- Email: [email protected]
4.002 Genetic aspects of male infertility in assisted reproduction
Abstracts - PGDIS: 8th International Symposium on PGD
PGD may also be recommended to transfer only embryos coming from euploid oocytes and free of the monogenic disease, in order to achieve a higher chance of successful implantation. We suggest that double factor PGD (DF-PGD) be used to perform both genetic and cytogenetic diagnoses. Von Hippel–Lindau syndrome (VHL) (OMIM# 193300) is a dominant, inherited family cancer syndrome that predisposes to a variety of malignant and benign neoplasms, most frequently retinal and cerebellar, but also spinal hemangioblastoma, renal cell carcinoma and pancreatic tumours. Several described mutations in the VHL gene (3p26–p27) are causative of this syndrome. A DF-PGD for a VHL-affected male carrier of the R161Q mutation in the VHL gene and a healthy 30-year-old female was performed. After ovarian stimulation, 12 mature oocytes were obtained. PGS: Comparative genomic hybridization (CGH), which allows for a cytogenetic analysis for all chromosomes, was applied to the ten first polar bodies (1PB) successfully biopsied immediately after fertilization by ICSI. After whole genome amplification, nine of the ten (90%) 1PB were CGH analysable using Metasystem software, on day +3. One out of the nine 1PB (11%) had aneuploid CGH profiles (1PB#1: 29XX,+2,+ 10,+12,+17,+19), while the rest (8/9; 89%) had euploid CGH profiles (1PBs #2, #3, #4, #5, #6, #7, #8 and #9). Mutation analysis: All 12 mature oocytes were fertilized and developed to 6–8 cell embryos on day +3. One single blastomere was biopsied from each one. Whole genome amplification with multiple displacement amplification was performed. A multiplex PCR containing primers for informative small tandem repeats (STR) close to the VHL gene (D3S1537 and D3S1675) and for a fragment containing the specific mutation was performed. Minisequencing was applied to detect the nucleotide change that produces the R161Q mutation using the following primer: 5'GACTAGGCTCCGGACAACCT3'. On day +4, genetic diagnosis was performed analysing both Minisequencing and STR results with an ABI Prism sequencer. Six out of the 12 (50%) embryos were affected by VHL, while the other six (50%) were unaffected (embryos #1, #2, #4, #5, #7 and #8). Five out of the six (83%) genetically healthy embryos came from oocytes considered euploid, thus they were transferable, while the other (17%) was aneuploid involving six chromosomes. Two of the embryos genetically and cytogenetically normal were transferred, achieving an ongoing twin pregnancy. The applied procedure (DF-PGD) can be a useful tool to increase the implantation rate of transferred embryos in PGD for carriers of monogenic diseases. FIS-ISCIII (PI 051395) funded this study. 4.002 Genetic aspects of male infertility in assisted reproduction Cinar C1, Beyazyurek C1, Ozgon G1, Ozkan S1, Ismailoglu B1, Oner O1, Fiorentino F2, Kahraman S1 1Istanbul Memorial Hospital, Istanbul, Turkey; 2Laboratorio Genoma, Italy Objective: Male infertility is present in up to half of infertile cases. This could be a result of genetic factors, such as numerical and structural chromosomal abnormalities and microdeletions of the Y chromosome. Cytogenetic and molecular screening analysis give valuable guidance in assisted reproduction treatments.
S-38 Reproductive BioMedicine Online, Vol. 16, Suppl. 3, April 2008
Materials/Methods: From March 2000 to September 2007, 1935 infertile men, 1214 with non-obstructive azoospermia (NOA) and 721 with oligoasthenoteratozoospermia (OAT), were referred to our ART and Reproductive Genetics Centre. World Health Organization 1999 criteria were taken into consideration for the evaluation of semen parameters and Kruger strict criteria was applied for the evaluation of sperm morphology. Karyotype analysis of 1935 cases was done using conventional cytogenetic techniques. For Y-deletion screening, genomic DNA was extracted from peripheral blood using a commercial kit. Twenty-five loci in the Yq region were amplified by multiplex polymerase chain reaction (PCR) with homemade primers. Results: The overall incidence of cytogenetic abnormalities was 12.45%. Klinefelter syndrome was the most frequent cytogenetic abnormality (10.95%) found in NOA group and both reciprocal and Robertsonian translocations (1.80% and 1.66%) are found to be the most frequent abnormalities in OAT group. The overall incidence of Y-chromosome microdeletion (n = 105) was 7.7%. The deletion rates were 1.85% and 9.5% for OAT and NOA groups, respectively. A total of 34 patients with microdeletions initiated treatment. Ejaculate sperm could be obtained from four patients with partial AZFc deletions. Micro-testicular sperm extraction (TESE) was applied to 30 patients with partial deletions of AZFa/b/c regions and spermatozoa were retrieved in 14 cases (46%). TESE was cancelled for 50 cases with complete AZFa and AZFb deletions. Conclusion: According to this study, the incidence of having either a cytogenetic abnormality or microdeletion in Y chromosome was 16.6%. High frequency of abnormality suggests the need for genetic screening and counselling. The results of karyotype and Y-microdeletion analysis should be in hand before initiation of assisted reproduction cycles to give patient proper treatment. Preimplantation genetic diagnosis (PGD) is an option for most of male infertility cases and should be offered with insistence to patients with structural rearrangements and numerical mosaicisms. Intracytoplasmic sperm injection together with testicular sperm aspiration, TESE, micro-TESE and PGD applications made and is continuing to make dreams come true for these particular patients. 4.003 The use of fastFISH for preimplantation genetic screening Al Farawati SF UCL, London, United Kingdom Introduction: Fluorescence in-situ hybridization (FISH) is used to detect numerical and structural chromosomal abnormalities and has been applied for the detection of chromosomes in embryos (preimplantation genetic diagnosis, PGD). PGD has been applied to couples carrying a chromosome abnormality, such as a Robertsonian or reciprocal translocation. FISH has also been used to screen for the presence of chromosomal aneuploidy in mothers of advanced maternal age, couples with recurrent miscarriages or repeated IVF failure (preimplantation genetic screening, PGS). PGS protocols only examine a limited number of chromosomes and the procedure takes 2 days to perform. FastFISH is a new rapid FISH technique that allows the whole procedure to be completed in less than 2 h from the time of sampling and the release of results on the same day.
PGD may also be recommended to transfer only embryos coming from euploid oocytes and free of the monogenic disease, in order to achieve a higher chance of successful implantation. We suggest that double factor PGD (DF-PGD) be used to perform both genetic and cytogenetic diagnoses. Von Hippel–Lindau syndrome (VHL) (OMIM# 193300) is a dominant, inherited family cancer syndrome that predisposes to a variety of malignant and benign neoplasms, most frequently retinal and cerebellar, but also spinal hemangioblastoma, renal cell carcinoma and pancreatic tumours. Several described mutations in the VHL gene (3p26–p27) are causative of this syndrome. A DF-PGD for a VHL-affected male carrier of the R161Q mutation in the VHL gene and a healthy 30-year-old female was performed. After ovarian stimulation, 12 mature oocytes were obtained. PGS: Comparative genomic hybridization (CGH), which allows for a cytogenetic analysis for all chromosomes, was applied to the ten first polar bodies (1PB) successfully biopsied immediately after fertilization by ICSI. After whole genome amplification, nine of the ten (90%) 1PB were CGH analysable using Metasystem software, on day +3. One out of the nine 1PB (11%) had aneuploid CGH profiles (1PB#1: 29XX,+2,+ 10,+12,+17,+19), while the rest (8/9; 89%) had euploid CGH profiles (1PBs #2, #3, #4, #5, #6, #7, #8 and #9). Mutation analysis: All 12 mature oocytes were fertilized and developed to 6–8 cell embryos on day +3. One single blastomere was biopsied from each one. Whole genome amplification with multiple displacement amplification was performed. A multiplex PCR containing primers for informative small tandem repeats (STR) close to the VHL gene (D3S1537 and D3S1675) and for a fragment containing the specific mutation was performed. Minisequencing was applied to detect the nucleotide change that produces the R161Q mutation using the following primer: 5'GACTAGGCTCCGGACAACCT3'. On day +4, genetic diagnosis was performed analysing both Minisequencing and STR results with an ABI Prism sequencer. Six out of the 12 (50%) embryos were affected by VHL, while the other six (50%) were unaffected (embryos #1, #2, #4, #5, #7 and #8). Five out of the six (83%) genetically healthy embryos came from oocytes considered euploid, thus they were transferable, while the other (17%) was aneuploid involving six chromosomes. Two of the embryos genetically and cytogenetically normal were transferred, achieving an ongoing twin pregnancy. The applied procedure (DF-PGD) can be a useful tool to increase the implantation rate of transferred embryos in PGD for carriers of monogenic diseases. FIS-ISCIII (PI 051395) funded this study. 4.002 Genetic aspects of male infertility in assisted reproduction Cinar C1, Beyazyurek C1, Ozgon G1, Ozkan S1, Ismailoglu B1, Oner O1, Fiorentino F2, Kahraman S1 1Istanbul Memorial Hospital, Istanbul, Turkey; 2Laboratorio Genoma, Italy Objective: Male infertility is present in up to half of infertile cases. This could be a result of genetic factors, such as numerical and structural chromosomal abnormalities and microdeletions of the Y chromosome. Cytogenetic and molecular screening analysis give valuable guidance in assisted reproduction treatments.
S-38 Reproductive BioMedicine Online, Vol. 16, Suppl. 3, April 2008
Materials/Methods: From March 2000 to September 2007, 1935 infertile men, 1214 with non-obstructive azoospermia (NOA) and 721 with oligoasthenoteratozoospermia (OAT), were referred to our ART and Reproductive Genetics Centre. World Health Organization 1999 criteria were taken into consideration for the evaluation of semen parameters and Kruger strict criteria was applied for the evaluation of sperm morphology. Karyotype analysis of 1935 cases was done using conventional cytogenetic techniques. For Y-deletion screening, genomic DNA was extracted from peripheral blood using a commercial kit. Twenty-five loci in the Yq region were amplified by multiplex polymerase chain reaction (PCR) with homemade primers. Results: The overall incidence of cytogenetic abnormalities was 12.45%. Klinefelter syndrome was the most frequent cytogenetic abnormality (10.95%) found in NOA group and both reciprocal and Robertsonian translocations (1.80% and 1.66%) are found to be the most frequent abnormalities in OAT group. The overall incidence of Y-chromosome microdeletion (n = 105) was 7.7%. The deletion rates were 1.85% and 9.5% for OAT and NOA groups, respectively. A total of 34 patients with microdeletions initiated treatment. Ejaculate sperm could be obtained from four patients with partial AZFc deletions. Micro-testicular sperm extraction (TESE) was applied to 30 patients with partial deletions of AZFa/b/c regions and spermatozoa were retrieved in 14 cases (46%). TESE was cancelled for 50 cases with complete AZFa and AZFb deletions. Conclusion: According to this study, the incidence of having either a cytogenetic abnormality or microdeletion in Y chromosome was 16.6%. High frequency of abnormality suggests the need for genetic screening and counselling. The results of karyotype and Y-microdeletion analysis should be in hand before initiation of assisted reproduction cycles to give patient proper treatment. Preimplantation genetic diagnosis (PGD) is an option for most of male infertility cases and should be offered with insistence to patients with structural rearrangements and numerical mosaicisms. Intracytoplasmic sperm injection together with testicular sperm aspiration, TESE, micro-TESE and PGD applications made and is continuing to make dreams come true for these particular patients. 4.003 The use of fastFISH for preimplantation genetic screening Al Farawati SF UCL, London, United Kingdom Introduction: Fluorescence in-situ hybridization (FISH) is used to detect numerical and structural chromosomal abnormalities and has been applied for the detection of chromosomes in embryos (preimplantation genetic diagnosis, PGD). PGD has been applied to couples carrying a chromosome abnormality, such as a Robertsonian or reciprocal translocation. FISH has also been used to screen for the presence of chromosomal aneuploidy in mothers of advanced maternal age, couples with recurrent miscarriages or repeated IVF failure (preimplantation genetic screening, PGS). PGS protocols only examine a limited number of chromosomes and the procedure takes 2 days to perform. FastFISH is a new rapid FISH technique that allows the whole procedure to be completed in less than 2 h from the time of sampling and the release of results on the same day.