[41] Transcriptional regulation of the cGMP phosphodiesterase, β-subunit gene

[4 II

TRANSCRIPTIONAL REGULATION

OF/3-PDE GENE

617

[41] T r a n s c r i p t i o n a l R e g u l a t i o n o f t h e c G M P Phosphodiesterase fl-Subunit Gene B y LEONID E . LERNER a n d D E B O R A B . FARBER

Introduction The /3 subunit of rod-specific cGMP phosphodiesterase (EC 3.1.4.17; /3-PDE) is an important component of the catalytic core of the enzyme. Mutations in the/3-PDE gene (PDE6B) have been associated with inherited retinal degenerations in a number of species and are the most common known cause of human autosomal recessive retinitis pigmentosa (ARRP). 1-8 However, PDE6B mutations are responsible for disease only in 5-6% of all studied cases of ARRP. Undoubtedly, appropriate levels of transcription of the/3-PDE gene are crucial for the integrity and function of the photoreceptors. Poor expression of the/3-PDE gene causes an abnormally low phosphodiesterase activity leading to high levels of cGMP and degeneration of rods. Eventually, the genes encoding proteins that play key roles in the regulation of the /3-PDE gene expression will become additional candidates for ARRP and other related diseases. As the field of transcriptional regulation of gene expression evolved, it became clear that genes are differentially expressed according to their interplay with particular sets of transcription factors. Therefore, cell-specific expression of a gene is likely to be regulated by a unique set of transcription factors specific for a particular cell type, rather than a single cell-specific transcription factor. These transcription factors bind avidly and selectively to short sequences of DNA (4-12 bp in length). If a gene contains a DNA C. Bowes, T. Li, M. Danciger, L. C. Baxter, M. L. Applebury, and D. B. Farber, Nature 347, 677 (1990). 2 S. J. Pittler and W. Baehr, Proc. Natl. Acad. Sci. U.S.A. 88, 8322 (1991). 3 D. B. Farber, J. S. Daneiger, and G. Aguirre, Neuron 9, 349 (1992). 4 M. L. Suber, S. J. Pittler, N. Qin, G. C. Wright, V. Holcombe, R. H. Lee, C. M. Craft, R. N. Lolley, W. Baehr, and R. L. Hurwitz, Proc. Natl. Acad. Sci. U.S.A. 90, 3968 (1993). 5 M. Danciger, J. Blaney, Y. Q. Gao, D. Y. Zhao, J. H. Heckenlively, S. G. Jacobson, and D. B. Farber, Genomics 30, 1 (1995). M. Danciger, V. Heilbron, Y. Q. Gao, D. Y. Zhao, S. G. Jacobsom and D. B. Farber, Mol. Vis. 2, http://www.emory.edu/molvis (1996). 7 M. E. McLaughlin, M. A. Sandberg, E. L. Berson, and T. P. Dryja, Nature Genet. 4,130 (1993). M. Bayes, M. Giordano, S. Balcells, D. Grinberg, L. Vilageliu, I. Mart/nez, C. Ayuso. J. Benltez, M. A. Ramos-Arroyo, P. Chivelet, T. Solans, D. Valverde, S. Amselem, M. Goossens, M. Biget, R. Gonz~ilez-Duarte, and C. Besmond, Hum. Mutant. 5, 228 (1995).

METHODS IN ENZYMOLOGY, VOL. 315

Copyright © 2000 by Academic Press All rights of reproduction in any form reserved. 0076-6879/00 $30.(X)

618

PHOTORECEPTOR PHOSPHODIESTERASE AND GUANYLYL CYCLASE

[41]

binding site for a particular factor, as long as the site is appropriately positioned relative to other regulatory components of the gene, it may be responsive to that factor in vivo. We have performed a scrupulous mutational analysis as well as studies of protein-DNA interactions on the 5'-flanking region of the human /3-PDE gene in order to localize and characterize its regulatory cis-acting elements and to demonstrate their interactions with nuclear trans-acting factors. This chapter focuses on specific techniques that have been employed to characterize the molecular mechanisms that control expression of the /3-PDE gene at the transcriptional level. We describe detailed protocols for the preparation of unidirectional nested deletion mutants, site-specific substitution mutagenesis, transient transfections in Y-79 or WERI-Rb-1 human retinoblastoma cell lines, cotransfections of a reporter construct carrying a fragment of the human/3-PDE gene 5'-flanking region and one or more expression construct(s) containing a cDNA for a transcription factor, the preparation of nuclear extracts from Y-79 or WERI-Rb-1 human retinoblastoma ceils, DNase I footprinting, and gel mobility shift assays. Methods for Functional Analysis of c/s-acting Elements in fl-PDE 5'-Flanking Region The potential for transcriptional activation of a regulatory sequence can be quantitatively assayed in vitro. This is achieved by transfecting an appropriate cell line maintained in culture with a construct containing a reporter gene driven by the regulatory sequence of interest and measuring the level of the reporter gene expression. A number of different reporter genes have been used in transient transfection assays. These include chloramphenicol acetyltransferase (CAT), 9 ~-galactosidase, I° luciferase, n and fl-globin. 12We have used the GeneLight reporter vectors pGL2-Basic and pGL2-Control (Promega Corp., Madison, WI), which contain the coding region of the firefly Photinus pyralis luciferase gene. Luciferase activity can be easily quantified using a rapid and sensitive assay that allows the analysis of a large number of samples. There is no endogenous luciferase activity in eukaryotic ceils. Therefore, the luciferase activity measured following transfection of an appropriate cell line with a pGL2-based construct reflects the level of expression of the luciferase reporter gene. A disadvantage of an assay that depends on the 9 C. M. Gorman, L. F. Moffat, and B. H. Howard, Mol. Cell. Biol. 2~ 1044 (1982). 10C. V. Hall, P. E. Jacob, G. M. Ringold, and F. Lee, I. Mol. Appl. Genet. 2, 101 (1983). 11j. R. de Wet, K. V. Wood, M. DeLuca, D. R. Helinski, and S. Subramani, Mol. Cell. Biol. 7, 725 (1987). lz B. J. Knoll, S. T. Zarucki, D. C. Dean, and B. W. O'Malley, Nucleic Acids Res. 11, 6733

(1983).

141]

TRANSCRIPTIONAL REGULATIONOF/~-PDE GENE

619

measurement of reporter enzyme activity is that it does not directly measure the transcriptional activation refected by the levels of mRNA. It has been accepted, however, that the level of |uciferase activity correlates well with the steady-state level of its mRNA. Direct analysis of mRNA levels may be performed by primer extension or RNase protection assays, which can also be used to confirm the correct initiation of transcription. However, this approach is less sensitive and substantially more time consuming. When a transient transfection assay using a pGL2-based construct is employed, the luciferase activity measured in cell lysates must be normalized for both transfection efficiency and general effects on transcription. This is achieved by introducing an internal control plasmid. A suitable control plasmid that we have used contains the bacterial l a c Z gene driven by the simian virus 40 (SV40) early promoter, the pSV-/3-galactosidase controlvector (Promega). Luciferase activity is determined by measuring the light generated by the luciferin substrate in the presence of adenosine triphosphate (ATP) and Mg 2+. The reaction is carried out in a luminometer cuvette and the peak light emission is recorded using a luminometer (e.g., Monolight 2010, Analytical Luminescence, Ann Arbor, MI). A simple protocol for the preparation of cell extracts suitable for luciferase analysis is described later. A number of different methods have been developed for the introduction of DNA into eukaryotic cells. The method chosen depends to a large extent on the particular cell line to be transfected. For Y-79 human retinoblastoma cells, we have successfully used the calcium phosphate-mediated transfection method, 13 which has the additional advantage of being relatively inexpensive compared to other approaches such as lipofection. Y-79 retinoblastoma cells have been shown to express both cone- and rod-specific genes including the/3-PDE gene. 14

Construction of Reporter Vectors Containing/3-PDE 5'-Flanking Sequences Unidirectional nested deletion constructs containing various lengths of the 5'-flanking region of the human/3-PDE gene are generated by polymerase chain reaction (PCR) using sequence-specific primers. 15 The 3' primer, complementary to the + 34 to + 53 bp sequence (relative to the transcription start site of the fl-PDE gene) adjacent to the translation initiation codon, is common to all of the constructs and contains a B g l I I linker. The 5' 13M. Wigler, S. Silverstein,L. S. Lee, A. Pellicer, Y. C. Cheng, and R. Axel, Cell 11, 223 (1977). J4A. Di Polo and D. B. Farber, Proc. Natl. Acad. Sci. U.S.A. 92, 4016 (1995). 15A. Di Polo, L. E. Lerner, and D. B. Farber, Nucleic Acids Res. 25, 3863 (1997).

620

PHOTORECEPTOR PHOSPHODIESTERASE AND GUANYLYL CYCLASE

[41]

primers vary in order to generate different length fragments, but each primer contains an NheI linker. PCR products are directionally subcloned into the pGL2-Basic vector. Inserts are fully sequenced in both directions to ensure 100% identity with the original template. Site-specific substitution constructs are produced by introducing A-C and G-T transversion mutations into specific sequences of the/3-PDE 5'flanking region. We have employed two alternative approaches in order to generate transversions: 1. PCR amplification of the/3-PDE 5'-flanking region using primers containing the desired mutation. The length of the primers varies depending on the position of the mutation(s). The 3' primer complementary to the fl-PDE 5'-flanking sequence extends upstream from the + 53 position (adjacent to the translation initiation codon) and contains a BgllI linker. The 5' primer extends downstream from the - 7 2 position, which may vary if different lengths of the ~-PDE 5'-flanking region are to be tested, and contains an NheI linker. Either the 3' or the 5' primer or both contain a desired mutation. For example, the 5' primer used to generate the - 6 9 / - 6 4 bp mutation in the context of the - 7 2 to +53 bp fragment of the human/3-PDE 5'-flanking region is as follows (the NheI linker is shown in lowercase and the mutated nucleotides are underlined): 5'-gggctagcGAGG__: TCTGAAGCTGACCC-3'. It is important to design the primer so that the mismatched nucleotides are located far enough from its 3' end to ensure adequate annealing between the template and the 3' end of the primer where extension occurs. The amplified sequence containing nucleotide substitutions is directionally subcloned into the pGL2-Basic vector and sequenced in both directions. 2. Recombinant PCR to introduce a mutation into a sequence located far from the nearest restriction site. 16 This approach is employed when the synthesis of a sufficiently long primer encompassing both the mutation and the restriction site is difficult. Briefly, two sets of primers are synthesized, One set of complementary primers contains the desired site-specific mutation based on the sequence of the/3-PDE 5'-flanking region. For example, in order to generate the - 7 / - 6 bp mutation in the context of the - 7 2 to +53 bp fragment we have used the following primers (the mutated nucleotides are underlined): 5'-GCTGATGACAGTI'YI'-FCCTGGGAGTCC-3' and 5 ' - G G A C T C C C A G G A A A A A C T G T C A T C A G C - 3 ' . The other pair of primers is designed so that one is a "sense" primer complementary to a sequence upstream from the planned mutation and the other is an 16 R. Higuchi, in "PCR Protocols: A Guide to Methods and Applications" (M. Innis, D. Gelfand, D. Sninsky and T. White, eds.), p. 177. Academic Press, San Diego, 1990.

[4 II

TRANSCRIPTIONAL REGULATIONOF/3-PDE GENE

621

"antisense" primer complementary to a sequence downstream from the mutation. We have used the GLprimerl and GLprimer2 (Promega) complementary to the pGL2 vector sequences flanking the inserted fragment. Two PCR reactions are set up, each using a mutated primer and one of the GLprimers, and the pGL2-Basic vector containing a fragment of the 13-PDE 5'-flanking region as template. The reactions yield two sequences that partially overlap creating a short double-stranded region containing the mutation and a long protruding end on each side. The protruding ends are complementary to the flanking sequences of the pGL2 vector containing unique restriction sites (NheI upstream and BgllI downstream, respectively). The two PCR products are purified using agarose gel electrophoresis and annealed. Using cloned Pfu D N A polymerase (Stratagene), each of the two sequences is extended utilizing the protruding end of the opposite sequence as template. The double-stranded product containing the desired mutation is then digested with NheI and BgllI restriction endonucleases, purified and directionally subcloned into the pGL2-Basic vector as described earlier. Inserts are sequenced in both directions to ensure 100% identity with the original template. In our hands, the efficiency of the recombinant PCR is very high (>85%). A detailed protocol for the secondary extension reaction is as follows: 1. In a 0.5-ml microfuge tube, mix 50 ng of each of the purified products of the primary PCR with 10 txl of 10× Pfu reaction buffer, 1 /xl of 20 mM dNTP mix, 2.5 U of Pfu D N A polymerase, and doubly distilled H20 to 50 /xl total volume. Add three drops of mineral oil to avoid evaporation. 2. Denature for 4 rain at 94°. 3. Perform 30 cycles of denaturation at 94° for 1 min, annealing at 48 ° for 1.5 rain, and extension at 72° for 1.5 min in a thermal cycler. It is important to adjust the extension time according to the length of the fragment to be amplified. 4. Incubate for additional 10 min at 72 ° (1 cycle) to allow extension to go to completion. For efficient and consistent transfection results in Y-79 retinoblastoma cells, it is very important to prepare highly purified plasmid DNA. We obtain best results with the Endofree Maxi kit (Qiagen, Valencia, CA) designed to remove bacterial endotoxin. Transient Transfections of Y-79 or WERI-Rb- 1 H u m a n Retinoblastoma Cells Using Calcium Phosphate Precipitation 1. Prepare the following solutions: • 2 × HEPES-buffered saline/Na2HPO4, pH 7.0 (HBS/P): 45 mM

622

2.

3.

4.

5.

PHOTORECEPTOR PHOSPHODIESTERASE AND GUANYLYL CYCLASE

[41]

HEPES (tissue culture grade), 280 mM NaC1, and 2.8 mM Na2HPO4. Adjust pH accurately to 7.0 with NaOH, filter sterilize. This buffer may be stored at 4 ° for several months; recheck pH after prolonged storage. • Phosphate-buffered saline (PBS), pH 7.4:140 mM NaCI, 2.7 mM KCI, 4.5 mM Na2HPO4, and 1.5 mM KH2PO40 Adjust pH to 7.4 with HCI, filter sterilize. • 2.5 M CaC12 (tissue culture grade), filter sterilize. • 10× TE buffer, pH 7.0:10 mM Tris-HCl and 1 mM EDTA, filter sterilize. This buffer may be stored at 4° for several months. • 0.2 mg/ml Poly(D-lysine) in PBS, filter sterilize, store at 4 °. • 5/zg/ml Fibronectin (Sigma, St. Louis, MO) in PBS, filter sterilize, store at 4°. Initiate Y-79 retinoblastoma cell cultures (ATCC, Rockville, MD, HTB 18) at least 2 weeks before transfection. Cells maintained in culture for a long period of time may not produce optimal results, therefore we prefer to use cell cultures less than 1.5 months old. Propagate the cells in suspension in RPMI 1640 (Gibco-BRL, Gaithersburg, MD) supplemented with 15% fetal bovine serum (FBS). Feed the cells the day before plating for transfection. Plate cells 24 hr before transfection. Under sterile conditions, coat 60-mm-diameter tissue culture plates with 0.4 ml of poly(D-lysine) (spread over the surface with brisk rotational movements). Replace the lid and wait for 10 min. Add 0.2 ml of fibronectin solution and spread over the surface. Replace the lid and wait for 30-60 min. Meanwhile, count the cells and dilute them with RPMI 1640 supplemented with 15% FBS to 1.5 × 10 6 cells/ml. Aspirate fibronectin/ poly(D-lysine) and wash the dishes briefly with 3 ml of serum-free RPMI 1640 followed by aspiration. Plate 3 ml of cell suspension per plate (approximately 4.5 × 10 6 cells/plate). If larger dishes are used, the number of cells plated and the volumes given should be adjusted accordingly. The following day, gently aspirate the medium (including any dead cells) without drying the cells, and replace with 4 ml of Dulbecco's modified Eagle's medium (DMEM)/F12 medium (50/50 mix, Cellgro, Mediatech Inc., Herndon, VA) supplemented with 15% FBS (RPMI 1640 has a high Ca 2÷ content, which may interfere with calcium phosphate-mediated transfection). Place the cells back into the humidified incubator for 3 hr. Prepare the following mixture in a 14-ml Falcon tube: 1.35 ml of 10× TE buffer, pH 7.0; 15/zg of pSV-/3-galactosidase vector (5/~g

[411

6.

7.

8.

9.

TRANSCRIPTIONAL REGULATION OF/3-PDE GENE

623

per plate) and 30 tzg of the appropriate pGL2 construct (10/zg per plate) in a total volume of 45 ~1 of TE buffer; 0.15 ml of 2.5 M CaCI2. Add 1.5 ml of 2 x HBS/P, pH 7.0, and mix thoroughly by pipetting up and down. Do not vortex. This transfection mixture (3 ml) is used for three plates (transfection of each construct is carried out in triplicate). Remove the plates from the incubator. Add 1.0 ml of transfection mixture to each plate and spread over the cells by grid movements (forward-backward and left-right). Do not use rotational movements because the precipitate tends to spread around the periphery of the plate. Place the plates into the humidified incubator overnight. The following morning, a fine-grained precipitate will have formed. It is readily visualized under the microscope around the cells and attached to the surface of the cells. It is important to examine all the plates for the amount of precipitate formed, which should be comparable, as well as to make sure that the cells remain attached to the plate. If there are plates with significantly less precipitate or with many cells detached, those plates should be disregarded. Gently aspirate the medium from the plates to avoid cell detachment and damage. Cells may be carefully washed with 5 ml of serum-free medium for up to three times but this may increase the cell loss from the plate. Feed the cells with 5 ml RPMI 1640 supplemented with 15% FBS, incubate for 24 hr and harvest.

Essentially the same protocol can be used for transient transfection of WERI-Rb-1 human retinoblastoma cells.

Preparation of Cell Lysate and Measurement of Luciferase Activity 1. Luciferase assay mixture (LAM): 20 mM Tricine, 1 mM MgCO3, 2.7 mM MgSO4, 0.1 mM EDTA, 30 mM dithiothreitol (DTT), 0.3 mM coenzyme A, 0.5 mM luciferin and 0.5 mM ATP; adjust pH to 7.8 with 1 M HC1. Store 1-ml aliquots at - 2 0 ° in complete darkness (may be wrapped in aluminum foil). 2. Prepare the cell lysis buffer by adding 1 volume of 5× Reporter Lysis Buffer (Promega) to 4 volumes of doubly distilled H20. Vortex. 3. Aspirate the medium from the plates and wash the cells twice with 4 ml of PBS at room temperature. Thoroughly remove all PBS after the final wash by tilting the plate (residual PBS may interfere with the cell lysis buffer and prevent complete cell lysis).

624

PHOTORECEPTORPHOSPHODIESTERASEAND GUANYLYLCYCLASE

[41]

4. Pipette 0.1 ml of cell lysis buffer onto the cell monolayer and spread it over the surface by tilting the plate. Leave the plate horizontal for 15 rain at room temperature. The cells will be lysed (if viewed under the microscope, only intact nuclei are visible). 5. Scrape the plate thoroughly with a cell scraper and transfer the cell lysate into a precooled microfuge tube. Keep on ice. Centrifuge for 2 min at 4 ° at 16,000g to pellet the cell debris, and transfer the supernatant into a clean 1.5-ml tube. Store on ice. 6. Pipette 20/xl of the extract obtained from different plates into appropriately labeled polystyrene luminometer cuvettes. Bring the cuvettes and LAM alongside the luminometer and turn it on. 7. Add 0.1 ml of LAM (thawed at room temperature in the dark, e.g., in a drawer) to one cuvette at a time, briefly hand-vortex by finger tapping once on the lower portion of the cuvette, insert the cuvette into the luminometer, and measure the luciferase activity. It is important to perform this step in a timely fashion consistent for all the cuvettes because once LAM is added to the extract, the light-emitting reaction begins. One can perform this sequence to a count of one to four. Alternatively, if the luminometer is equipped with a dispenser, LAM can be injected automatically. LAM alone and extracts from mock-transfected cells provide negative controls (between 90 and 150 light units). Luciferase activity produced by transfection of Y-79 cells with the pGL2-Control vector can be used as a positive control and the values obtained usually range between 80,000 and 110,000 light units.

Determination of Galactosidase Activity and Quantification of Transcription Levels 1. Prepare the following solutions: fl-Galactosidase assay buffer, pH 7.0 (buffer Z): 60 mM Na2HPO4" 7 H z O , 40 mM N a H 2 P O 4 " H20, 10 mM KC1, 1 mM M g S O 4 " 7HzO, and 50 mM 2-mercaptoethanol. a7 Do not autoclave. This buffer is stable at 4°. 4 mg/ml o-Nitrophenyl-fl-D-galactopyranoside (ONPG) in buffer Z, store in 1 ml aliquots at - 2 0 °. 1 M Na2CO3 in doubly distilled H 2 0 . 2. Pipette 40/xl of 4 mg/ml ONPG stock solution into appropriately labeled glass tubes. 17j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," Vol. 3, p. 16.66. Cold Spring Harbor Laboratory Press, New York, 1989.

[4 I I

TRANSCRIPTIONAL REGULATIONOF/3-PDE GENE

625

3. Add 40/xl of cell extract followed by 120/zl of buffer Z. Mix. 4. Incubate at 37 ° until yellow color develops (approximately 1.5-3 hr). 5. Add 100 tzl of 1 M Na2CO3 to each tube and determine the OD at 420 nm. Relative luciferase activity (RLA) is calculated as follows:

RLA = Luciferase activity (light units)//3-galactosidase activity (OD420

units) × 1000

A typical example of relative luciferase activity calculated following transient transfections of Y-79 retinoblastoma cells is shown in Fig. 1. Constructs containing different lengths of the 5'-flanking region of the human/3-PDE gene were subcloned into the pGL2-Basic vector and tested in transient transfections (Figs. 1A and 1B). In addition, the results of transfections using site-specific nucleotide substitution mutants of the 5'flanking region of the/3-PDE gene are illustrated in Fig. lB. For cotransfection experiments, when two or more different DNA constructs are transfected simultaneously (e.g., a reporter construct and an expression construct), the protocol is essentially the same as above except that an equal amount of plasmid used as vector for the expression construct(s) is added to the control transfection mixture. For example, when cotransfecting 10/.~g of a construct containing a fragment of the 5'-flanking region of the /~-PDE gene (a reporter construct) and 1 /.~g of plasmid containing the cDNA for the CRX transcription factor (an expression construct)] &~9 the control transfection contains 10 txg of the/3-PDE construct and 1 ~g of the empty plasmid used as vector for the CRX cDNA.

Methods for Assaying Protein-DNA Interactions at fl-PDE 5'-Flanking Region Gel Mobility Shift Assay Gel mobility shift assay (GMSA) is a sensitive and convenient technique for the detection of sequence-specific protein-DNA interactions. It is particularly useful for the analysis of low abundance transcription factor-DNA complexes formed in the context of the/3-PDE 5'-flanking region. ~8S. Chen, Q. L. Wang, Z. Nie, H. Sun, G. Lennon, N. G, Copeland, D. J. Gilbert, N. A. Jenkins, and D. J. Zack, Neuron 19, 1017 (1997). 19T. Furukawa, E. M. Morrow, and C. L. Cepko, Cell 91, 531 (1997).

A

HumanI3-PDE5'-FlankingRegion

Relative LuciferaseActivity (%)

I'

25

50

75

, , , I , , , I , , ,

+1

i00

I ,,

I

p-1356 p-ll17

I

p-807 .......

I

p-566

I

p-377

I

p-297

I

p-197 p-167 p-34 [ - ~

p+4[ - ~

D IH

VectorAlone SV40 [3

Human

13-PDE

5'-Flanking Region

Relative LuciferaseActivity (%)

I'

25

50

75

, , , I , , , I , ,

+1

100

,I,,

p-167

I I

p-93 p-93M I p-83

[-~

II

p-77

i

I

p-72

I

p-72M lli p-61

[-~ .

p-50 VectorAlone SV40

[-~

B

I

[411

TRANSCRIPTIONAL REGULATIONOF/3-PDE GENE

627

Preparation o f N u c l e a r Protein Extracts f r o m Y-79 or W E R I - R b - 1 H u m a n R e t i n o b l a s t o m a Cells

We use a modification of the m e t h o d previously described by N a e v e et al. 2° The advantage of this m e t h o d over that reported by Dignam et al. 2~ is that the present procedure can be accomplished in 1-1.5 hr thus minimizing the potential nuclear protein loss. Essentially the same protocol is used for the nuclear extract preparation f r o m Y-79 or W E R I - R b - 1 retinoblast o m a cells. 1. Prepare the following solutions: Buffer A: 10 m M H E P E S , p H 7.9, 10 m M KC1, 0.1 m M E D T A , 0.1 m M E G T A , 1 m M D T I ' , 0.75 m M spermidine, 0.15 m M spermine, 100/zM phenylmethylsulfonyl fluoride (PMSF), 1/zg/ml aprotenin, 1 tzg/ml leupeptin, and 1 ~ g / m l pepstatin. Buffer B: 50 m M H E P E S , p H 7.9, 10 m M KC1, 0.2 m M E D T A , 0.2 m M E G T A , 1 m M D T T , 0.75 m M spermidine, 0.15 m M spermine. 100/xM PMSF, 1/xg/ml aprotenin, 1/xg/ml leupeptin, 1/xg/ml pepstatin, and 67% (w/v) sucrose. Buffer C: 20 m M H E P E S , p H 7.9, 100 m M KC1, 0.2 m M E D T A , 0.2 m M E G T A , 2 m M D T ] ' , 100 ~ M PMSF, 1/xg/ml aprotenin, 1/zg/ ml leupeptin, 1 / z g / m l pepstatin, and 20% (v/v) glycerol. Buffers are stored at - 2 0 ° without PMSF, D T T , and sucrose, which are added immediately before use. 2. Retinoblastoma cells grown in suspension for less than 1.5 months are transferred to a 15-ml conical tube and the packed cell volume (PCV) determined after the cells have been pelleted by centrifugation at 1,000g for 5 min at 4 °. Cells are resuspended in a small volume 2oG. S. Naeve, Y. Zhou, and A. S. Lee, Nucleic Acids Res. 23, 475 (1995). 21j. D. Dignam, R. M. Lebovitz, and R. G. Roeder, Nucleic Acids Res. 11, 1475 (1983).

Flt~, 1. (A) Relative luciferase activity of constructs containing different lengths of the human/3-PDE 5'-flanking region from -1356 to +4 bp on transient transfection into Y-79 human retinoblastoma cells. Plasmids (15/~g) were cotransfected with the control lacZ gene driven by the SV40 promoter (5/zg). Luciferase activity was normalized to the corresponding /3-galactosidase activity for each sample and expressed as percent activity of the construct p-197. Values represent the average of at least three transfections and standard deviation bars are shown. (B) Relative luciferase activity produced by constructs containing unidirectional nested deletions of the upstream end of the human/3-PDE Y-flanking region (from -167 to -50) on transient transfection into Y-79 human retinoblastoma cells. Plasmids p-93M and p-72M contain point mutations in the E box and the AP-1 consensus sequences. respectively. Luciferase activity was normalized to the corresponding/3-galactosidase activity for each sample and expressed as percent activity of the construct p-197. Values represent the average of at least three transfections and standard deviation bars are shown.

628

3.

4.

5.

6.

7.

PHOTORECEPTOR PHOSPHODIESTERASE AND GUANYLYL CYCLASE

[41]

of cold PBS and transferred to a 50-ml conical tube (it may be more convenient to split the cells into two tubes if PCV is greater than 0.5 ml). The cells are gently washed with 30x PCV of cold PBS, resuspended in 5x PCV of cold buffer A (hypotonic) and allowed to swell on ice for 10 min. Cells are centrifuged at 1000g for 3 min at 4°. The pellet is carefully resuspended in 2x the original PCV of cold buffer A and transferred into a Dounce homogenizer. Cells are broken with 5 strokes of a tight pestle. Immediately, 0.3 x PCV of cold buffer B is added and mixed with 5 strokes of a loose pestle, and the mixture is transferred to a 1.5-ml microfuge tube. Nuclei are separated from lysed cells by centrifuging at 16,000g for 30 sec at 4°. The supernatant is carefully removed. The viscous nuclear pellet is resuspended in 0.66x PCV of buffer C and subjected to three cycles of rapid freeze-thawing (60 sec in dry ice/acetone and 90 sec in a water bath preheated to 37 °) in order to lyse the nuclei. Lysed nuclei are centrifuged at 16,000g for 10 min at 4 °. The supernatant is collected, aliquotted, and quick-frozen. Nuclear extract may be stored at - 8 0 ° for several months (avoid temperature fluctuations). Protein concentration is determined using the Bradford assay. 22

Synthesis and Purification of DNA Probe We generally use synthetic oligonucleotides for making the probe for GMSA, although restriction fragments from a recombinant plasmid containing the sequence of interest may be used as well, particularly when a longer probe (e.g., 50-250 bp) is desired. 1. Two complementary oligonucleotides identical to a short sequence in the human/~-PDE 5'-flanking region are synthesized. For example, we have used oligonucleotides identical to the region from - 7 2 to - 5 8 bp, which contains the consensus sequence for the AP-1 response element, TGAGTCA: 5'-GAGTGAGTCAGCTGA-3'. 2. For optimal results, purify the oligonucleotides using a 12-15% polyacrylamide gel containing 6 M urea. (We run one oligonucleotide per gel to avoid cross-contamination.) Briefly, the bands are sliced out and minced with a razor blade (use a new blade for each oligonucleotide) and crushed with a pipette tip in a microfuge tube. D N A is eluted overnight in i ml of a solution containing 0.1% (w/v) sodium dodecyl sulfate (SDS), 0.5 M ammonium acetate, and 10 mM magne22 M. M. Bradford, Anal. Biochem. 72, 248 (1976).

[41]

TRANSCRIPTIONAL REGULATIONOF/3-PDE GENE

629

sium acetate at 37 ° in a shaker incubator. Polyacrylamide gel pieces are pelleted by centrifugation for 2 min at 12,000g at 4° and the supernatant is collected followed by ethanol/sodium acetate precipitation.

Labeling of DNA Probe 1. Unlike restriction fragments, synthetic oligonucleotides do not have a 5'-phosphate and therefore can be directly labeled using T4 polynucleotide kinase and [y-32p]ATP. We prefer to label single-stranded oligonucleotides which are subsequently annealed. Prepare reaction mixture: Oligonucleotide (10 pmol//zl) 1.0/xl 10× T4 polynucleotide kinase buffer 2.0/zl [y-32p]ATP, 6000 Ci/mmol (10 pmol) 5.0/xl Doubly distilled H20 11.4/zl In general, ng of oligonucleotide = pmol of oligonucleotide × 0.33 x N (number of bases in the oligonucleotide) Add T4 polynucleotide kinase (10 units), mix well, and incubate for 45 rain at 37°. Stop the reaction by heating to 68° for 10 min. 2. We always use [y-3Zp]ATP received on the day when the labeling reaction is performed. The higher the specific activity, the less the amount of the probe needed for the detection of the DNA-binding protein of interest. If the specific activity of the probe is low and many oligonucleotide molecules remain unlabeled, more probe should be used per reaction. However, this increases the competitive binding of the protein to unlabeled molecules therefore decreasing its detectability in GMSA. For example, if the protein of interest is present in the nuclear extract in scarce amounts (e.g., a rare transcription factor) it will preferentially interact with the excess of unlabeled oligonucleotides therefore getting sequestered. This will prevent the formation of a retarded band in GMSA. To achieve the highest specific activity of the probe, the concentration of the oligonucleotide in the labeling reaction should be decreased threefold to 3 pmol, the amount of [y-32p]ATP should be increased threefold to 15/xl, and the volume of H20 decreased to 1.4 /zl (compare to the standard reaction described earlier). In this way up to 90% of oligonucleotide molecules will be labeled compared to only 50% labeled when the standard reaction is performed using equimolar concentrations of the oligonucleotide and ['y-32p]ATP. However, about 90% of [T-32p]ATP molecules will be wasted. 23 23j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A LaboratoryManual," Vol. 2, p. 11.31. Cold Spring Harbor LaboratoryPress, New York, 1989.

630

P H O T O R E C E P T O R P H O S P H O D I E S T E R A S E A N D G U A N Y L Y L CYCLASE

[41]

. After radiolabeling is complete, annealing of the complementary oligonucleotides is achieved by mixing them in equimolar amounts, heating to 75 ° for 5 min in a large water bath, and allowing to cool slowly to room temperature. The probe is purified by centrifugation through a 50-tzl Sephadex G-25 microcentrifuge spin column. The efficiency of [y-32p]ATP transfer can be calculated by scintillation counting 1/zl of the probe on a piece of filter paper before and after the removal of unincorporated radiolabel by the spin column. To evaluate the quality of the radiolabeled probe, it is electrophoresed on a native 12-15% polyacrylamide gel followed by autoradiography. The labeled DNA probe is stored at - 2 0 ° for no more than 5 days to avoid radiolysis.

Protein-DNA Binding Reaction and Gel Electrophoresis of Formed Complexes In general, the strength of protein-DNA interactions in vitro can be influenced by a number of parameters including monovalent (Na + and K +) and divalent (Mg2+) cations, pH, nonionic detergents, protein concentration, the type and concentration of the competitor DNA, and the temperature of the binding reaction. For example, low salt (<150 mM KC1) tends to favor protein-DNA interactions. Low amounts of nonionic detergent (0.5-0.05% Nonidet P-40), a carrier protein (e.g., 50 ng//.d bovine serum albumin) and a polyamine such as spermidine (2 mM) can stabilize certain protein-DNA complexes. Thus, systematic alteration of the binding reaction composition and binding conditions ensures optimal detection of protein-DNA complexes. In addition, different parameters of gel electrophoresis can alter the dissociation rate and the electrophoretic mobility of protein-DNA complexes. In general, low percentage and cross-linking of the polyacrylamide gel and low ionic strength of the electrophoresis buffer enhance the detection of the complexes in GMSA. 1. Prepare 5x GMSA buffer (10 mM Tris-HC1, pH 7.5, 50 mM KC1, 0.2 mM EDTA, 1 mM MgClz, 4% (v/v) glycerol, 1 mM DTT, 0.05% (v/v) Nonidet P-40, and 1 mM PMSF) from stock solutions: 1 M Tris-HC1, pH 7.5 10 xl 50 xl 1 M KCI 2 :d 100 mM EDTA 2 ,~1 500 mM MgC12 10 :d 5% Nonidet P-40 40 gl Glycerol 1 MDTT 1 gl 10 :d 100 mM PMSF

[411

TRANSCRIPTIONAL REGULATIONOF/3-PDE 6ENE

A

Nuclear Extract

Y-79

631

WERI-Rb-1

32P-probe 1

2

3

i~i¸i¸

4

i

II---~

B

32p-probe

[~AP-1

Competitor

[3AP-1

~AP-1M

-

10x

100x

1

2

3

-

10x 4

5

100x 6

II-+

FIG. 2. (A) Two shifted bands (I and II) are detected when the labeled/3AP-1 probe is incubated with either Y-79 or WERI-Rb-1 cell nuclear extract. No shifted bands are visualized when the labeled/3AP-1M is used as a probe. (B) Competition gel shift experiments using the labeled/3AP-1 probe and Y-79 retinoblastoma nuclear extract. The intensity of both shifted bands I and II decreases progressively on addition of increasing amounts of unlabeled /3AP-1 competitor (lanes 1-3), but shows no inhibition of complex formation with excess unlabeled/3AP-1M (lanes 4-6).

632

PHOTORECEPTOR PHOSPHODIESTERASE AND GUANYLYL CYCLASE A

Primer S

[411

Y-79

A C G T

--

25 50 25 50

--

Nuclear Extract (lag)

IV llI II

B

primer S -167

AGTTACTCCCAGCCTTCATTCCACAGGGTCTGGTTTTCCT

-127

GGAAGGTGGGAAGTCCCAGGGTCTGAGGAGAGGGAGC

- 90

E box ~ ~ ~ AP-I GC box GCAGGCCCCCATTTGTAGGAGTGAGTCAGCTGACCCGC ! n &

CRX

TATa-like ~

- 52

CCCCGGGGTTCCTAATCTCACTAAGAAAGACTTTGCTGA HI IV

- 13

TGACAGGGTTTCCTGGGAGTCCATGCGTGCCTGGAGCAG

+ 27

CAGCGTCTCCAGGGACAGGCAGCCACC~TGI

&

+32

+i

primer A

FIG. 3. (A) DNase I footprinting analysis performed with the human/3-PDE proximal 5'flanking region. The sense probe spanning nucleotides -167 to +53 was generated by PCR using primers S and A [shown in (B)]. Binding reactions contained 25 or 50/zg of either Y-79 retinoblastoma or pig retina crude nuclear extracts. A 1 : 50 and 1 : 10 dilution of DNase I was used, respectively, for digestion of nonprotein control and protein-bound probe. Protection areas are designated by vertical lines and numbered consecutively [compare to (B)]; hypersensitivity bands are indicated by arrows. A dideoxynucleotide chain termination sequencing

[411

TRANSCRIPTIONAL REGULATIONOF fl-PDE ~ENE

633

Add doubly distilled H 2 0 to a total volume of 200/xl. Use 4/.tl of 5× GMSA buffer per 20 ~1 binding reaction (see below). . The D N A probe (1-5 × 105 cpm) identical to the sequence of the human fl-PDE promoter containing the consensus AP-1 response element (/3AP-1, 5 ' - G A G T G A G T C A G C T G A - Y ) and the probe containing transversions in the AP-1 consensus sequence (flAP-1M, 5'-GAGGTCTTCAGCTGA-3') are incubated with 5-20/~g of either Y-79 or WERI-Rb-1 retinoblastoma nuclear extract in the presence of 2 tzg of poly(dI-dC) (Pharmacia) as nonspecific D N A competitor in GMSA buffer. The binding reaction is performed at room temperature for 20 min in a total volume of 20 txl. Meanwhile, a native polyacrylamide gel (39 : 1 acrylamide : bisacrylamide, w/w) containing 0.25× TBE buffer (22.5 mM Tris-borate and 0.5 mM EDTA, pH 8.0) is preelectrophoresed for 60-90 min at 150-200 V (the current should drop from 20-25 mA to less than 10 mA). Protein-DNA complexes are resolved at room temperature on a 5-8% (w/v) polyacrylamide gel, depending on the size of the proteinD N A complexes, at 8-80 V. hr. In our experience, the complexes appear to be stable when electrophoresed for the appropriate time at 45-200 V. Following electrophoresis, the gel is dried and autoradiographed (Fig. 2). DNase I Footprinting Assay This t e c h n i q u e allows the analysis of s i m u l t a n e o u s i n t e r a c t i o n s b e t w e e n different t r a n s c r i p t i o n factors a n d several b i n d i n g sites o n the s a m e D N A molecule. A n o t h e r a d v a n t a g e of this t e c h n i q u e is that the sites of p r o t e i n D N A i n t e r a c t i o n s can b e a c c u r a t e l y localized.

Preparation of DNA Probe The quality of the D N A probe is fundamental for the success of this type of experiment. The specific activity of the probe must be high

reaction using primer S was run in parallel with the footprinting reactions as a marker. (B) Sequence of the proximal 5'-flanking region of the human fl-PDE gene (from -167 to +53 bp) showing the sites of protein-DNA interactions identified by DNase I footprinting. Protected areas are underlined and consecutively numbered; hypersensitivity bands are shown as arrows. Sequences homologous to previously described regulatory elements, E box, AP1 element, GC box, CRX element, and TATA-Iike element are labeled. Sense and antisense primers (S and A, respectively) used to generate the DNA probe are overlined. The two transcription start sites of this gene are shown as +1 and +32 and the translation initiation codon is boxed.

634

PHOTORECEPTOR PHOSPHODIESTERASE AND GUANYLYL CYCLASE

[41]

and the probe must not be older than 4-5 days to avoid radiolysis. For the/3-PDE promoter footprinting assay, a DNA probe comprising the sequence from -167 to +53 bp of the human/3-PDE promoter is generated by PCR. The 5' primer, complementary to positions -167 to -153 (5'AGTTACTCCCAGCCT-3'), is labeled with T4 polynucleotide kinase (Pharmacia) and [7-32p]ATP (6000 Ci/mmol, New England Nuclear, Boston, MA). The 3' primer, complementary to +34 to +53 bp (5'GGTGGCTGCCTGTCCCTGGA-3'), is not labeled. Both the 5' and 3' primers (10 pmol of each) are used to amplify pBamHI (100 ng), which contains 4.8 kb of the human/3-PDE Y-flanking region. 24 The amplified fragment is purified by electrophoresis on a denaturing 7% polyacrylamide gel and used for DNase I footprinting. The labeled DNA probe is stored at - 2 0 °.

DNase I Footprinting The footprinting reaction is performed in three steps: proteins are allowed to bind to the DNA probe, the protein-DNA complexes are partially digested with DNase I, and the products of digestion are analyzed by gel electrophoresis. Incidentally, DNase I cleavage is not completely random. Therefore, free DNA probe is digested and resolved alongside the proteinbound probe on a polyacrylamide gel to control for sequence-specific cleavage. 1. Prepare the following solutions: 10× Footprinting buffer: 100 mM HEPES, pH 7.9, 1 mM EDTA, glycerol, 20% polyvinyl alcohol, 500 mM KCI. Stop buffer: 20 mM EDTA, 1% SDS, 0.2 M NaC1, and 250/zg/ml yeast tRNA. 2. The binding reaction is performed in a total volume of 50/zl containing 5/zl of 10× footprinting buffer, 0.5 mM DTT, 1/zg poly(dI-dC), labeled DNA probe (approximately 5 × 104 c p m ) , and 25-50/zg of Y-79 retinoblastoma or pig retina crude nuclear extract as described elsewhere,z4 For consistent results, a master mix containing all of the components except nuclear extract is aliquotted into microfuge tubes. Add nuclear extract to each tube and incubate on ice for 30 min. Meanwhile, dilute the DNase I stock (1 mg/ml, Worthington Biochemical, Lakewood, N J). We have used a 1 : 5 or 1 : 10 dilution of DNase I for the protein-bound probe and a 1 : 50 or 1 : 100 dilution for the control probe alone (dilutions are determined empirically). After the incubation period, 50/zl of a 10 mM MgCI2/5 mM CaCI2 24 A. Di Polo, C. B. Rickman, and D. B. Farber, Invest. Ophthalmol. Vis. Sci. 37, 551 (1996).

[42]

INHIBITIONOF PHOTORECEPTOR cGMP PDE

635

mixture is added, followed immediately by digestion with DNase I (mix gently with the pipette tip) for exactly 1 min. . Promptly terminate the reaction by the addition of 90 /xl of stop buffer. 4. Nucleic acids are recovered by phenol-chloroform (1 : 1) extraction followed by ethanol precipitation. Pellets are dissolved in 99% formamide with tracking dyes, and DNA is resolved on a 7% (w/v) sequencing gel. The gel is dried and autoradiographed. A typical example of a DNase I footprinting gel is shown in Fig. 3. Protein-DNA interactions are evidenced as areas protected from DNase I digestion or as intense hypersensitivity bands. The latter may result from changes in DNA conformation caused by the binding of a nuclear protein, which makes this particular site more susceptible to DNase I digestion. Acknowledgments T h e development of the protocols described in this chapter was supported by N I H grants EY02651 (D.B.F.) and EY00367 (L.E.L.). D.B.F. is the recipient of a Senior Scientific Investigators A w a r d from Research to Prevent Blindness.

[42] I n h i b i t i o n o f P h o t o r e c e p t o r c G M P P h o s p h o d i e s t e r a s e by Its y Subunit

By A L E X E Y E.

GRANOVSKY, KHAKIM G. MURADOV,

and

NIKOLAI O. ARTEMYEV

Introduction Rod cGMP phosphodiesterase (PDE) is the effector enzyme in the visual transduction cascade. In dark-adapted rod photoreceptors, the activity of PDE catalytic a and/3 subunits (Pa/3) is blocked by two identical inhibitory y subunits (P~/). Light stimulation of photoreceptors leads to enzyme activation by the GTP-bound transducin-o~ molecules (GtaGTP), which bind to P~/subunits and displace them from the catalytic coreJ -3 Identification of the sites involved in the P~//Pa/3 interface and insights into mechanisms of the PDE activity inhibition are essential for understanding I M. Chabre and P. Deterre, Eur. J. Biochem. 179, 255 (1989). 2 S. Yarfitz and J. B. Hurley, J. Biol. Chem. 269, 14329 (1994). 3 L. Stryer, Proc. Natl. Acad. Sci. U.S.A. 93, 557 (1996).

METHODS IN ENZYMOLOGY,VOL. 315

Copyright © 2000by AcademicPress All rights of reproduction in any form reserved. 0076-6879/00$30.00