- Email: [email protected]
3GC cloning: PCR products cloning mediated by terminal deoxynucleotidyl transferase
Analytical Biochemistry 378 (2008) 108–110
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
3GC cloning: PCR products cloning mediated by terminal deoxynucleotidyl transferase Dong Zheng, Xuedong Liu *, Yanna Zhou Laboratory of Genetics and Molecular Biology, Northeast Forestry University, Harbin 150040, China
a r t i c l e
i n f o
Article history: Received 2 February 2008 Available online 9 April 2008
a b s t r a c t We have developed a PCR product cloning strategy called 3GC cloning. Through this strategy, PCR products tailed with more than three homopolymeric deoxycytidines (dCs) at the 30 ends by terminal deoxynucleotidyl transferase (TdT) would anneal complementarily with three-deoxyguanosine (dG) protruding ends of 3G vector, which was generated through coupled SfiI cleavage at both recognition sites. Redundant overhangs at insert–vector junctions after ligation would be trimmed off and repaired in bacteria, and the length of such junction was only three G/C pairs. Any chain lengths of three or more nucleotides, which are able to serve as substrates for TdT, could theoretically be cloned by this strategy. Ó 2008 Elsevier Inc. All rights reserved.
Terminal deoxynucleotidyl transferase (TdT)1, also called terminal transferase, is a DNA polymerase that catalyzes the addition of dNTPs to the 3’ hydroxyl terminus of DNA [1,2]. Protruding, recessed, or blunt-ended double- or single-stranded DNA [3] and even RNA [4] molecules with chain lengths of three or more nucleotides can serve as substrates for TdT. This property of TdT led to development of well-accepted techniques such as TdT-mediated dUTP nick end labeling (TUNEL) for apoptosis detection [5,6]. This property also leads to our hypothesis for a PCR product cloning strategy that (i) these nucleotides at the 30 ends of DNA inserts subsequently serve as ‘‘tails” for cloning by annealing complementary homopolymeric sticky ends of vector (Fig. 1) and that (ii) the noncomplementary regions (gaps and/or overhangs) can be effectively repaired by the bacteria once the annealed DNA complex is introduced into the cell,. Most of these use a plasmid vector with three-deoxyguanosine (dG) residues linked to the 30 ends of linearized plasmid DNA, which would allow annealing to occur between the vectors and the deoxycytidine (dC)-tailed PCR products. These vectors with three-dG sticky ends after coupled SfiI cleavage [7] are generally referred to as 3G vectors, and the process is called 3GC cloning. This cloning method could omit attaching ‘‘add-on” base sequences having preferred restriction recognition sequences to PCR primers and could limit vector–insert junction length to only three G/C pairs that would be convenient for downstream gene manipulation and analysis.
* Corresponding author. Fax: +86 451 82190624. E-mail address: [email protected] (X. Liu). 1 Abbreviations used: TdT, terminal deoxynucleotidyl transferase; TUNEL, TdTmediated dUTP nick end labeling; dG, deoxyguanosine; dC, deoxycytidine; EDTA, ethylenediaminetetraacetic acid; cDNA, complementary DNA; LB, Luria–Bertani; IPTG, isopropyl-b-D-thiogalactopyranoside; X-Gal, 5-bromo-4-chloro-3-idolyl-b-Dgalactoside; CFU, colony-forming units; PPC, percentage of positive colonies; RT, reverse transcriptase. 0003-2697/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2008.03.053
To facilitate the 3G vector, a 55-bp polylinker containing two SfiI recognition sites was inserted into EcoRI/BamHI double-digested pUC18 (Takara, Liaoning, China) (Fig. 1). The 2716-bp 3G vector (2 lg) was treated with 30 U of SfiI (New England Biolabs, Ipswich, MA, USA) in a 50-ll reaction at 37 °C for 4 h. The entire sample was loaded onto one 1% agarose gel containing 1 lg/ml ethidium bromide for electrophoresis. The target vector digestion products were excised from each lane of the gel and placed into one 0.5-ml microtube that was punched at the bottom using an 18-gauge needle. Each 0.5-ml microtube was placed in a sterile 1.5-ml microtube and was centrifuged at maximum speed for 2 to 3 min. The excised bands were broken into small pieces and collected in the 1.5-ml microtube. Then 150 ll of LoTE buffer (3 mmol/L Tris–HCl and 0.2 mmol/L ethylenediaminetetraacetic acid [EDTA], pH 7.5)/7.5 mol/L ammonium acetate (125:25) mix was added to the 1.5-ml microtube containing the gel pieces and was incubated at 65 °C for 2 h to elute the DNA from the gel. DNA was precipitated with ethanol, and the DNA pellet was redissolved into 40 ng/ll with water and stored at 4 °C. To prepare the PCR product for this study, a 753-bp PCR product containing signal peptide and FN3 domain of bovine growth hormone receptor gene was amplified using a pair of forward (ATGGA TCTCTGGCAGCTG) and reverse (TCACATCTGAGGAAATGTTATCAGG AG) primers in a total reaction volume of 100 ll (20 pmol of each primer, 4 ll of complementary DNA [cDNA] template, and 2.5 U of Taq DNA polymerase). Amplification was performed in an ABI 2710 thermocycler (Applied Biosystems, Foster City, CA, USA) as follows: 2 min at 94 °C, then 35 cycles of 5 s at 94 °C, 30 s at 55 °C, and 30 s at 72 °C, and then an additional 7 min at 72 °C. After electrophoresis and purification, a typical 50-ll dC tailing reaction (1 NEB buffer, 250 lmol/L CoCl2, 5 pmol of purified DNA inserts, 10 lmol/L dCTP, and 10 U of TdT) was performed at 37 °C for 30 min. Then 3 to 10 dCs were added at each 30 end of PCR prod-
Notes & Tips / Anal. Biochem. 378 (2008) 108–110
109
Polylinker inserted into pUC18 EcoRI SfiI SfiI BamHI HincII ATTACGAATTCGCATGCGGCCGGGGGGGCCGTCGACAGCATGCATGCGGCCCCCCCGGCCGGATCC TAATGCTTAAGCGTACGCCGGCCCCCCCGGCAGCTGTCGTACGTACGCCGGGGGGGCCGGCCTAGG
SfiI-digested polylinker after inserted into pUC18 vector EcoRI 5’ ATTACGAATTCGCATGCGGCCGGGG 3’ TAATGCTTAAGCGTACGCCGGC
BamHI CGGCCGGATCC 3’ GGGGCCGGCCTAGG 5’
PCR products tailed with terminal transferase 5’ ......DNA fragment...... CCCCCCC 3’ ...... 5’ 3’ CCCCCC......
After annealing inserts and vectors EcoRI BamHI ATTACGAATTCGCATGCGGCCGGGG......DNA fragment......CCCCCCCCGGCCGGATCC TAATGCTTAAGCGTACGCCGGCCCC...... ...... GGGGCCGGCCTAGG C overhang C gap C Fig. 1. Schematic diagrams of 3GC cloning. Polylinker for pUC18 is used to illustrate the design of 3G vector. The polylinker region was designed to ensure that the LacZa reading frame was maintained and further to avoid false positives caused by blunt end self-ligation of vector. Coupled SfiI cleavage at both recognition sites would facilitate more plasmid convert directly to the completed digestion products. Theoretically, gap and overhang might exist in the annealed complex, and the bacterial repairing system could efficiently repair them.
ucts. The reaction was stopped by adding 10 ll of 0.2 mol/L EDTA, and DNA was precipitated with ethanol and then quantified and diluted as above. The insert and vector were annealed (insert/vector ratio 1:1) at 35 °C, and the mix was cooled gradually to 16 °C. Ligation was performed using a LigaFast Rapid DNA Ligation System (Promega, Madison, WI, USA), and the annealing mixture (5 ll) was used directly for transformation. One-tenth of the transformation reaction
mixture was plated onto a Luria–Bertani (LB) agar plate (100 mg/ ml ampicillin, 20 mg/ml IPTG, and 20 mg/ml X-Gal). The resulting colonies were briefly selected by blue/white analyzed by restriction digestion, and the positives were further analyzed by DNA sequencing. The average transformation efficiency of DH5a cells was 3.25 105 colony-forming units (CFU)/lg DNA. The average percentage of positive colonies (PPC) was 84.33%. There was no discernible difference between different vector/insert ratios.
A
ccc
VECTOR INSERT ATTACGAATTCGCATGCGGCCGGGGATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCT TAATGCTTAAGCGTACGCCGGCCCCTACCTAGAGACCGTCGACGACAACTGGAACCGTCACCGTCCGAGGTCACTGCGA EcoRI overhang Bacteria Repair Sequencing ATTACGAATTCGCATGCGGCCGGGGATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCT TAATGCTTAAGCGTACGCCGGCCCCTACCTAGAGACCGTCGACGACAACTGGAACCGTCACCGTCCGAGGTCACTGCGA
B
EcoRI
***
Fig. 2. DNA sequencing performed on a recombinant clone produced by the 3GC cloning procedure. (A) Sequence analysis of the junction that contains noncomplementary regions. Redundant overhang at the junction of the experimental design was trimmed off and correctly repaired, and sequencing analysis showed that all junctions were three G/C pairs irrespective of various lengths of poly(dC) tails at the 30 ends of the PCR products. (B) Chromatogram of sequencing data. In panel B, the three asterisks (***) show the insert–vector junction, and the arrow (;) shows the first base of coding sequence (CDS) of growth hormone receptor.
110
Notes & Tips / Anal. Biochem. 378 (2008) 108–110
Among all positive colonies sampled, there was one false-positive colony with SfiI-cut vector; sequence analysis of this colony showed that a rearrangement of part of the multiple cutting sites had occurred. We did not find any false positives caused by blunt end self-ligation of vectors as described by Mead and coworkers [8]. From the experimental design, theoretically, gaps and/or overhangs would inevitably occur in the annealed insert–vector complexes (Fig. 1). However, among all 52 correct positive colonies selected randomly, sequencing results disclosed that no detectable gaps existed in the annealed insert–vector complexes (Fig. 2). Overhangs were correctly repaired, although length of the dC tails at the 30 end of PCR products may vary from several to tens of nucleotides. Mechanisms underlying these phenomena are currently unknown and need further investigation. The 3GC cloning mediated by TdT is highly reproducible and reliable for DNA cloning and gene fusion. Theoretically, any chain lengths of three or more nucleotides that are able to be TdT substrates could be cloned by this strategy. We have testified that this method could be used in different Escherichia coli strains (DH5a, JM109, and HB101); these results are consistent with observations by Li and Evans [9]. We successfully cloned another 12 different genes by this strategy (data not shown). It is worth noting that the 3GC strategy has several potential applications. For example, based on the fact that terminal transferase activity would cause reverse transcriptase (RT) to add a few additional dCs to the 3’ end of the first-strand cDNA [10], the 3G vector could be used to prime synthesizing second-strand cDNA and further construct the cDNA library. In summary, we have developed a new molecular cloning strategy, 3GC cloning, which complementarily annealed PCR products dC-tailed by TdT and 3G vector that contained three-dG sticky ends, making cloning simpler and more cost-effective. We demonstrated that by using this method, any PCR products produced by Taq DNA polymerase can be cloned efficiently into the 3G vector.
Acknowledgments This project was sponsored by the Scientific Research Foundation for the Returned Overseas Chinese Scholars of State Education Ministry and Heilongjiang Province (LC06C36), the Key Technologies R&D Program of Heilongjiang Province (GC03B514), and the National Natural Science Foundation of China (30771218). References [1] K. Kato, J. Moura Gonalves, G.E. Houts, F.J. Bollum, Deoxynucleotidepolymerizing enzymes of calf thymus gland: II. Properties of the terminal deoxynucleotidyl transferase, J. Biol. Chem. 242 (1967) 2780–2789. [2] V.N. Pandey, M.J. Modak, Biochemistry of terminal deoxynucleotidyl transferase: Identification and unity of ribo- and deoxyribonucleoside triphosphate binding site in terminal deoxynucleotidyl transferase, J. Biol. Chem. 264 (1989) 867–871. [3] G. Maga, K. Ramadan, G.A. Locatelli, I. Shevelev, S. Spadari, U. Hubscher, DNA elongation by the human DNA polymerase, k polymerase, and terminal transferase activities are differentially coordinated by proliferating cell nuclear antigen and replication protein A, J. Biol. Chem. 280 (2005) 1971–1981. [4] V. Rosemeyer, A. Laubrock, R. Seibl, Nonradioactive 30 -end-labeling of RNA molecules of different lengths by terminal deoxynucleotidyl transferase, Anal. Biochem. 224 (1995) 446–449. [5] Y.S. Gavrieli, S. Ben-Sasson, Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation, J. Cell Biol. 119 (1992) 493– 501. [6] Z. Darzynkiewicz, X. Li, J. Gong, Assays of cell viability: Discrimination of cells dying by apoptosis, in: Z. Darzynkiewicz, J.P. Robinson, H.A. Crissman (Eds.), Methods in Cell Biology Flow Cytometry, vol. 41, Academic Press, San Diego, 1994, pp. 15–38. [7] L.M. Wentzell, T.J. Nobbs, S.E. Halford, The Sfi I restriction endonuclease makes a four-strand DNA break at two copies of its recognition sequence, J. Mol. Biol. 248 (1995) 581–595. [8] D.A. Mead, N.K. Pey, C. Herrnstadt, R.A. Marcil, L.M. Smith, A universal method for the direct cloning of PCR amplified nucleic acid, Bio/Technology 9 (1991) 657–663. [9] C. Li, R.M. Evans, Ligation independent cloning irrespective of restriction site compatibility, Nucleic Acids Res. 25 (1997) 4165–4166. [10] W.M. Schmidt, M.W. Mueller, CapSelect: A highly sensitive method for 5’ CAP dependent enrichment of full-length cDNA in PCR mediated analysis of mRNAs, Nucleic Acids Res. 27 (1999) e31.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
3GC cloning: PCR products cloning mediated by terminal deoxynucleotidyl transferase Dong Zheng, Xuedong Liu *, Yanna Zhou Laboratory of Genetics and Molecular Biology, Northeast Forestry University, Harbin 150040, China
a r t i c l e
i n f o
Article history: Received 2 February 2008 Available online 9 April 2008
a b s t r a c t We have developed a PCR product cloning strategy called 3GC cloning. Through this strategy, PCR products tailed with more than three homopolymeric deoxycytidines (dCs) at the 30 ends by terminal deoxynucleotidyl transferase (TdT) would anneal complementarily with three-deoxyguanosine (dG) protruding ends of 3G vector, which was generated through coupled SfiI cleavage at both recognition sites. Redundant overhangs at insert–vector junctions after ligation would be trimmed off and repaired in bacteria, and the length of such junction was only three G/C pairs. Any chain lengths of three or more nucleotides, which are able to serve as substrates for TdT, could theoretically be cloned by this strategy. Ó 2008 Elsevier Inc. All rights reserved.
Terminal deoxynucleotidyl transferase (TdT)1, also called terminal transferase, is a DNA polymerase that catalyzes the addition of dNTPs to the 3’ hydroxyl terminus of DNA [1,2]. Protruding, recessed, or blunt-ended double- or single-stranded DNA [3] and even RNA [4] molecules with chain lengths of three or more nucleotides can serve as substrates for TdT. This property of TdT led to development of well-accepted techniques such as TdT-mediated dUTP nick end labeling (TUNEL) for apoptosis detection [5,6]. This property also leads to our hypothesis for a PCR product cloning strategy that (i) these nucleotides at the 30 ends of DNA inserts subsequently serve as ‘‘tails” for cloning by annealing complementary homopolymeric sticky ends of vector (Fig. 1) and that (ii) the noncomplementary regions (gaps and/or overhangs) can be effectively repaired by the bacteria once the annealed DNA complex is introduced into the cell,. Most of these use a plasmid vector with three-deoxyguanosine (dG) residues linked to the 30 ends of linearized plasmid DNA, which would allow annealing to occur between the vectors and the deoxycytidine (dC)-tailed PCR products. These vectors with three-dG sticky ends after coupled SfiI cleavage [7] are generally referred to as 3G vectors, and the process is called 3GC cloning. This cloning method could omit attaching ‘‘add-on” base sequences having preferred restriction recognition sequences to PCR primers and could limit vector–insert junction length to only three G/C pairs that would be convenient for downstream gene manipulation and analysis.
* Corresponding author. Fax: +86 451 82190624. E-mail address: [email protected] (X. Liu). 1 Abbreviations used: TdT, terminal deoxynucleotidyl transferase; TUNEL, TdTmediated dUTP nick end labeling; dG, deoxyguanosine; dC, deoxycytidine; EDTA, ethylenediaminetetraacetic acid; cDNA, complementary DNA; LB, Luria–Bertani; IPTG, isopropyl-b-D-thiogalactopyranoside; X-Gal, 5-bromo-4-chloro-3-idolyl-b-Dgalactoside; CFU, colony-forming units; PPC, percentage of positive colonies; RT, reverse transcriptase. 0003-2697/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2008.03.053
To facilitate the 3G vector, a 55-bp polylinker containing two SfiI recognition sites was inserted into EcoRI/BamHI double-digested pUC18 (Takara, Liaoning, China) (Fig. 1). The 2716-bp 3G vector (2 lg) was treated with 30 U of SfiI (New England Biolabs, Ipswich, MA, USA) in a 50-ll reaction at 37 °C for 4 h. The entire sample was loaded onto one 1% agarose gel containing 1 lg/ml ethidium bromide for electrophoresis. The target vector digestion products were excised from each lane of the gel and placed into one 0.5-ml microtube that was punched at the bottom using an 18-gauge needle. Each 0.5-ml microtube was placed in a sterile 1.5-ml microtube and was centrifuged at maximum speed for 2 to 3 min. The excised bands were broken into small pieces and collected in the 1.5-ml microtube. Then 150 ll of LoTE buffer (3 mmol/L Tris–HCl and 0.2 mmol/L ethylenediaminetetraacetic acid [EDTA], pH 7.5)/7.5 mol/L ammonium acetate (125:25) mix was added to the 1.5-ml microtube containing the gel pieces and was incubated at 65 °C for 2 h to elute the DNA from the gel. DNA was precipitated with ethanol, and the DNA pellet was redissolved into 40 ng/ll with water and stored at 4 °C. To prepare the PCR product for this study, a 753-bp PCR product containing signal peptide and FN3 domain of bovine growth hormone receptor gene was amplified using a pair of forward (ATGGA TCTCTGGCAGCTG) and reverse (TCACATCTGAGGAAATGTTATCAGG AG) primers in a total reaction volume of 100 ll (20 pmol of each primer, 4 ll of complementary DNA [cDNA] template, and 2.5 U of Taq DNA polymerase). Amplification was performed in an ABI 2710 thermocycler (Applied Biosystems, Foster City, CA, USA) as follows: 2 min at 94 °C, then 35 cycles of 5 s at 94 °C, 30 s at 55 °C, and 30 s at 72 °C, and then an additional 7 min at 72 °C. After electrophoresis and purification, a typical 50-ll dC tailing reaction (1 NEB buffer, 250 lmol/L CoCl2, 5 pmol of purified DNA inserts, 10 lmol/L dCTP, and 10 U of TdT) was performed at 37 °C for 30 min. Then 3 to 10 dCs were added at each 30 end of PCR prod-
Notes & Tips / Anal. Biochem. 378 (2008) 108–110
109
Polylinker inserted into pUC18 EcoRI SfiI SfiI BamHI HincII ATTACGAATTCGCATGCGGCCGGGGGGGCCGTCGACAGCATGCATGCGGCCCCCCCGGCCGGATCC TAATGCTTAAGCGTACGCCGGCCCCCCCGGCAGCTGTCGTACGTACGCCGGGGGGGCCGGCCTAGG
SfiI-digested polylinker after inserted into pUC18 vector EcoRI 5’ ATTACGAATTCGCATGCGGCCGGGG 3’ TAATGCTTAAGCGTACGCCGGC
BamHI CGGCCGGATCC 3’ GGGGCCGGCCTAGG 5’
PCR products tailed with terminal transferase 5’ ......DNA fragment...... CCCCCCC 3’ ...... 5’ 3’ CCCCCC......
After annealing inserts and vectors EcoRI BamHI ATTACGAATTCGCATGCGGCCGGGG......DNA fragment......CCCCCCCCGGCCGGATCC TAATGCTTAAGCGTACGCCGGCCCC...... ...... GGGGCCGGCCTAGG C overhang C gap C Fig. 1. Schematic diagrams of 3GC cloning. Polylinker for pUC18 is used to illustrate the design of 3G vector. The polylinker region was designed to ensure that the LacZa reading frame was maintained and further to avoid false positives caused by blunt end self-ligation of vector. Coupled SfiI cleavage at both recognition sites would facilitate more plasmid convert directly to the completed digestion products. Theoretically, gap and overhang might exist in the annealed complex, and the bacterial repairing system could efficiently repair them.
ucts. The reaction was stopped by adding 10 ll of 0.2 mol/L EDTA, and DNA was precipitated with ethanol and then quantified and diluted as above. The insert and vector were annealed (insert/vector ratio 1:1) at 35 °C, and the mix was cooled gradually to 16 °C. Ligation was performed using a LigaFast Rapid DNA Ligation System (Promega, Madison, WI, USA), and the annealing mixture (5 ll) was used directly for transformation. One-tenth of the transformation reaction
mixture was plated onto a Luria–Bertani (LB) agar plate (100 mg/ ml ampicillin, 20 mg/ml IPTG, and 20 mg/ml X-Gal). The resulting colonies were briefly selected by blue/white analyzed by restriction digestion, and the positives were further analyzed by DNA sequencing. The average transformation efficiency of DH5a cells was 3.25 105 colony-forming units (CFU)/lg DNA. The average percentage of positive colonies (PPC) was 84.33%. There was no discernible difference between different vector/insert ratios.
A
ccc
VECTOR INSERT ATTACGAATTCGCATGCGGCCGGGGATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCT TAATGCTTAAGCGTACGCCGGCCCCTACCTAGAGACCGTCGACGACAACTGGAACCGTCACCGTCCGAGGTCACTGCGA EcoRI overhang Bacteria Repair Sequencing ATTACGAATTCGCATGCGGCCGGGGATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCT TAATGCTTAAGCGTACGCCGGCCCCTACCTAGAGACCGTCGACGACAACTGGAACCGTCACCGTCCGAGGTCACTGCGA
B
EcoRI
***
Fig. 2. DNA sequencing performed on a recombinant clone produced by the 3GC cloning procedure. (A) Sequence analysis of the junction that contains noncomplementary regions. Redundant overhang at the junction of the experimental design was trimmed off and correctly repaired, and sequencing analysis showed that all junctions were three G/C pairs irrespective of various lengths of poly(dC) tails at the 30 ends of the PCR products. (B) Chromatogram of sequencing data. In panel B, the three asterisks (***) show the insert–vector junction, and the arrow (;) shows the first base of coding sequence (CDS) of growth hormone receptor.
110
Notes & Tips / Anal. Biochem. 378 (2008) 108–110
Among all positive colonies sampled, there was one false-positive colony with SfiI-cut vector; sequence analysis of this colony showed that a rearrangement of part of the multiple cutting sites had occurred. We did not find any false positives caused by blunt end self-ligation of vectors as described by Mead and coworkers [8]. From the experimental design, theoretically, gaps and/or overhangs would inevitably occur in the annealed insert–vector complexes (Fig. 1). However, among all 52 correct positive colonies selected randomly, sequencing results disclosed that no detectable gaps existed in the annealed insert–vector complexes (Fig. 2). Overhangs were correctly repaired, although length of the dC tails at the 30 end of PCR products may vary from several to tens of nucleotides. Mechanisms underlying these phenomena are currently unknown and need further investigation. The 3GC cloning mediated by TdT is highly reproducible and reliable for DNA cloning and gene fusion. Theoretically, any chain lengths of three or more nucleotides that are able to be TdT substrates could be cloned by this strategy. We have testified that this method could be used in different Escherichia coli strains (DH5a, JM109, and HB101); these results are consistent with observations by Li and Evans [9]. We successfully cloned another 12 different genes by this strategy (data not shown). It is worth noting that the 3GC strategy has several potential applications. For example, based on the fact that terminal transferase activity would cause reverse transcriptase (RT) to add a few additional dCs to the 3’ end of the first-strand cDNA [10], the 3G vector could be used to prime synthesizing second-strand cDNA and further construct the cDNA library. In summary, we have developed a new molecular cloning strategy, 3GC cloning, which complementarily annealed PCR products dC-tailed by TdT and 3G vector that contained three-dG sticky ends, making cloning simpler and more cost-effective. We demonstrated that by using this method, any PCR products produced by Taq DNA polymerase can be cloned efficiently into the 3G vector.
Acknowledgments This project was sponsored by the Scientific Research Foundation for the Returned Overseas Chinese Scholars of State Education Ministry and Heilongjiang Province (LC06C36), the Key Technologies R&D Program of Heilongjiang Province (GC03B514), and the National Natural Science Foundation of China (30771218). References [1] K. Kato, J. Moura Gonalves, G.E. Houts, F.J. Bollum, Deoxynucleotidepolymerizing enzymes of calf thymus gland: II. Properties of the terminal deoxynucleotidyl transferase, J. Biol. Chem. 242 (1967) 2780–2789. [2] V.N. Pandey, M.J. Modak, Biochemistry of terminal deoxynucleotidyl transferase: Identification and unity of ribo- and deoxyribonucleoside triphosphate binding site in terminal deoxynucleotidyl transferase, J. Biol. Chem. 264 (1989) 867–871. [3] G. Maga, K. Ramadan, G.A. Locatelli, I. Shevelev, S. Spadari, U. Hubscher, DNA elongation by the human DNA polymerase, k polymerase, and terminal transferase activities are differentially coordinated by proliferating cell nuclear antigen and replication protein A, J. Biol. Chem. 280 (2005) 1971–1981. [4] V. Rosemeyer, A. Laubrock, R. Seibl, Nonradioactive 30 -end-labeling of RNA molecules of different lengths by terminal deoxynucleotidyl transferase, Anal. Biochem. 224 (1995) 446–449. [5] Y.S. Gavrieli, S. Ben-Sasson, Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation, J. Cell Biol. 119 (1992) 493– 501. [6] Z. Darzynkiewicz, X. Li, J. Gong, Assays of cell viability: Discrimination of cells dying by apoptosis, in: Z. Darzynkiewicz, J.P. Robinson, H.A. Crissman (Eds.), Methods in Cell Biology Flow Cytometry, vol. 41, Academic Press, San Diego, 1994, pp. 15–38. [7] L.M. Wentzell, T.J. Nobbs, S.E. Halford, The Sfi I restriction endonuclease makes a four-strand DNA break at two copies of its recognition sequence, J. Mol. Biol. 248 (1995) 581–595. [8] D.A. Mead, N.K. Pey, C. Herrnstadt, R.A. Marcil, L.M. Smith, A universal method for the direct cloning of PCR amplified nucleic acid, Bio/Technology 9 (1991) 657–663. [9] C. Li, R.M. Evans, Ligation independent cloning irrespective of restriction site compatibility, Nucleic Acids Res. 25 (1997) 4165–4166. [10] W.M. Schmidt, M.W. Mueller, CapSelect: A highly sensitive method for 5’ CAP dependent enrichment of full-length cDNA in PCR mediated analysis of mRNAs, Nucleic Acids Res. 27 (1999) e31.