5G polymorphism of the plasminogen activator inhibitor-1 gene and risk of restenosis after coronary artery stenting

Genetics

4G/5G Polymorphism of the plasminogen activator inhibitor-1 gene and risk of restenosis after coronary artery stenting Corinna Bo ¨ ttiger, MD, Werner Koch, PhD, Christina Lahn, Julinda Mehilli, MD, Nicolas von Beckerath, MD, Albert Scho ¨ mig, MD, and Adnan Kastrati, MD Mu ¨ nchen, Germany

Background

Plasminogen activator inhibitor-1 (PAI-1) has been proposed as a candidate risk factor for restenosis after coronary artery stenting. Transcription, level, and activity of PAI-1 are influenced by the 4G/5G polymorphism in the promoter region of PAI-1 gene. The polymorphism may therefore affect wound-healing processes in injured blood vessels and influence restenosis.

Methods

In 1850 consecutive patients, angiographic measures of restenosis and the clinical outcome at 30 days and 1 year after stent implantation were evaluated. Angiographic restenosis was defined as ⱖ50% diameter stenosis determined at follow-up angiography, performed 6 months after stenting. The 4G/5G genotypes were determined with TaqMan technique.

Results

Among the patients, the frequency of the 4G allele was 0.55. Follow-up angiography was done in 84% of the patients. We observed restenosis in 32.5% of 4G/4G carriers, 32.2% of 4G/5G carriers, and 35.7% of 5G/5G carriers (P ⫽ .52). The occurrence of a major adverse event (death, myocardial infarction, or target vessel revascularization due to restenosis-induced ischemia) was 5.6% in 4G/4G carriers, 5.3% in 4G/5G carriers, and 4.6% in 5G/5G carriers at 30 days (P ⫽ .80), and 24.7% in 4G/4G carriers, 23.0% in 4G/5G carriers, and 26.2% in 5G/5G carriers at 1 year (P ⫽ .45).

Conclusion The 4G/5G polymorphism of the PAI-1 gene is not associated with an increased risk of thrombotic and restenotic events after coronary artery stenting. (Am Heart J 2003;146:855– 61.) The deployment of endovascular stents offers a significant advance in the percutaneous treatment of atherosclerotic disease, but in-stent restenosis affects about 30% of patients in the months after an initially successful intervention.1 Fibrinolysis, and especially plasminogen activator inhibitor-1 (PAI-1) as an important factor in fibrinolysis,2 is thought to play a major role in the process of restenosis, as experimental and clinical data such as impairment of the fibrinolytic system and subsequent changes of the PAI-1 plasma protein level or activity after coronary interventions suggest.3–13 Although the factors disturbing the balance of

From the aDeutsches Herzzentrum Mu¨nchen and 1. Medizinische Klinik rechts der Isar, Technische Universita ¨ t Mu¨nchen, Mu¨nchen, Germany. Submitted October 11, 2002; accepted March 10, 2003. Reprint requests: Corinna Bo ¨ ttiger, MD, Deutsches Herzzentrum Mu¨nchen, Lazarettstrasse 36, 80636 Mu¨nchen, Germany. E-mail: [email protected] © 2003, Mosby, Inc. All rights reserved. 0002-8703/2003/$30.00 ⫹ 0 doi:10.1067/S0002-8703(03)00363-6

PAI-1 levels or activity after coronary interventions are largely unknown, one or more genetic polymorphisms are potentially involved in regulation of PAI-1. The most intensively studied variation of the PAI-1 gene is the common 4G/5G deletion/insertion polymorphism.14 Presence of the 4G motif has been found to lead to higher transcriptional activity than presence of the 5G motif.14,15 In correlation with these experimental results, plasma PAI-1 protein levels and activities were higher in subjects homozygous for the 4G allele than in subjects homozygous for the 5G allele.14 –17 We examined the association of the functionally relevant 4G/5G polymorphism of the PAI-1 gene with the risk of restenosis after coronary artery stenting in a large cohort of patients.

Methods Patients The study included 1850 consecutive white patients with symptomatic coronary artery disease who underwent stent implantation in coronary arteries at Deutsches Herzzentrum

American Heart Journal November 2003

856 Bo¨ttiger et al

Mu ¨ nchen and 1. Medizinische Klinik rechts der Isar der Technischen Universita¨t Mu ¨ nchen. All patients were scheduled for angiographic follow-up at 6 months. All patients participating in this study gave written informed consent for the intervention, follow-up angiography, and genotype determination. The study protocol conformed to the Declaration of Helsinki and was approved by the institutional ethics committee. Stent placement protocols and poststenting therapy have been previously described in detail.18,19 Postprocedural therapy consisted of aspirin (100 mg twice daily, indefinitely) and ticlopidine (250 mg twice daily for 4 weeks). Patients considered at a higher risk for stent thrombosis received adjunct therapy with the glycoprotein IIb/IIIa blocker abciximab. The decision to give abciximab was at the operator’s discretion.

Genotype determination Genomic DNA was extracted from peripheral blood leukocytes with the QIAamp Blood Kit (Qiagen, Hilden, Germany) or the High Pure PCR Template Preparation Kit (Roche Diagnostics, Mannheim, Germany). Genotype analysis was performed with allele-specific fluorogenic probes by TaqMan technique (Applied Biosystems, Weiterstadt, Germany).20 Oligonucleotide primers 5⬘ CAGACAAGGTTGTTGACACAAGAGA 3⬘ and 5⬘ TCCCTCATCCCTGCCATGT 3⬘ were used to amplify a 114-bp (5G allele) or 113-bp (4G allele) sequence consisting of nucleotides ⫺734 (5G allele) or ⫺733 (4G allele) to ⫺621 upstream of exon 1 of the IL-6 gene.14 The sequences of the probe oligonucleotides were complementary to the mRNA-like DNA strand: 5⬘ FAM-CACGGCTGACTCCCCACGTGT 3⬘ (4G allele-specific) and 5⬘ VIC-CGGCTGACTCCCCCACGTGT 3⬘ (5G allele-specific). FAM (6-carboxy-fluorescein) and VIC (Applied Biosystems, patent pending) designate the fluorogenic dyes covalently bound to the 5⬘ ends of the probes. The 2-step thermocycling procedure consisted of 40 cycles of denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 1 minute. As a control, genotyping was repeated for 20% of the samples using DNA prepared separately from the original blood sample. To identify DNAs homozygous for the 4G and 5G alleles, which were required as genotype standards for TaqMan assays, and to test the accuracy of results obtained with the TaqMan method, conventional genotype determination was performed. This was done by polymerase chain reaction (PCR), subsequent digestion of the PCR product with restriction enzyme BseLI (MBI Fermentas, St Leon-Rot, Germany), and separation of the restriction fragments by electrophoresis in a polyacrylamide gel (Invitrogen, Groningen, The Netherlands). Primers 5⬘ CACAGAGAGAGTCTGGCCACGT 3⬘ (forward) and 5⬘ GGTGGCTCGAGGGCAGAAT 3⬘ (reverse) were used to amplify a 147-bp (5G allele) or 146-bp (4G allele) sequence comprising nucleotides ⫺698 (5G allele) or ⫺697 (4G allele) to ⫺552. The upstream primer was modified with respect to the genomic sequence (C instead of A) to create a 5G allele-specific BseLI restriction site (CCN5 N2GG) that is not present in the 4G-specific PCR product.21 The thermocycling procedure consisted of denaturation at 95°C for 1 minute, annealing and extension at 60°C for 1 minute, repeated for 35 cycles, followed by a final extension at 72°C for 7 minutes. BseLI (MBI Fermentas, St Leon-Rot, Germany) cleaved the 4G allele-specific PCR product into 2 fragments

of 96 bp and 50 bp and the 5G allele-specific PCR product into 3 fragments of 74 bp, 50bp, and 23 bp. Genotypes were determined without knowledge of patients’ clinical and angiographic data.

Angiographic assessment Lesion morphology was classified according to the modified American College of Cardiology/American Heart Association grading system into type A, B1, B2, and C22; lesions of types B2 and C were considered complex lesions. Digital angiograms were analyzed off-line using the automated edgedetection system CMS (Medis Medical Imaging Systems, Nuenen, The Netherlands). Matched views were selected for angiograms recorded before and immediately after the intervention, and at follow-up. The parameters measured were lesion length, reference diameter, minimal lumen diameter, diameter stenosis, and diameter of the maximally inflated balloon during stent placement. Acute lumen gain was calculated as the difference between the final poststenting minimal lumen diameter and the minimal lumen diameter present before stenting. Late lumen loss was calculated as the difference between final poststenting minimal lumen diameter and minimal lumen diameter measured at follow-up angiography. Loss index was calculated as the ratio of late lumen loss and acute lumen gain. Operators who performed the quantitative assessment were unaware of the genotype data.

Definitions and study end points The diagnosis of unstable angina pectoris at presentation was based on a history of crescendo angina, angina at rest or with minimal exertion, or angina of new onset (within 1 month) in the absence of clear-cut electrocardiographic and cardiac enzyme changes indicative of an acute MI.23 Acute MI was diagnosed in the presence of a clinical episode of prolonged chest pain with either the appearance of 1 or more new pathologic Q waves on the electrocardiogram or an increase in creatine kinase (or its MB isoenzyme) levels to at least twice the upper normal limit. Patients were defined as having diabetes mellitus if they were on active treatment with insulin or an oral antidiabetic agent; for patients with dietary treatment, documentation of an abnormal fasting blood glucose tolerance test based on the World Health Organization criteria24 was required for establishing this diagnosis. Persons reporting regular smoking in the prior 6 months were considered to be current smokers. Systemic arterial hypertension was defined as systolic blood pressure of ⱖ140 mm Hg or diastolic blood pressure of ⱖ90 mm Hg25 on at least 2 separate occasions. Hypercholesterolemia was defined as a documented total cholesterol value ⱖ6.2 mmol/L. The definition of cardiovascular risk factors was based on the data obtained during the actual hospitalization or from the patient’s chart. The primary end point of the study was angiographic restenosis defined as a diameter stenosis of ⱖ50% at 6-month follow-up angiography. The number of patients included was based on the assumption of a 30% difference in the restenosis rates between carriers and noncarriers of the 4G allele, allowing for missing follow-up angiography in ⱕ20% of the patients and selecting an ␣-error of 0.05 and a ␤-error of 0.10 for a 2-sided test. The secondary end point of the study was

American Heart Journal Volume 146, Number 5

the combined event rate of death, myocardial infarction or target vessel revascularization due to symptoms or signs of ischemia in the presence of angiographic restenosis. The follow-up protocol included a telephone interview at 30 days, a clinical visit at 6 months, and an additional telephone contact at 1 year after stent placement. For patients reporting cardiac symptoms during the telephone interview, at least 1 clinical and electrocardiographic follow-up visit was scheduled and performed at the outpatient clinic or by the referring physician. In case of suspected restenosis, a follow-up angiography was performed. At 1 year, all information derived from hospital readmission records or provided by the referring physician or by the outpatient clinic was entered into the computer database. Persons who performed clinical follow-up were not aware of the patient’s genotype.

Statistical analysis The main analyses consisted of comparisons between the carriers of the genotypes 4G4G, 4G5G, and 5G5G. Discrete variables are expressed as counts or percentages and compared with the ␹2 or the Fisher exact test, as appropriate. Continuous variables are expressed as mean ⫾ SD and compared by means of the unpaired, 2-sided t test or analysis of variance for ⬎2 groups. Risk analysis was performed calculating the odds ratio (OR) and the 95% CIs. The association between the PAI-1 genotype and restenosis was also assessed by a multivariate logistic regression analysis including also all clinical, angiographic and procedural characteristics. Statistical analyses were performed using S-Plus software (Mathsoft Inc, Seattle, Wash). Correspondence of the PAI-1 genotype distribution with the Hardy-Weinberg equilibrium was tested with the Hardy-Weinberg Diagnostics program, version 1.beta, designed by A Rogatko and M Slifker (Fox Chase Cancer Center; http://www.fccc.edu/users/rogatko/hwdiag). A P value of ⬍.05 was considered statistically significant.

Bo¨ ttiger et al 857

Table I. Baseline clinical characteristics of the patients 4G4G (n ⴝ 572)

4G5G (n ⴝ 908)

5G5G (n ⴝ 370)

Age (y) 62.7 ⫾ 10.2 63.0 ⫾ 10.0 63.5 ⫾ 10.0 Women (%) 21.2 19.8 24.3 Arterial hypertension (%) 68.5 67.3 69.2 Diabetes (%) 21.9 21.5 18.4 Current smoker (%) 31.8 29.6 32.2 Elevated total cholesterol 43.2 42.5 43.0 (%) Acute myocardial 21.0 19.2 21.9 infarction (%) Unstable angina (%) 24.8 30.3 26.5 Prior myocardial 28.8 25.7 26.5 infarction (%) Prior PTCA (%) 24.0 25.7 22.7 Prior bypass surgery (%) 10.0 11.2 12.4 Number of diseased coronary vessels (%) 1 Vessel 29.2 29.1 24.6 2 Vessels 33.2 30.8 34.9 3 Vessels 37.6 40.1 40.5 Reduced left ventricular 29.7 28.2 31.9 function (%)

P .43 .20 .77 .39 .55 .97 .48 .06 .40 .50 .49 .36

.41

Data are proportions or mean ⫾ SD.

and 0.9% for 4G5G genotype (P ⫽ .86). MI was observed in 2.6% for 4G4G genotype, 1.8% for 4G5G genotype, and 1.4% for 4G4G genotype (P ⫽ .41). Urgent target vessel revascularization was required in 4.2% of 4G4G genotype, 1.8% of 4G5G genotype, and 1.4% of 4G4G genotype (P ⫽ .17).

Angiographic restenosis

Results Patients characteristics Among the 1850 patients who underwent stenting in coronary arteries, 572 (30.9%) patients carried genotype 4G4G, 908 (49.1%) patients carried genotype 4G5G, and 370 (20.0%) patients carried genotype 5G5G. This distribution complied with the HardyWeinberg equilibrium (P ⫽ .973). The main baseline clinical characteristics of the patient groups are compared in Table I; lesion and procedural characteristics are presented in Table II. Among the parameters shown in Tables I and II, there were no statistically significant differences between the 3 patient groups.

Acute and subacute thrombotic events after stent placement Angiographic stent vessel occlusion occurring within 30 days after stent placement was observed in 1.9% for 4G4G genotype, 1.8% for 4G5G genotype, and 1.4% for 4G4G genotype (P ⫽ .80). The mortality rate was 1.0% for 4G4G genotype, 1.0% for 4G5G genotype,

Of the 1850 patients, 1556 (84.1%) underwent follow-up coronary angiography 6 months after stenting. Restenosis rate, the primary end point of the study, was not significantly different between the patient groups: 32.5% in patients homozygote for 4G, 32.2% in heterozygote patients, and 35.7% in patients homozygote for 5G (P ⫽ .52) (Table III). All characteristics shown in Tables I and II were included in a multivariate logistic regression analysis of angiographic restenosis. Upon adjustment, the presence of the 4G allele was associated with an OR of 0.90 (95% CI 0.68-1.18). The multivariate logistic regression analysis showed that lesion complexity (P ⫽ .04), ostial location of the lesion (P ⬍ .001), lesion length (P ⫽ .004) and postprocedural minimal lumen diameter (P ⫽ .03) were independent predictors of angiographic restenosis. Continuous measures of restenosis were not significantly different among the patient groups (P ⱖ .52) (Table III). We separately examined the relationship between the 4G/5G polymorphism and restenosis among smokers and nonsmokers. In smokers, restenosis rate was

American Heart Journal November 2003

858 Bo¨ ttiger et al

Table II. Lesion and procedural characteristics at the time of intervention 4G4G (n ⴝ 572) Target coronary vessel (%) Left main LAD LCx RCA ACVB Complex lesion (%) Restenotic lesion (%) Chronic occlusion (%) Ostial lesion (%) Before stenting Reference diameter (mm) Minimal lumen diameter (mm) Diameter stenosis (%) Lesion length (mm) Procedural data Measured balloon diameter (mm) Maximal balloon pressure (atm) Balloon to vessel ratio Stented segment length (mm) Number of stents Periprocedural abciximab therapy (%) Immediately after stenting Minimal lumen diameter (mm) Diameter stenosis (%) Acute lumen gain (mm)

4G5G (n ⴝ 908)

5G5G (n ⴝ 370)

P .19

1.1 40.0 23.4 28.7 6.8 73.4 23.8 7.0 5.6

1.4 39.8 18.7 33.2 6.9 74.0 25.1 6.4 7.3

2.2 38.9 17.6 35.4 6.0 78.1 23.0 5.4 7.8

.22 .68 .62 .33

3.05 ⫾ 0.53 0.64 ⫾ 0.51 79.1 ⫾ 15.7 12.0 ⫾ 6.7

3.04 ⫾ 0.53 0.64 ⫾ 0.49 79.0 ⫾ 15.0 11.9 ⫾ 6.8

3.00 ⫾ 0.54 0.65 ⫾ 0.49 78.4 ⫾ 15.4 12.5 ⫾ 6.8

.27 .95 .78 .38

3.25 ⫾ 0.54 13.9 ⫾ 3.3 1.07 ⫾ 0.09 20.3 ⫾ 13.4 1.81 ⫾ 1.15 20.5

3.24 ⫾ 0.53 13.8 ⫾ 3.3 1.07 ⫾ 0.09 19.7 ⫾ 14.4 1.76 ⫾ 1.20 18.3

3.22 ⫾ 0.53 13.8 ⫾ 3.2 1.08 ⫾ 0.11 21.0 ⫾ 13.8 1.85 ⫾ 1.16 21.9

.77 .83 .09 .33 .39 .29

2.95 ⫾ 0.52 5.2 ⫾ 8.0 2.31 ⫾ 0.67

2.93 ⫾ 0.52 5.3 ⫾ 8.7 2.29 ⫾ 0.63

2.91 ⫾ 0.51 5.4 ⫾ 8.0 2.26 ⫾ 0.62

.52 .95 .52

Data are proportions or mean ⫾ SD. LAD, Left anterior descending coronary artery; LCx, left circumflex coronary artery; RCA, right coronary artery; ACVB, aorto-coronary venous bypass. Complex lesions were defined as ACC/AHA lesion types B2 and C, according to the American College of Cardiology/American Heart Association grading system.

Table III. Results of follow-up angiography 4G4G (n ⴝ 486) Minimal lumen diameter (mm) Diameter stenosis (%) Late lumen loss (mm) Loss index Restenosis rate (%)

4G5G (n ⴝ 762)

Table IV. Clinical outcome at 1 year after stent placement 5G5G (n ⴝ 308)

P

1.73 ⫾ 0.92 1.74 ⫾ 0.93 1.71 ⫾ 0.96 .87 43.6 ⫾ 27.1 43.4 ⫾ 27.5 44.0 ⫾ 28.6 .96 1.21 ⫾ 0.84 1.21 ⫾ 0.85 1.20 ⫾ 0.81 .98 0.56 ⫾ 0.42 0.55 ⫾ 0.40 0.58 ⫾ 0.45 .52 32.5 32.2 35.7 .52

Data are proportions or mean ⫾ SD.

32.9% in 4G4G carriers, 30.5% in 4G5G carriers, and 31.7% in 5G5G carriers (P ⫽ .88). Thus, there was no significant difference among the groups. The analysis of nonsmokers did not show a significant difference either, with 32.3% restenosis rate in 4G4G carriers, 32.9% in 4G5G carriers, and 37.7% in 5G5G carriers (P ⫽ .38). No statistically significant differences were achieved concerning late loss, either.

Clinical outcome at 1 year Table IV shows the adverse events observed over 1 year. There was only a trend toward a higher mortality

Death (%) Nonfatal myocardial infarction (%) Target vessel revascularization (%) PTCA ACVB Major adverse cardiac events (%)

4G4G (n ⴝ 572)

4G5G (n ⴝ 908)

5G5G (n ⴝ 370)

P

1.6 1.1

2.4 1.9

4.1 2.0

.06 .41

21.3

19.6

20.5

.72

19.2 2.5 24.7

18.5 1.4 23.0

18.6 2.2 26.2

.94 .34 .45

PTCA, Percutaneous transluminal coronary angiography; ACVB, aorto-coronary venous bypass.

among 5G allele carriers, but the numbers were small and the study was not sufficiently powered for the analysis of this event. The incidence of nonfatal MI was similar in the 3 groups (P ⫽ .41). Target vessel revascularization was required in 21.3% of patients with 4G4G genotype, 19.6% of patients with 4G5G genotype, and 20.6% of patients with 5G5G genotype (P ⫽ .72). In total, the occurrence of a major adverse

American Heart Journal Volume 146, Number 5

cardiac event (death, nonfatal MI, or target vessel revascularization) was 24.7% in patients carrying 4G4G genotype, 23.0% in patients carrying 4G5G genotype, and 26.2% in patients carrying 4G5G genotype (P ⫽ .45).

Discussion In this trial, we found no association between the 4G/5G promoter polymorphism of the PAI-1 gene and angiographic restenosis (primary end point) or clinical outcome (death, myocardial infarction, target lesion revascularization) after coronary artery stenting in a large consecutive cohort of patients. Based on previous studies indicating an influence of cigarette smoking on PAI-1 levels,26,27 we separately examined the relationship between the 4G/5G polymorphism and restenosis among the smokers and nonsmokers of our study cohort. However, we did not find an association, neither in smokers nor in nonsmokers. This observation is in contrast to a recent report suggesting that, in smokers, late lumen loss after coronary artery stenting was most severe in carriers of the 5G5G genotype, whereas in nonsmokers, late lumen loss was greatest among 4G4G carriers.8 Our expectation to find a correlation between the 4G/5G polymorphism of the PAI-1 gene and the risk of restenosis after coronary artery stenting was based on a number of experimental and clinical observations. Because of its regulatory functions in coagulation and fibrinolysis, PAI-1 is viewed as an important factor involved in thrombosis and myocardial infarction.2,28 –30 Studies investigating the relationship between the 4G/5G polymorphism and coronary artery disease or myocardial infarction provided conflicting results.15–17,31–36 The pathophysiologic process resulting in restenosis after coronary artery stenting parallels wound healing responses.37 The tendency of PAI-1 to maintain the fibrin clot may result in an extended presence of potent mitogenic substances at the site of vessel injury, possibly contributing to migration and proliferation of vascular smooth muscle cells and development of a neointima resulting in restenosis. However, conflicting data about the role of PAI-1 in the process of restenosis exists: there are also data that suggest PAI-1 may facilitate reduction of neointima formation and therefore prevent restenosis.10,12,38 A number of trials examined the relationship between PAI-1 and restenosis after coronary interventions. Predominantly, elevation of PAI-1 protein levels or activity after percutaneous transluminal coronary angioplasty has been implicated in restenosis.3–5,7 Two studies investigated the occurrence of restenosis after percutaneous transluminal coronary angioplasty, both with or without stenting; one found a positive correla-

Bo¨ ttiger et al 859

tion with PAI-1 activity9 while the other found a negative correlation with PAI-1 protein levels.6 The apparently conflicting results of these trials may reflect, at least in part, the difficulty of assessing the individual contribution of PAI-1 plasma concentration or activity to restenosis. For example, there exists a significant positive correlation between the plasma concentration and activity of PAI-1 and those of its natural opponents tPA and uPA, which may cause, by formation of inactive complexes, partial neutralization of their effects.12,39,40 In addition, the plasma level of PAI-1 is sensitive to diurnal variation and dependent on factors associated with coronary artery disease (eg, insulin resistance).41,42 In an effort to overcome this potentially important problem, we examined a functionally relevant genetic marker of PAI-1, the 4G/5G polymorphism, to test whether it is useful as a predictor of restenosis risk after coronary stent placement. However, our study provides evidence that this is not the case. The design of the study (large and consecutive series of patients, precisely defined phenotype, and adequate and established methods to examine the phenotype quantitatively) argues against the possibility that this negative outcome is based on chance. To test the accuracy of the results obtained with the TaqMan procedure for genotyping of the 4G/5G polymorphism, we used an established technique, polymerase chain reaction in combination with restriction enzyme analysis,21 and found complete concordance of the results. A 4G allele frequency of 0.55, as observed in our patients, is similar to the data obtained by other groups.15,16,34,43 This supports the validity of our genotyping data. Thus, in contrast to associations found between gene polymorphisms of other candidate genes and restenosis after stenting,44,45 the 4G/5G polymorphism of the PAI-1 gene is not a marker for restenosis risk. However, this result does not imply that PAI-1 is unimportant for restenotic mechanisms. Most likely, the functional contribution, if any, of the 4G/5G polymorphism in processes like wound healing and neointima formation, does not reach a significant level. Metabolic determinants (eg, the insulin resistance syndrome) may be more important than the 4G/5G polymorphism in determining PAI-1 activity and its correlation to restenosis after stenting.46 The possibility remains that examination, not of a single variation, but of different combinations of several polymorphisms present in the PAI-1 gene would provide a genetic marker for restenosis after coronary artery stenting.

References 1. Kastrati A, Schomig A, Elezi S, et al. Predictive factors of restenosis after coronary stent placement. JACC 1997;30:1428 –36. 2. Kohler HP, Grant PJ. Plasminogen activator inhibitor type 1 and coronary artery disease. N Engl J Med 2000;342:1792– 801.

860 Bo¨ ttiger et al

3. Huber K, Jo ¨ rg M, Probst P, et al. A decrease in plasminogen activator inhibitor-1 activity after successful percutaneous transluminal coronary angioplasty is associated with a significantly reduced risk for coronary restenosis. Thromb Haemost 1992;67:209 –13. 4. Sakata K, Miura F, Sugino H, et al. Impaired fibrinolysis early after percutaneous transluminal coronary angioplasty is associated with restenosis. Am Heart J 1996;131:1– 6. 5. Ishiwata S, Tukada T, Nakanishi S, et al. Postangioplasty restenosis: platelet activation and the coagulation-fibrinolysis system as possible factors in the pathogenesis of restenosis. Am Heart J 1997;133:387–92. 6. Strauss BH, Lau HK, Bowman KA, et al. Plasma urokinase antigen and plasminogen activator inhibitor-1 antigen levels predict angiographic coronary restenosis. Circulation 1999;100:1616 –22. 7. Fornitz GG, Nielsen P, Amtorp O, et al. Impaired fibrinolysis determines the outcome of percutaneus transluminal coronary angioplasty (PTCA). Eur J Clin Invest 2001;31:586 –92. 8. Ortlepp JR, Hoffmann R, Killian A, et al. The 4G/5G promotor polymorphism of the plasminogen activator inhibitor-1 gene and late lumen loss after coronary stent placement in smoking and nonsmoking patients. Clin Cardiol 2001;24:585–91. 9. Prisco D, Fedi S, Antonucci E, et al. Postprocedural PAI-1 activity is a risk marker of subsequent clinical restenosis in patients both with and without stent implantation after elective balloon PTCA. Thromb Res 2001;104:181– 6. 10. Carmeliet P, Moons L, Lijnen R, et al. Inhibitory role of plasminogen activator inhibitor-1 in arterial wound healing and neointima formation: a gene targeting and gene transfer study in mice. Circulation 1997;96:3180 –91. 11. Hasenstab D, Forough R, Clowes AW. Plasminogen activator inhibitor type 1 and tissue inhibitor of metalloproteinase-2 increase after arterial injury in rats. Circ Res 1997;80:490 – 6. 12. Kjøller L, Kanse SM, Kirkegaard T, et al. Plasminogen activator inhibitor-1 represses integrin- and vitronectin-mediated cell migration independently of its function as an inhibitor of plasminogen activation. Exp Cell Res 1997;232:420 –9. 13. DeYoung MB, Tom C, Dichek DA. Plasminogen activator inhibitor type 1 increases neointima formation in balloon-injured rat carotid arteries. Circulation 2001;104:1972–7. 14. Dawson SJ, Wiman B, Hamsten A, et al. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem 1993;268:10739 – 45. 15. Eriksson P, Kallin B, van’t Hooft FM, et al. Allele-specific increase in basal transcription of the plasminogen-activator inhibitor-1 gene is associated with myocardial infarction. Proc Natl Acad Sci USA 1995;92:1851–5. 16. Ye S, Green FR, Scarabin PY, et al. The 4G/5G genetic polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene is associated with differences in plasma PAI-1 activity but not with risk of myocardial infarction in the ECTIM study. Thromb Haemost 1995;74:837– 41. 17. Ossei-Gerning N, Mansfield MW, Stickland MH, et al. Plasminogen activator inhibitor-1 promoter 4G/5G genotype and plasma levels in relation to a history of myocardial infarction in patients characterized by coronary angiography. Arterioscler Thromb Vasc Biol 1997;17:33–7. 18. Scho ¨ mig A, Kastrati A, Mudra H, et al. Four-year experience with Palmaz-Schatz stenting in coronary angioplasty complicated by dissection with threatened or present vessel closure. Circulation 1994;90:2716 –24.

American Heart Journal November 2003

19. Scho ¨ mig A, Neumann F-J, Kastrati A, et al. A randomized comparison of antiplatelet and anticoagulant therapy after the placement of coronary-artery stents. N Engl J Med 1996;334:1084 –9. 20. Livak KJ. Allelic discrimination using fluorogenic probes and the 5⬘ nuclease assay. Genet Anal 1999;14:143–9. 21. Margaglione M, Grandone E, Cappucci G, et al. An alternative method for PAI-1 promoter polymorphism (4G/5G) typing. Thromb Haemost 1997;77:605– 6. 22. Ellis SG, Vandormael MG, Cowley MJ, et al. Coronary morphologic and clinical determinants of procedural outcome with angioplasty for multivessel coronary disease: implications for patient selection. Circulation 1990;82:1193–202. 23. Rutherford JD, Braunwald E, Cohn PF. Chronic ischemic heart disease. In: Braunwald E, editor. Heart disease: a textbook of cardiovascular medicine. 3rd ed. Philadelphia: WB Saunders Company; 1988. p. 1314 –78. 24. World Health Organization Study Group. Diabetes mellitus. WHO Tech Rep Ser 1985;727:1–104. 25. Guidelines Subcommittee. 1999 World Health Organization-International Society of Hypertension guidelines for the management of hypertension. J Hypertens 1999;17:151– 83. 26. Simpson AJ, Gray RS, Moore NR, et al. The effects of chronic smoking on fibrinolytic potential of plasma and platelets. Br J Haematol 1997;97:201–13. 27. Hughes K, Choo M, Kuperan P, et al. Cardiovascular risk factors in relation to cigarette smoking: a population-based survey among Asians in Singapore. Atherosclerosis 1998;137:253– 8. 28. Eren M, Painter CA, Atkinson JB, et al. Age-dependent spontaneous arterial thrombosis in transgenic mice that express a stable form of human plasminogen activator inhibitor-1. Circulation 2002;106:491– 6. 29. Held C, Hjemdahl P, Rehnqvist N, et al. Fibrinolytic variables and cardiovascular prognosis in patients with stable angina pectoris and treated with verapamil and metoprolol. Circulation 1997;95: 2380 – 6. 30. Tho ¨ gersen AM, Jansson J-H, Boman K, et al. High plasminogen activator inhibitor and tissue plasminogen activator levels in plasma precede a first acute myocardial infarction in both men and women. Circulation 1998;98:2241–7. 31. Iwai N, Shimoike H, Nakamura Y, et al. The 4G/5G polymorphism of the plasminogen activator inhibitor gene is associated with the time course of progression to acute coronary syndromes. Atherosclerosis 1998;136:109 –14. 32. Margaglione M, Cappucci G, Colaizzo D, et al. The PAI-1 gene locus 4G/5G polymorphism is associated with a family history of coronary artery disease. Arterioscler Thromb Vasc Biol 1998;1: 152– 6. 33. Gardemann A, Lohre J, Katz N, et al. The 4G4G genotype of the plasminogen activator inhibitor 4G/5G gene polymorphism is associated with coronary atherosclerosis in patients at high risk for this disease. Thromb Haemost 1999;82:1121– 6. 34. Ridker PM, Charles HH, Lindpaintner K, et al. Arterial and venous thrombosis is not associated with the 4G/5G polymorphism in the promotor of the plasminogen activator inhibitor gene in a large cohort of US men. Circulation 1997;95:59 – 62. 35. Anderson JL, Muhlestein JB, Habashi J, et al. Lack of association of a common polymorphism of the plasminogen activator inhibitor-1 gene with coronary artery disease and myocardial infarction. J Am Coll Cardiol 1999;34:1778 – 83. 36. Doggen CJ, Bertina RM, Cats VM, et al. The 4G/5G polymorphism in the plasminogen activator inhibitor-1 gene is not associ-

American Heart Journal Volume 146, Number 5

37. 38.

39. 40.

41.

42.

ated with myocardial infarction. Thromb Haemost 1999;82:115– 20. Virmani R, Farb A. Pathology of in-stent restenosis. Curr Opin Lipidol 1999;10:499 –510. Xiaoli M, Wenying H, Mingpeng S. Effects and mechanism of tissue-type plasminogen activator and plasminogen activator inhibitor on vascular smooth muscle cell proliferation. Int J Cardiol 1998;66(1 Suppl):S57– 64. Saksela O, Rifkin DB. Cell-associated plasminogen activation: regulation and physiological functions. Ann Rev Cell Biol 1988;4:93–126. Chandler WL, Trimble SL, Loo SC, et al. Effect of PAI-1 levels on the molar concentrations of active tissue plasminogen activator (t-PA) and t-PA/PAI-1 complex in plasma. Blood 1990;76:930 –7. Angleton P, Chandler WL, Schmer G. Diurnal variation of tissuetype plasminogen activator and its rapid inhibitor (PAI-1). Circulation 1989;79:101– 6. Juhan-Vague I, Pyke SD, Alessi MC, et al. Fibrinolytic factors and

Bo¨ ttiger et al 861

43.

44.

45.

46.

the risk of myocardial infarction or sudden death in patients with angina pectoris. ECAT study group: European concerted action on thrombosis and disabilities. Circulation 1996;94:2057– 63. Iacoviello L, Burzotta F, Di Castelnuovo A, et al. The 4G/5G polymorphism of PAI-1 promoter gene and the risk of myocardial infarction: a meta-analysis. Thromb Haemost 1998;80:1929 –30. Kastrati A, Scho ¨ mig A, Seyfarth M, et al. PlA polymorphism of platelet glycoprotein IIIa and risk of restenosis after coronary stent placement. Circulation 1999;99:1005–10. Koch W, Bo ¨ ttiger C, Mehilli J, et al. Association of a CD18 gene polymorphism with a reduced risk of restenosis after coronary stenting. Am J Cardiol 2001;88:1120 – 4. Henry M, Tregoue¨t DA, Alessi MC, et al. Metabolic determinants are much more important than genetic polymorphisms in determining the PAI-1 activity and antigen plasma concentrations: a family study with part of the Stanislas cohort. Arterioscler Thromb Vasc Biol 1998;18:84 –9.