Fig. 6A–B). In contrast, 500 μM La3+ clearly suppressed these currents to −6 ± 2 pA/pF (p b 0.01; n = 8–18) (data not shown). BCTC (10 μM) had the same inhibitory effect as La3+ (Fig. 6). BCTC (10 μM) without 1 μM 3T1AM suppressed the inward currents to −9 ± 2 pA/pF (p b 0.05; n = 6) and the outward currents to 74 ± 7 pA/pF (p b 0.05; n = 6; Fig. 6C–F). BCTC blocked the TRPM8 responses to either menthol, icilin or 3T1AM. To confirm TRPM8 expression in HCEC, we compared the Ca2+ transients induced by 3T1AM and 500 μM menthol with those in TRPM8 transfected U2osB2 osteosarcoma cells. Fig. 7A shows that in nontransfected wildtype cells (WT) 500 μM menthol barely affected [Ca2+]i whereas in its transfected counterpart menthol induced a response similar to that obtained in HCEC (Fig. 7B) Conversely, 20 μM BCTC suppressed the rise induced by menthol (1.351 ± 0.022 to 1.222 ± 0.005; n = 3–5; p b 0.01; Fig. 7C–D). 3T1AM (1 μM) had effects similar to those induced by menthol; namely, it increased the ratio from 1.206 ± 0.002 to 1.265 ± 0.005 (n = 5; p b 0.05; Fig. 7E–F), which was at lower levels than those induced with menthol (1.351 ± 0.022; n = 5; p b 0.05). In addition, the Ca2+ response pattern was also different suggesting a more complex Ca2+ response to 3T1AM than menthol. As with menthol, 10 μM BCTC blocked the TRPM8 response to 3T1AM (1.265 ± 0.005 to 1.203 ± 0.001; n = 4–5; p b 0.01; Fig. 7G–H). The BCTC mixed TRPV1/TRPM8 antagonist selectivity was evaluated under some conditions in which it is also an effective TRPV1 blocker [46]. BCTC decreased the rise in the ratio induced by 5 μM CAP from 1.212 ± 0.006 to 1.188 ± 0.003 (n = 4; p b 0.05; Fig. 8A–C). In contrast, BCTC had no inhibitory effect on increases induced by 20 μM CAP (n = 7; p N 0.05) indicating that BCTC only blocks TRPV1 activation induced by a submaximal CAP concentration (Fig. 8D–F). In summary, the similarity between the

Fig. 1. TRPM8 gene and protein expression. A: Conventional RT-PCR indicates mRNA signal of TRPM8 amplicon (621 bp) in HCEC and LNCaP. B: Quantitative real-time RT-PCR analysis. The data were normalized to LNCaP with the positive mRNA signal. GAPDH was used as a housekeeping gene for normalization. C–E: Immunocytochemistry documents subcellular TRPM8 localization. C: Nuclear staining with DAPI (blue). D: TRPM8 positive cells (violet). E: merged. Scale bar is ≈20 μm.

140

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

Fig. 2. Cold exposure elicits increases in Ca2+ entry through TRPM8 activation. The thermal and pharmacological changes were carried out at the time points indicated by arrows. Data are mean ± SEM of 6–13 experiments. (A) Temperature reduction from ≈22 °C to b17 °C resulted in a small transient [Ca2+]i elevation (left panel). The corresponding temperature courses are shown above the Ca2+ traces. In the presence of the TRPM8 channel blocker BCTC (20 μM), the cold-induced Ca2+ increase was suppressed (n = 11; right panel). (B) Same experiments as shown in (A), but with a slight temperature reduction from ≈23 °C to N17 °C (moderate cooling) resulting in a small transient [Ca2+]i elevation (n = 13; left panel). Moreover, even a transient reduction below baseline could be observed at a later point of time. In the presence of the TRPM8 channel blocker BCTC (10 μM), the moderate cold-induced Ca2+ changes was suppressed (n = 6; middle panel). Similar results were obtained with the TRPM8 blocker AMTB (n = 11; right panel). (C) Summary of the experiments with cold stimulation (b17 °C versus N17 °C). The hashtag (#) indicates a statistically significant difference of fluorescence ratios between cooling with and without BCTC (p b 0.05 at 210 s; unpaired tested). (D) Analysis of moderate cooling-induced Ca2+ changes at 300 s. The hashtag (#) indicates a statistically significant difference of fluorescence ratios between cooling with and without AMTB (p b 0.05 at 300 s; unpaired tested).

inhibitory effects of BCTC on increases induced by 3T1AM or menthol in HCEC and recombinant TRPM8 expressed in osteosarcoma cells confirms functional TRPM8 expression in HCEC. 3.3. Crosstalk between TRPM8 and TRPV1-induced responses We evaluated if TRPM8 and TRPV1 can interact with one another since in addition to the aforementioned studies they can modulate each other's pain response to heat and cold [47]. This was done by determining if TRPM8 activation blunted subsequent responses by TRPV1 to either CAP or a 450 mOsM hyperosmotic challenge. CAP (20 μM) increased the f340 nm/f380 nm ratio from 1.196 ± 0.002 to 1.352 ± 0.033

(p b 0.0005; n = 10; 1500 s), whereas after exposure to icilin (15 μM) CAP only increased this ratio from 1.205 ± 0.002 to 1.261 ± 0.02 (p b 0.0001; n = 8/9; 1500 s; Fig. 9A). Similar results were obtained if 1 μM 3T1AM replaced 15 μM icilin (Fig. 9B). In this case, CAP irreversibly only increased this ratio from 1.199 ± 0.001 to 1.217 ± 0.003 (p b 0.001; n = 6; 600 s) which is clearly less than the rises obtained with just CAP without 3T1AM pre-incubation (Fig. 9B–C). Moreover, TRPV1 activation caused by a hypertonic challenge (450 mOsM) was completely blunted during exposure to 1 μM 3T1AM. Specifically, this stress increased the f340 nm/f380 nm ratio from 1.198 ± 0.002 to 1.334 ± 0.034 (n = 8; p b 0.01) whereas it did not increase in the presence of 1 μM 3T1AM (n = 5; Fig. 9D–E). In order to validate that TRPM8

Fig. 3. Menthol and icilin elicit increases in Ca2+ entry through TRPM8 activation. (A) Menthol (500 μM) induced a large irreversible Ca2+ influx (left panel) which could be clearly suppressed by BCTC (10 μM) (n = 6; right panel). (B) Same experiment as shown in (A), but with 60 μM icilin (n = 5). BCTC (20 μM) clearly suppressed the icilin-induced Ca2+ increase (n = 8). (C) Summary of the experiments with menthol, icilin and BCTC. The asterisks (*) show significances with and without the TRPM8 agonists menthol and icilin (n = 5–14; p b 0.05 at the minimum; paired tested). The hashtags (#) indicate statistically significant differences of fluorescence ratios with and without BCTC (p b 0.005; unpaired tested).

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

141

Fig. 4. Icilin-activated whole-cell currents. (A) Whole-cell channel currents (with leak current subtraction) under control conditions. (B) Whole-cell channel currents in the presence of 15 μM icilin. (C) Effect of icilin is summarized in a current/voltage plot (I–V plots). Data are from (A) and (B). For the I–V plots, maximal peak current amplitudes were plotted against the voltage (mV). The upper trace (filled circles) was obtained in the presence of 15 μM icilin and the trace below (open circles) under control conditions. (D) Time course recording showing the current increases by 15 μM icilin and reduction after application of 500 μM La3+. (E) Original traces of icilin-induced current responses to voltage ramps. Current densities are shown before application (labeled as A), during application of 15 μM icilin (labeled as B) and after addition of 500 μM La3+ (labeled as C). Data were obtained from the data shown in panel (D). (F) Summary of patch-clamp experiments with icilin and La3+. The asterisks (*) indicate statistically significant differences of in- and outward currents (n = 9–14; p b 0.05 at the minimum; unpaired tested).

Fig. 5. Modulation of TRPM8-induced Ca2+ influx by 3T1AM and BCTC. 3T1AM was applied at times indicated by arrows. Data are mean ± SEM of 7–14 experiments. (A) 1 μM 3T1AM induced a Ca2+ entry (n = 14; filled circles). Without 3T1AM application, no changes in Ca2+ influx could be observed (n = 8; open circles). (B) 10 μM BCTC suppressed the 3T1AM-induced Ca2+ influx (n = 7). (C) Summary of the experiments with 3T1AM and BCTC. The asterisks (*) show significances with and without BCTC (n = 7–14; p b 0.01 at the minimum; paired tested). The hashtags (#) indicate statistically significant differences of fluorescence ratios (p b 0.01; unpaired tested). (D) Dose-dependent effects of 0.1–10 μM 3T1AM (n = 3–8) (EC50 = 1.2 ± 0.0 μM; R2 = 0.994).

142

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

Fig. 6. BCTC blunts 3T1AM induced rises in whole-cell currents. (A) Whole-cell channel current pattern (with leak current subtraction) under control conditions. (B) Whole-cell channel currents in the presence of 1 μM 3T1AM. (C) Effect of 3T1AM is summarized in a current/voltage plot (I–V plots). Data are from (A) and (B). The upper trace (quadrangles) was obtained in the presence of 1 μM 3T1AM and the trace below (triangles) with BCTC (10 μM). The third (lower) trace (filled circles) was obtained under control conditions. (D) Time course recording showing the current increases induced by 1 μM 3T1AM and reduction after application of 10 μM BCTC. (E) Original traces of 3T1AM-induced current responses to voltage ramps. Current densities are shown before application (labeled as A), during application of 1 μM 3T1AM (labeled as B) and after addition of 10 μM BCTC (labeled as C). Data were obtained from the data shown in panel (D). (F) Summary of patch-clamp experiments with 3T1AM and BCTC. The asterisks (*) indicate statistically significant differences of in- and outward currents (n = 6–9; p b 0.05 at the minimum; unpaired tested).

Fig 7. Menthol and 3T1AM selectively activate TRPM8 in a TRPM8-transfected osteosarcoma cell line (U2osTRPM8, B2). The pharmacological treatments were carried out at the times indicated by arrows. Data are mean ± SEM of 3–7 experiments. (A) Application of 500 μM menthol induced a weak Ca2+ influx in the wild type (non-transfected) osteosarcoma cells. (B) In the TRPM8-transfected cells, application of 500 μM menthol resulted in a rapid, irreversible large increase in [Ca2+]i. (C) 10 μM BCTC significantly reduced the menthol-induced calcium influx. (D) Summary of the experiments with menthol and BCTC. The hashtags (#) indicate statistically significant differences of fluorescence ratios with and without BCTC (p b 0.05 at the minimum; unpaired tested). (E) Similar experiments as shown in (A)–(C) but with 1 μM 3T1AM instead of menthol. There was no recordable calcium influx following the application of 3T1AM in non-transfected (wild type) osteosarcoma cells (U2osWT). (F) In contrast, application of 1 μM 3T1AM in TRPM8 transfected cells lead to a strong, irreversible increase in [Ca2+]i. (G) 10 μM BCTC abolished the 3T1AM-induced calcium entry. (H) Summary of the experiments with 3T1AM and BCTC. The hashtags (#) indicate statistically significant differences of fluorescence ratios with and without BCTC (p b 0.05 at the minimum; unpaired tested).

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

143

Fig. 8. Inhibition of TRPV1 activation by BCTC depends on CAP concentration. CAP was applied at the times indicated by arrows. Data are mean ± SEM of 4–7 experiments. (A) Application of 5 μM CAP resulted in [Ca2+]i elevation. The trace shows intracellular Ca2+ levels during application of CAP (n = 4). (B) In the presence of BCTC (10 μM), the CAP-induced Ca2+ increase was suppressed (n = 4). Moreover, [Ca2+]i even fell below its baseline value. (C) Summary of the experiments with 5 μM CAP and 10 μM BCTC. (D–F) Similar experiments as shown in (A–C), but 20 μM CAP and 20 μM BCTC was used. In these experiments, BCTC failed to suppress CAP-induced Ca2+ increases (n = 7).

activation blocked subsequent TRPV1 stimulation induced by a hypertonic challenge, we compared the individual effects of 1 μM 3T1AM and a hypertonic solution (450 mOsM) on whole-cell currents with the response obtained followed by replacement with a 450 mOsM hypertonic stress containing 1 μM 3T1AM. Fig. 10A–B shows that this stress increased the whole-cell currents. Similarly, 1 μM 3T1AM also increased them, but the 450 mOsM stress failed to induce a response following exposure to 1 μM 3T1AM (Fig. 10C–D). However, inward currents temporarily fell from an elevated level of 327 ± 32% of control currents to 153 ± 21% (p b 0.01; n = 5–6; unpaired tested) (Fig. 10C–E and G). Replacing the hypertonic solution with an isotonic solution containing CAP (20 μM) also failed to induce TRPV1 activation because the currents were unchanged. Fig. 11A–B documents that 1 μM 3T1AM augmented increases in whole-cell currents induced by a step stimulation protocol. Notably, a 20 μM CAP replacement failed to further augment these current increases, but instead they declined (Fig. 11C). Specifically, 1 μM 3T1AM transiently increased the inward current density from −13 ± 2 pA/pF to − 34 ± 4 pA/pF (n = 9–10; p b 0.005). Subsequently, 20 μM CAP decreased inward current density to −23 ± 3 pA/pF (n = 9–10; p b 0.01). 3T1AM increased outward currents from 118 ± 20 pA/pF to 235 ± 40 pA/pF (n = 9–10; p b 0.05). On the other hand, 20 μM CAP decreased them to 159 ± 33 pA/pF (n = 9–10; p b 0.01; Fig. 11D–E). In summary, 3T1AM inhibited CAP- or hypertonicinduced increases in Ca2 + influx and whole-cell currents suggesting that TRPM8 elicits a negative feedback effect on TRPV1 activation through crosstalk. 4. Discussion We show here that 3T1AM is a TRPM8 agonist since this thyroxine metabolite directly increases intracellular Ca2+ influx without temperature lowering in HCEC. Its selectivity was validated by showing that

BCTC blocked 3T1AM, menthol and icilin-induced currents underlying Ca2 + transients. As these effects were replicated in an osteosarcoma cell line expressing recombinant TRPM8, this agreement confirms that the effects of these mediators are attributable to interacting with TRPM8. Even though there are reports that BCTC is also a TRPV1 antagonist, we identified specific conditions under which BCTC is an effective TRPM8 antagonist. Specifically, BCTC failed to antagonize TRPV1 activation if this channel was maximally activated by 20 μM CAP. Since drug-induced TRPM8 activation led to declines in TRPV1 activation by CAP, this crosstalk effect may be of therapeutic benefit in a clinical setting to hasten wound healing and treat DED. This is possible because loss of TRPV1 function markedly improved corneal transparency restoration during wound healing of an alkali burn in a murine corneal wound healing model undergoing inflammation and fibrosis [19]. Furthermore, TRPM8 expression on HCEC supports earlier findings that drug targeting is a potential option for treating DED since its stimulation by temperature lowering on corneal nerves increased lacrimation [13,24]. As currently available TRPM8 agonists may have some side effects, 3T1AM-type analogs could be an effective lead compound warranting further development. 4.1. Functional TRPV1 and TRPM8 expression RT-PCR and semi-quantitative PCR analyses as well as immunofluorescent staining documented TRPM8 gene and protein expression, respectively (Fig. 1). Another indication of TRPM8 expression is that the reversal potential of its induced currents was near 0 mV, which is characteristic of both non-selective TRPM8 and TRPV1 cation channel behavior [40]. These currents are not attributable to Cl− channel activity since we showed in a previous study that isosmotic replacement of the extracellular Cl− containing solution with Cl− free Na+-gluconate did not change TRPV1-induced increases in whole-cell currents [15].

144

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

Fig. 9. TRPM8 activation by 3T1AM — reduces rises in Ca2+ influx induced by TRPV1 activation in HCEC. Pharmacologic treatments were carried out at the time indicated by arrows. (A) 15 μM icilin induced an irreversible Ca2+ entry (n = 8–9; filled circles). Additional application of 20 μM CAP (≈1400 s) did not change the Ca2+ level. Without icilin, a strong CAP-induced Ca2+ influx was observed (n = 10; open circles). (B) 1 μM 3T1AM induced an irreversible Ca2+ entry (n = 5–6; filled circles). Additional application of 20 μM CAP (≈1400 s) did not change the Ca2+ level. Without 3T1AM, a strong CAP-induced Ca2+ influx was observed (n = 10; open circles). (C) Summary of the experiments shown in (A) and (B). The hashtags (#) indicate statistically significant differences in CAP-induced fluorescence ratios with and without icilin or 3T1AM. (D) Same experiments as shown in (B), but with TRPV1 activation induced by a 450 mOsM hypertonic challenge instead of CAP (n = 5; filled circles). Additional application of hypertonic solution (≈1400 s) did not change the Ca2+ level. Without 3T1AM, a strong hypertonic-induced Ca2+ influx was observed (n = 8; open circles). (E) Summary of the experiments shown in (D). The hashtag (#) indicates a statistically significant difference in fluorescence ratios obtained by exposure to a hypertonic challenge with and without 3T1AM.

This qualification most likely also applies to TRPM8 since its activation induced currents similar to those caused by stimulating TRPV1 [40]. Functional TRPM8 expression was demonstrated by showing that either temperature lowering (to b 17 °C or to N 17 °C), exposure to icilin or menthol induced Ca2+ transients, which were inhibited by La3+ and BCTC. These effects are very similar to those described in corneal endothelial cells [25] and other cell types [6,27,40,48]. Icilin is a potent and efficacious TRPM8 agonist, but it also activates TRPA1 [49]. Regarding TRPM8 activation by icilin, we used it at concentrations between 15 and 60 μM according to our previous studies [6,25,48] and those by others [49,50], which is well within the range for maximal TRPM8 channel activation. Even though menthol was used, which is a more selective TRPM8 agonist than the super cooling agent icilin, the latter agonist is more efficacious and potent [51,52]. Nevertheless, icilin has been applied up to 100 μM [49]. The use of BCTC as a TRPM8 antagonist is consistent with its blockage of intracellular Ca2 + transients induced by menthol [53]. Furthermore, its inhibitory effects in this study are similar to those described in other studies in which TRPM8 gene silencing obviated declines induced by BCTC [44,54]. Our results also agree with reports that BCTC can block TRPV1 activation since we found that the inhibitory effect of TRPV1 activation by BCTC only occurred at 5 μM CAP which does not fully activate TRPV1 (Fig. 8) [46]. In this study, 20 μM CAP was used, which is well above the 1 μM level used in retinal pigment epithelial cells expressing TRPV1 mRNA, where it failed to induce Ca2+ increases [55]. The relative insensitivity of TRPV1 in these ocular tissues to activation by CAP is in accord with our studies in which 10 μM CAP was required to obtain robust responses to this selective TRPV1 agonist. Another consideration supporting our use of BCTC as a TRPM8 antagonist is that it inhibited recombinant TRPM8 activation [55]. Effective targeting of TRPM8 by BCTC is further supported by the

finding that BCTC failed to suppress increases in lacrimation induced by cold in TRPM8 knockout mice [23]. Furthermore, our contention that BCTC can be used to delineate TRPM8 activity is consistent with a number of other studies [56–58]. We also tested AMTB as a TRPM8 blocker based on its identification as a selective TRPM8 blocker in several studies [59,60]. However, it failed to suppress calcium transients induced by 3T1AM in HCEC (Fig. 5) and calcium transients induced by icilin in HCjEC both of which express functional TRPM8 activity (data not shown) [6]. We can only speculate that this disagreement may be attributable to TRPV1 isoform heterogeneity between different tissues. 4.2. 3T1AM interacts with TRPM8 3T1AM elicited rapid TRPM8 activation at a constant bath temperature irrespective of whether it was N25 °C or around 20 °C. Its selectivity as a TRPM8 agonist was validated by showing that in a heterologous TRPM8 channel expression system the Ca2+ transients were comparable to those in HCEC and in both cases inhibited by BCTC (Fig. 7). Another indication that 3T1AM directly interacts with TRPM8 is that both the induced increases in calcium influx and in whole-cell currents were blocked by either La3 +, a broad spectrum TRP channel blocker, or BCTC [53,61]. It is noteworthy that 3T1AM is an order of magnitude more potent than icilin and menthol in activating TRPM8. Furthermore, the endogenous metabolic product of 3T1AM, N-Ac-3T1AM [62], also induced Ca2+ transients (data not shown). TRPM8 activation by 3T1AM, icilin or menthol fully blunted TRPV1-activation induced by a hypertonic challenge whereas they were somewhat less effective in blocking TRPV1 activation by CAP (Fig. 9D–E, Fig. 10). This obviation of hypertonicityinduced TRPV1 activation could be relevant to the in vivo condition

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

145

Fig. 10. TRPM8 activation by 3T1AM blocks hypertonic-induced whole-cell current augmentation of TRPV1 activity in HCEC. (A) Time course recording showing the current increases induced by a hypertonic challenge (450 mOsM). (B) Original traces of hypertonic-induced current responses to voltage ramps. Current densities are shown before application (labeled as A) and during application of hypertonic solution (labeled as B). Data were obtained from the data shown in panel (A). (C) Time course recording showing the current increases by 1 μM 3T1AM and current density levels after adding hypertonic solution (450 mOsM). (D) Original traces of 3T1AM-induced current responses to voltage ramps. Current densities are shown before application (labeled as A), during application of 1 μM 3T1AM (labeled as B) and after addition of hypertonic solution (labeled as C). Data were obtained from the data shown in panel (C). Notable, there was even a transient decrease of hypertonic-induced inward currents in the presence of 3T1AM (lower trace). (E) Maximal negative current density induced by a voltage step from 0 mV to −60 mV are depicted in percent of control values before application of hypertonic challenge and 3T1AM, respectively. 3T1AM-induced inward currents could be suppressed in the presence of a hypertonic solution (450 mOsM). (F) Same analyses as in panel E, but of steps from 0 mV to 130 mV. (G) Summary of the experiments with hypertonic challenge and 3T1AM (no additive effect). The asterisks (*) indicate statistically significant differences of hypertonic induced increases of in- and outward currents with and without 3T1AM (n = 5–6; p b 0.05 at the minimum; unpaired tested).

wherein cooling mediated increases in lacrimation induced by TRPM8 activation may also suppress increases in TRPV1 activity. TAAR1 had been proposed to mediate the hypothermia effects of pharmacological doses of 3T1AM [29]. However, the persistence of its effects in TAAR1 knockout mice indicated contribution of other plasma membrane or intracellular receptors to induction of hypothermia [63]. Therefore, it is conceivable that TRPM8 is somehow also directly linked with a GPCR such as beta adrenergic receptors [63]. An interaction between TRPM8 and beta-adrenergic receptors is a possibility since these receptors are highly expressed in ocular tissue layers [64–66]. One finding supporting this possibility is that the non-selective betaadrenergic receptor antagonist timolol suppressed 3T1AM induced Ca2+ increases in HCjEC [67]. As 3T1AM interacts with TRPM8, 3T1AM induced hypothermia may be attributable to co-activation of both beta-adrenergic receptors and TRPM8. Furthermore, their coactivation may not be limited to inducing hypothermia through increases in plasma membrane Ca2+ influx since we detected TRPM8 protein expression also in the peri-nuclear domain (Fig 1D). Earlier studies showed that 3-T1AM uptake into target cells also occurs [68,69]. In addition, very recent studies indicate that 3T1AM may act as multi-target ligand for several classes of GPCRs [67,70,71], whose expression and possible interaction with TRP channels in ocular cell models warrants further consideration. 4.3. TRPM8 drug targeting in inflammation Epithelial TRPM8 activation may also contribute to increases in ocular surface hydration induced by temperature lowering since this tissue

layer can contribute up to 25% of total corneal fluid egress [72]. Epithelial mediated fluid transport reduces the likelihood of pathogenic infiltration and inflammation induction through contributing to maintaining ocular surface hydration. However, in vivo, the cold sensation accompanying histamine and bradykinin-induced inflammation may depend on their cognate receptors interacting with TRPM8 to instead inhibit its activation. Such an interaction is known to be mediated by a linked G-protein subunit Gα(q) since its genetic deletion blocked this effect [73]. As TRPM8 activation can be also induced at constant temperature, this finding increases the attractiveness of using thyroid hormone metabolites as lead compounds in developing drugs that can directly activate TRPM8 and reduce desiccation of anterior ocular surface epithelia. Even though DED is becoming progressively more prevalent, the current therapy is mainly limited to providing symptomatic relief rather than targeting the underlying molecular mechanisms of this disease. Cyclosporine A is one exception, but it is not an unqualified success and awaits approval in some countries to treat DED [74,75]. This limitation coupled with the realization that TRPM8 activation blunts TRPV1induced rises in proinflammatory cytokine release in HCjEC [6] should prompt further studies evaluating the feasibility of treating DED with TRPM8 cooling agents such as 3T1AM. Funding Stefan Mergler is supported by DFG (Me 1706/14-1, Me 1706/18-1) about TRP channel related research projects and received a grant from the DFG priority program 1629 ThyroidTransAct (Me 1706/13-1). Noushafarin Khajavi was supported by the DFG project of Stefan

146

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147

Fig. 11. TRPM8 activation by 3T1AM blocks CAP-induced whole-cell current augmentation (no additive effect). (A) Whole-cell channel currents pattern (with leak current subtraction) under control conditions. (B) Whole-cell channel currents in the presence of 1 μM 3T1AM. (C) Whole-cell channel currents after the CAP application. (D) Effect of 3T1AM and 20 μM CAP is summarized in a current/voltage plot (I–V plots). Data are from (A), (B) and (C). The upper trace (rectangles) was obtained in the presence of 1 μM 3T1AM and the trace below (triangles) with CAP (20 μM). The third trace (circles) was obtained under control conditions. (E) Summary of patch-clamp experiments with 3T1AM and CAP (no additive effect). The asterisks (*) indicate statistically significant differences of in- and outward currents (n = 9–10; p b 0.05 at the minimum; unpaired tested).

Mergler (1629 ThyroidTransAct). The planar patch-clamp equipment was partially supported by Sonnenfeld-Stiftung (Berlin, Germany). Josef Köhrle received grants from the DFG priority program 1629 ThyroidTransAct (Ko 922/16-1 and 922/17-1). This study was also supported by a DFG grant to Carsten Grötzinger (Gr 1829/1-1) and Mathias Strowski (STR 558/9-1).

helpful discussions. Finally, we appreciate very much the technical assistance provided by the fellow students Sahana Srinivasan, Anna Santaella, Karoline Krüger, Oleksandra Basiy and Alexandra List during their lab rotation projects.

References Author contribution statement AL, SM, NK and PSR designed the study, analyzed the data, wrote and edited the manuscript. JK contributed with his expertise in molecular endocrinology, discussed data and their interpretation and helped edit the manuscript. NK performed PCR analysis and immunohistochemistry. CG provided the heterologously expressed TRPM8 cells, carried out and analyzed experiments during manuscript revision, and helped edit the manuscript and plot analysis. AL, PD, PH, SM, NL and NK performed calcium measurements and planar patch-clamp recordings as well as plot analyses. AL, PD, NK and SM created diagrams. Acknowledgments The authors thank Gabriele Fels and Ersal Türker for the technical assistance as well as Olaf Strauß (PhD) (all Charité Berlin, Dept. of Ophthalmology) for helpful discussions. We also thank Yvonne Giesecke (Charité Berlin, Dept. of Gastroenterology) for technical assistance. Furthermore, the authors appreciate very much the collaboration with Friedrich Paulsen (MD), Fabian Garreis (PhD) and Antje Schröder (MSc) (University of Erlangen, Institute of Anatomy) as well as with Stephan Reichl (TU Braunschweig, Institute for Pharmaceutical Technology). We additionally thank Mathias Strowski (MD) from the Gastroenterology Department as well as Juliane Dinter (PhD), Gunnar Kleinau (PhD) and Heike Biebermann (PhD) from the Institute of Pediatric Experimental Endocrinology (all Charité University Berlin) for their support and

[1] X. Yi, Y. Wang, F.S. Yu, Invest. Ophthalmol. Vis. Sci. 41 (2000) 4093–4100. [2] J.Y. Hyon, H.M. Kim, D. Lee, E.S. Chung, J.S. Song, C.Y. Choi, J. Lee, Korean Corneal Disease Study G, Korean J. Ophthalmol. 28 (2014) 197–206. [3] S.C. Pflugfelder, A. Solomon, M.E. Stern, Cornea 19 (2000) 644–649. [4] M. Rasmussen, R.T. Alexander, B.V. Darborg, N. Mobjerg, E.K. Hoffmann, A. Kapus, S.F. Pedersen, Am. J. Physiol. Cell Physiol. 294 (2008) C197–C212. [5] Z. Pan, Z. Wang, H. Yang, F. Zhang, P.S. Reinach, Invest. Ophthalmol. Vis. Sci. 52 (2011) 485–493. [6] N. Khajavi, P.S. Reinach, N. Slavi, M. Skrzypski, A. Lucius, O. Strauss, J. Kohrle, S. Mergler, Cell. Signal. 27 (2015) 315–325. [7] H. Hirata, M.L. Oshinsky, J. Neurophysiol. 107 (2012) 1199–1209. [8] N. Khajavi, P.S. Reinach, M. Skrzypski, A. Lude, S. Mergler, Cell. Physiol. Biochem. 34 (2014) 790–803. [9] S. Mergler, F. Garreis, M. Sahlmuller, E.M. Lyras, P.S. Reinach, A. Dwarakanath, F. Paulsen, U. Pleyer, Histochem. Cell Biol. 137 (2012) 743–761. [10] S. Mergler, M. Valtink, S. Takayoshi, Y. Okada, M. Miyajima, S. Saika, P.S. Reinach, Ophthalmic Res. 52 (2014) 151–159. [11] P.S. Reinach, W. Chen, S. Mergler, Eye Vis. (Lond) 2 (2015), http://dx.doi.org/10. 1186/s40662-40015-40016-40664. [12] P.S. Reinach, S. Mergler, Y. Okada, S. Saika, BMC Ophthalmol. (2015)http://dx.doi. org/10.1186/s12886-015-0135-7 (in press). [13] F. Zhang, H. Yang, Z. Wang, S. Mergler, H. Liu, T. Kawakita, S.D. Tachado, Z. Pan, J.E. Capo-Aponte, U. Pleyer, H. Koziel, W.W. Kao, P.S. Reinach, J. Cell. Physiol. 213 (2007) 730–739. [14] S. Mergler, M. Valtink, V.J. Coulson-Thomas, D. Lindemann, P.S. Reinach, K. Engelmann, U. Pleyer, Exp. Eye Res. 90 (2010) 758–770. [15] S. Mergler, F. Garreis, M. Sahlmuller, P.S. Reinach, F. Paulsen, U. Pleyer, J. Cell. Physiol. 226 (2011) 1828–1842. [16] Y. Yang, H. Yang, Z. Wang, S. Mergler, J.M. Wolosin, P.S. Reinach, Exp. Eye Res. 107 (2013) 121–129. [17] T. Sumioka, Y. Okada, P.S. Reinach, K. Shirai, M. Miyajima, O. Yamanaka, S. Saika, Invest. Ophthalmol. Vis. Sci. 55 (2014) 3295–3302. [18] Z. Wang, Y. Yang, H. Yang, J.E. Capo-Aponte, S.D. Tachado, J.M. Wolosin, P.S. Reinach, Mol. Vis. 17 (2011) 3137–3146.

A. Lucius et al. / Cellular Signalling 28 (2016) 136–147 [19] Y. Okada, P.S. Reinach, K. Shirai, A. Kitano, W.W. Kao, K.C. Flanders, M. Miyajima, H. Liu, J. Zhang, S. Saika, Am. J. Pathol. 178 (2011) 2654–2664. [20] R. Caires, E. Luis, F.J. Taberner, G. Fernandez-Ballester, A. Ferrer-Montiel, E.A. Balazs, A. Gomis, C. Belmonte, E. de la Pena, Nat. Commun. 6 (2015) 8095. [21] B. Nilius, G. Owsianik, T. Voets, J.A. Peters, Physiol. Rev. 87 (2007) 165–217. [22] M. Tominaga, M.J. Caterina, J. Neurobiol. 61 (2004) 3–12. [23] M. Tominaga, T. Tominaga, Pflugers Arch. 451 (2005) 143–150. [24] A. Parra, R. Madrid, D. Echevarria, S. del Olmo, C. Morenilla-Palao, M.C. Acosta, J. Gallar, A. Dhaka, F. Viana, C. Belmonte, Nat. Med. 16 (2010) 1396–1399. [25] S. Mergler, C. Mertens, M. Valtink, P.S. Reinach, V.C. Szekely, N. Slavi, F. Garreis, S. Abdelmessih, E. Turker, G. Fels, U. Pleyer, Exp. Eye Res. 116 (2013) 337–349. [26] R. Ramachandran, E. Hyun, L. Zhao, T.K. Lapointe, K. Chapman, C.L. Hirota, S. Ghosh, D.D. McKemy, N. Vergnolle, P.L. Beck, C. Altier, M.D. Hollenberg, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 7476–7481. [27] S. Mergler, Y. Cheng, S. Skosyrsky, F. Garreis, P. Pietrzak, N. Kociok, A. Dwarakanath, P.S. Reinach, V. Kakkassery, Exp. Eye Res. 94 (2012) 157–173. [28] C.S. Hoefig, J. Kohrle, G. Brabant, K. Dixit, B. Yap, C.J. Strasburger, Z. Wu, J. Clin. Endocrinol. Metab. 96 (2011) 1864–1872. [29] A. Saba, G. Chiellini, S. Frascarelli, M. Marchini, S. Ghelardoni, A. Raffaelli, M. Tonacchera, P. Vitti, T.S. Scanlan, R. Zucchi, Endocrinology 151 (2010) 5063–5073. [30] T.S. Scanlan, K.L. Suchland, M.E. Hart, G. Chiellini, Y. Huang, P.J. Kruzich, S. Frascarelli, D.A. Crossley, J.R. Bunzow, S. Ronca-Testoni, E.T. Lin, D. Hatton, R. Zucchi, D.K. Grandy, Nat. Med. 10 (2004) 638–642. [31] R. Zucchi, A. Accorroni, G. Chiellini, Front. Physiol. 5 (2014) 402. [32] G. Chiellini, S. Frascarelli, S. Ghelardoni, V. Carnicelli, S.C. Tobias, A. DeBarber, S. Brogioni, S. Ronca-Testoni, E. Cerbai, D.K. Grandy, T.S. Scanlan, R. Zucchi, FASEB J. 21 (2007) 1597–1608. [33] L.P. Klieverik, E. Foppen, M.T. Ackermans, M.J. Serlie, H.P. Sauerwein, T.S. Scanlan, D.K. Grandy, E. Fliers, A. Kalsbeek, J. Endocrinol. 201 (2009) 377–386. [34] S. Piehl, C.S. Hoefig, T.S. Scanlan, J. Kohrle, Endocr. Rev. 32 (2011) 64–80. [35] K.P. Doyle, K.L. Suchland, T.M. Ciesielski, N.S. Lessov, D.K. Grandy, T.S. Scanlan, M.P. Stenzel-Poore, Stroke 38 (2007) 2569–2576. [36] E. Galli, M. Marchini, A. Saba, S. Berti, M. Tonacchera, P. Vitti, T.S. Scanlan, G. Iervasi, R. Zucchi, J. Clin. Endocrinol. Metab. 97 (2012) E69–E74. [37] P. Venditti, G. Napolitano, S.L. Di, G. Chiellini, R. Zucchi, T.S. Scanlan, M.S. Di, Mol. Cell. Endocrinol. 341 (2011) 55–62. [38] J.B. Regard, H. Kataoka, D.A. Cano, E. Camerer, L. Yin, Y.W. Zheng, T.S. Scanlan, M. Hebrok, S.R. Coughlin, J. Clin. Invest. 117 (2007) 4034–4043. [39] Z. Pan, H. Yang, S. Mergler, H. Liu, S.D. Tachado, F. Zhang, W.W. Kao, H. Koziel, U. Pleyer, P.S. Reinach, Cell. Calcium 44 (2008) 374–385. [40] T. Voets, G. Droogmans, U. Wissenbach, A. Janssens, V. Flockerzi, B. Nilius, Nature 430 (2004) 748–754. [41] G. Grynkiewicz, M. Poenie, R.Y. Tsien, J. Biol. Chem. 260 (1985) 3440–3450. [42] S. Mergler, R. Derckx, P.S. Reinach, F. Garreis, A. Böhm, L. Schmelzer, S. Skosyrski, N. Ramesh, S. Abdelmessih, O.K. Polat, N. Khajavi, A.I. Riechardt, Cell. Signal. 26 (2014) 56–69. [43] S. Mergler, M. Valtink, V.J. Coulson-Thomas, D. Lindemann, P.S. Reinach, K. Engelmann, U. Pleyer, Exp. Eye Res. 93 (2010) 710–719. [44] S. Thebault, L. Lemonnier, G. Bidaux, M. Flourakis, A. Bavencoffe, D. Gordienko, M. Roudbaraki, P. Delcourt, Y. Panchin, Y. Shuba, R. Skryma, N. Prevarskaya, J. Biol. Chem. 280 (2005) 39423–39435. [45] M. Valero, C. Morenilla-Palao, C. Belmonte, F. Viana, Pflugers Arch. 461 (2011) 99–114. [46] K.J. Valenzano, E.R. Grant, G. Wu, M. Hachicha, L. Schmid, L. Tafesse, Q. Sun, Y. Rotshteyn, J. Francis, J. Limberis, S. Malik, E.R. Whittemore, D. Hodges, J. Pharmacol. Exp. Ther. 306 (2003) 377–386.

147

[47] E.M. Anderson, A.C. Jenkins, R.M. Caudle, J.K. Neubert, PLoS ONE 9 (2014) e89137. [48] S. Mergler, M.Z. Strowski, S. Kaiser, T. Plath, Y. Giesecke, M. Neumann, H. Hosokawa, S. Kobayashi, J. Langrehr, P. Neuhaus, U. Plockinger, B. Wiedenmann, C. Grotzinger, Neuroendocrinology 85 (2007) 81–92. [49] S.M. Rawls, T. Gomez, Z. Ding, R.B. Raffa, Eur. J. Pharmacol. 575 (2007) 103–104. [50] D.A. Andersson, H.W.N. Chase, S. Bevan, J. Neurosci. 24 (2004) 5364–5369. [51] D.D. McKemy, W.M. Neuhausser, D. Julius, Nature 416 (2002) 52–58. [52] H.H. Chuang, W.M. Neuhausser, D. Julius, Neuron 43 (2004) 859–869. [53] H.J. Behrendt, T. Germann, C. Gillen, H. Hatt, R. Jostock, Br. J. Pharmacol. 141 (2004) 737–745. [54] Y. Cho, Y. Jang, Y.D. Yang, C.H. Lee, Y. Lee, U. Oh, Cell. Calcium 48 (2010) 202–208. [55] S. Cordeiro, S. Seyler, J. Stindl, V.M. Milenkovic, O. Strauss, Invest. Ophthalmol. Vis. Sci. 51 (2010) 6001–6008. [56] Y. Liu, M.L. Lubin, T.L. Reitz, Y. Wang, R.W. Colburn, C.M. Flores, N. Qin, Eur. J. Pharmacol. 530 (2006) 23–32. [57] R. Madrid, T. Donovan-Rodriguez, V. Meseguer, M.C. Acosta, C. Belmonte, F. Viana, J. Neurosci. 26 (2006) 12512–12525. [58] Z. Lei, O. Ishizuka, T. Imamura, W. Noguchi, T. Yamagishi, H. Yokoyama, Y. Kurizaki, G.S. Sudha, T. Hosoda, O. Nishizawa, K.E. Andersson, Neurourol. Urodyn. 32 (2013) 500–504. [59] E.S. Lashinger, M.S. Steiginga, J.P. Hieble, L.A. Leon, S.D. Gardner, R. Nagilla, E.A. Davenport, B.E. Hoffman, N.J. Laping, X. Su, Am. J. Physiol. Ren. Physiol. 295 (2008) F803–F810. [60] M.L. Valero, F. Mello de Queiroz, W. Stuhmer, F. Viana, L.A. Pardo, PLoS ONE 7 (2012) e51825. [61] C.R. Halaszovich, C. Zitt, E. Jungling, A. Luckhoff, J. Biol. Chem. 275 (2000) 37423–37428. [62] S.A. Hackenmueller, T.S. Scanlan, J. Chromatogr. A 1256 (2012) 89–97. [63] H.N. Panas, L.J. Lynch, E.J. Vallender, Z. Xie, G.L. Chen, S.K. Lynn, T.S. Scanlan, G.M. Miller, J. Neurosci. Res. 88 (2010) 1962–1969. [64] A.H. Neufeld, K.A. Zawistowski, E.D. Page, B.B. Bromberg, Invest. Ophthalmol. Vis. Sci. 17 (1978) 1069–1075. [65] T. Matsuo, M.S. Cynader, Ophthalmic Res. 24 (1992) 213–219. [66] B.O. Messina, C.G. Pacheco, J. Toral-Lopez, S.F. Lara Huerta, L.M. Gonzalez-Huerta, H. Urueta-Cuellar, M.R. Rivera-Vega, I. Babayan-Mena, S.A. Cuevas-Covarrubias, Curr. Eye Res. 39 (2014) 1076–1080. [67] J. Dinter, N. Khajavi, J. Muehlhaus, C.L. Wienchol, M. Coester, T. Hermsdorf, C. Staeubert, J. Koehrle, T. Schoenebert, G. Kleinau, S. Mergler, H. Biebermann, Eur. Thyroid J. 4 (Suppl. 1) (2015) 21–29. [68] A.G. Ianculescu, K.M. Giacomini, T.S. Scanlan, Endocrinology 150 (2009) 1991–1999. [69] S. Ghelardoni, G. Chiellini, S. Frascarelli, A. Saba, R. Zucchi, J. Endocrinol. 221 (2014) 101–110. [70] J. Dinter, J. Muhlhaus, S.F. Jacobi, C.L. Wienchol, M. Coster, J. Meister, C.S. Hoefig, A. Muller, J. Kohrle, A. Gruters, H. Krude, J. Mittag, T. Schoneberg, G. Kleinau, H. Biebermann, J. Mol. Endocrinol. 54 (2015) 205–216. [71] J. Dinter, J. Muhlhaus, C.L. Wienchol, C.X. Yi, D. Nurnberg, S. Morin, A. Gruters, J. Kohrle, T. Schoneberg, M. Tschop, H. Krude, G. Kleinau, H. Biebermann, PLoS ONE 10 (2015) e0117774. [72] S.D. Klyce, Invest. Ophthalmol. Vis. Sci. 16 (1977) 968–973. [73] X. Zhang, S. Mak, L. Li, A. Parra, B. Denlinger, C. Belmonte, P.A. McNaughton, Nat. Cell Biol. 14 (2012) 851–858. [74] H.D. Perry, E.D. Donnenfeld, Curr. Opin. Ophthalmol. 15 (2004) 299–304. [75] S.C. Pflugfelder, Am J. Ophthalmol. 137 (2004) 337–342.