[5] Fluorescence correlation spectroscopy of GFP fusion proteins in living plant cells

[5]

FCS OF GFP FUSIONPROTEINSIN PLANTCELLS

93

[5] Fluorescence Correlation Spectroscopy of GFP Fusion Proteins in Living Plant Cells By MARK A. HINK, JAN WILLEM BORST, and ANTONIEJ. W. G. VISSER Introduction

Fluorescence Correlation Spectroscopy Until recently fluorescence correlation spectroscopy (FCS) was mainly applied to well-defined in vitro systems. However, the possibility of monitoring molecular dynamics under equilibrium conditions at a single-molecule level makes FCS an attractive technique for intracellular studies. This article presents an overview of FCS measurements inside living plant cells. FCS was introduced in the early 1970s ~ to measure transport properties and concentrations via autocorrelation of fluorescence fluctuations arising from fluctuations in the occupation number in the system (for an extensive overview of theory and applications see Rigler and Elson 2 and Thompson3). In FCS a focused laser beam illuminates a subfemtoliter volume element. Fluorescently labeled molecules present in the volume element will emit photons. The fluorescence photons pass through a pinhole and are detected by a highly sensitive detector. The signal-to-noise ratio achieved by this method is very high, since signal interference from scattered laser light, background fluorescence, and Raman emission can be largely eliminated. This allows measurements at the single-molecule level. Typical fluorophore concentrations used in FCS measurements are in the nanomolar range, which makes FCS ideally suited to study biomolecules at physiologically relevant concentrations. The intensity signals (I) are autocorrelated over time resulting in the normalized autocorrelation curve Gij (r), being dependent on the fluctuating intensity M:

Gij (7:) = (~li(t) ~lj(t d- r)) (li)(Ij)

with i = j for autocorrelation

(1)

Any process that will result in temporal changes of the fluorescence intensity may be represented in G(r). Diffusion of molecules entering and leaving the volume element is one of the most studied sources of fluctuation as well as other processes such as triplet state dynamics, 4 isomerization, 5 I D. Magde, E. L. Elson, and W. W. Webb, Phys. Rev. Let. 29, 705 (1972). 2 R. Rigler and E. S. Elson, eds., "Fluorescence Correlation Spectroscopy. Theory and Applications." Springer Verlag, Berlin, 2001. 3 N. L. Thompson, in "Topics in Fluorescence Spectroscopy" Vol. I (J. R. Lakowicz, ed.), p. 337. Plenum Press, New York, 1991. 4 j. Widengren, O. Mets, and R. Rigler, J. Phys. Chem. 99, 13368 (1995). 5 j. Widengren and E Schwille, J. Phys. Chem. 104, 6416 (2000).

METHODSIN ENZYMOLOGY.VOL.36l

Copyright2003, ElsevierScience(USA). All rightsreserved. 0076-6879103$35.00

94

[51

BIOPHOTONICS

quenching, 6 or protonation of the chromophore.7'8 The possibility of monitoring molecular interactions with FCS has resulted in numerous publications on proteinprotein, protein-lipid, and ligand-receptor interactions. 9-15 In these studies a small fluorescently tagged molecule interacts with a nonlabeled molecule having a much larger mass. Autocorrelation of the fluorescence signal then distinguishes smaller (faster diffusing) from larger (slower diffusing) molecules and the fractions (F) of free and bound molecules of a binding equilibrium can be determined according to a three-dimensional (3D) diffusion fitting model: GB(r) = 1 + ~

2 D/ffi "=

withD

3o =

{1 1

Fi oi

]1 +

1

}

Here, N is the total number of fluorescent particles in the detection volume element, which corresponds to 1/[Go(0) - 1]. Parameters z0 and o)0 represent the e -2 radii of the axial and equatorial axis of the detection volume element, respectively, and 0i is the molecular brightness of species i. Note that each species contributes to the curve by the squared value of its brightness, which means that a species with a brightness twice that of another species will contribute four times more to the correlation curve. The diffusion time for species/(re), is related to the translational diffusion constant according to Di = --°92 4re

(3)

Fluorescence Cross-Correlation Spectroscopy

The application of FCS to study molecular interactions is limited by the fact that the diffusion time scales only to the power of one-third of the molecular 6 G. Bonnet, O. Krichevsky, and A. Libchaber, Proc. Natl. Acad. Sci. U.S.A. 95, 8602 (1998). 7 U. Haupts, S. Maiti, R Schwille, and W. W. Webb, Proc. Natl. Acad. Sci. U.S.A. 95, 13573 (1998). 8 j. Widengren, U. Mets, and R. Rigler, Chem. Phys. 250, 171 (1999). 9 K. M. Berland, R T. C. So, Y. Chen, W. W. Mantulin, and E. Gratton, Biophys J. 71, 410 (1996). lO B. Rauer, E. Neumann, J. Widengren, and R. Rigler, Biophys. Chem. 58, 3 (1996). 11 U. Trier, Z. Olah, B. Kleuser, and M. Schafer-Korting, Pharmazie 54, 263 (1999). 12 T. Wohland, K. Friedrich, R. Hovius, and H. Vogel, Biochemistry 38, 8671 (1999). 13 A. Pramanik, P. Thyberg, and R. Rigler, Chem. Phys. Lipids 104, 35 (2000). 14 j. Goedhart, H. Rrhrig, M. A. Hink, A. van Hoek, A. J. W. G. Visser, T. Bisseling, and T. W. J. Gadella, Biochemistry 38, 10898 (1999). 15 E. van Craenenbroeck and Y. Engelborghs, Biochemistry 38, 5082 (1999).

[5]

FCS OF GFP FUSIONPROTEINSIN PLANTCELLS

95

mass. Therefore discrimination between single fluorescently labeled molecules and complexed molecules will be difficult in case of almost equally sized components such as those occurring in studies of homodimer receptors. Meseth et al. 16 examined the resolving power of FCS to distinguish between different molecular sizes. In the case of an unchanged fluorescence yield on binding, the diffusion times of the bound and unbound forms have to differ at least 1.6 times, which corresponds to a fourfold mass increase, which is required to distinguish both species without prior knowledge of the system. Although small mass differences can be visualized in the autocorrelation traces, this requires detailed knowledge about the photophysical properties of the molecules involved. For most experimental systems and especially for measurements in living cells, these properties are hard to obtain. To overcome these limitations Schwille et al. 17 have developed dual-color fluorescence cross-correlation spectroscopy (FCCS). In FCCS studies interacting molecules can be tagged by spectrally different fluorescent groups, e.g., green and red emitting dyes. Interaction can be studied by following the fluctuations in fluorescence intensity of both labeled molecules. Therefore the emission light is split into two different detectors by which the two dyes can be monitored simultaneously. Cross-correlation curves are analyzed according to Eq. (2) with rdif representing the weighted diffusion time of the doubly labeled molecules, Ngr: 0)2 ÷ 0)2 r -Cdif'gr --

0,g

8Ogr

.

(4)

The time-independent part, Go(0) is not equal to 1 + 1/Ngr here, but is also related to the number of molecules emitting in only one of the two channels. Equation (5) corrects for this18: GD(0) = 1 +

Ng(/Trgg//'/rrr) ÷ Ngr[l + (/]rgg/0rrr)] (Ng + Ngr)[Nr + Ng(0rgg/rlrrr) ÷ Ngr[1 + (0rgg/r/rrr)]]

(5)

Ng and Nr are the numbers of free, singly labeled molecules and r/em,dye,exare the molecular brightness values for the dyes at various excitation and emission wavelengths. In the ideal case the time-dependent part of GD represents only the fluctuation characteristics of the doubly labeled molecule. In practice, however, the green dye will also emit into the red detector (this is called cross-talk) and therefore contribute to the cross-correlation curve as an additional species.

16U. Meseth, T. Wohland, R. Rigler, and H. Vogel, Biophys. J. 76, 1619 (1999). 17p. Schwille, E J. Meyer-Almes, and R. Rigler, Biophys. J. 72, 1878 (1997). 18R. Rigler, Z. Ftldes-Papp, E J. Meyer-Almes, C. Sammet, M. Volcker, and A. Schnetz, Z Biotech. 63, 97 (1999).

96

BIOPHOTONICS

[51

FCCS applications that have been reported include enzyme kinetics, 19,2° nucleotide hybridization, 17,18,21 conformational dynamics in DNA, 22 and proteinDNA interactions.23 From these studies it is clear that FCCS is an attractive technique to observe very specific molecular interactions. Now it is a challenge to apply this technique to cellular systems in order to monitor molecular interactions.

Practical Considerations

for F C S M e a s u r e m e n t s

in Living Cells

Only a limited number of intracellular FCS applications have been reported 14'24-34 (for a review see Schwille35). Cellular autofluorescence, photobleaching of the dye, cellular damage, and reduced signal-to-noise ratios due to scattering are major points of concern when taking FCS into the living cell. We will briefly discuss these factors. Autofluorescence

One of the most important problems is the presence of autofluorescent molecules. Endogeneous molecules like NADH, flavins, flavoproteins, and chlorophyll (and some others) will fluoresce strongly in the blue, green, and red spectral regions. The optimal spectral range for fluorescence of probes used in plant cells is roughly between 500 and 600 nm, which is covered by variants of fluorescent proteins (see below). Autofluorescence (more generally the background) can contribute to the correlation curves in two ways. It may be present as a constant, 19U. Kettling,A. Koltermann,P. Schwille,and M. Eigen,Proc. Natl. Acad. Sci. U.S.A. 95,1416 (1998). 20A, Koltermann,U. Kettling,J. Bieschke, T. Winkler,and M. Eigen, Proc. Natl. Acad. Sci. U.S,A. 95, 1421 (1998). 21Z. F61des-Papp, B. Angerer, P. Thyberg, M. Hinz, S. Wennmalm,W. Ankenbauer,H. Seliger, A. Holmgren,and R. Rigler,J. Biotech. 86, 237 (2001). 22M. I. Wallace,L. M. Ying,S. Balasubramanian,and D. Klenerman,J. Phys. Chem. 48, 11551 (2001). 23K. Rippe, Biochemistry 39, 2131 (2000). 24 K. M. Berland, P. T. C. So, and E. Gratton,Biophys. J. 68, 694 (1995). 25j. C. Politz,E. S. Brown,D. E. Wolf,and T. Pederson,Proc. Natl. Acad. Sci. U.S,A. 95, 6043 (1998). 26R. Brock, M. Hink, and T. M. Jovin,Biophys. J. 75, 2547 (1998). 27R. Brock, G. Vamosi,G. Vereb, and T. M. Jovin,Proc. Natl. Acad. Sci. U.S.A. 96, 10123 (1999). 28W. J. H. Koopman,M. A. Hink, A. J. W. G. Visser, E. W. Roubos, and B. G. Jenks, Cell Calcium 26, 59 (1999). 29p. Schwille,J. Korlach, and W. W. Webb, Cytometry 36, 176 (1999). 30p. Schwille,U. Haupts, S. Maiti, and W. W. Webb,Biophys. J. 77, 2251 (1999). 31 R. Rigler, A. Pramanik,P. Jonasson, G. Kratz, O. T. Jansson. P.-A. Nygren, S. Stfihl, K. Ekberg, B.-L. Johansson, S. Uhl6n,M. Uhl6n,H. J6rnvall,and J. Wahren,Proc. Natl. Acad. Sci. U.S.A. 96, 13318 (1999). 32M, Wachsmuth,W. Waldeck, and J. Langowski,J. Mol. BioL 298, 677 (2000). 33j. Goedhart, M. A. Hink, A. J. W. G. Visser, T. Bisseling,and T. W. J. Gadella,Plant J. 21, 109 (2000). 34R. H. K6hler, P. Schwille,W. W. Webb,and M. R. Hanson,Z Cell Sci. 113, 3921 (2000). 35p. Schwille,Cell Biochem. Biophys. 34, 383 (2001).

[5]

FCS OF GFP FUSION PROTEINSIN PLANTCELLS

97

noncorrelating species, lowering the amplitude of the correlation curve by a factor of ( 1 - - Ibackground/Itotal)2. Autofluorescent molecules may also contribute to the curve as an additional correlating component. In this case the difference in brightness between the autofluorescent molecules and the fluorescent probe used will determine how large the contribution of the autofluorescence will be [see Eq. (2)1 and therefore a careful selection of cell type, fluorescent probe, and excitation wavelength is required. Also differences between subcellular locations and the metabolic state of a cell 26 can influence the brightness of autofluorescence. To investigate processes in living plant cells two cell types were selected, which have been widely used as a model system for plant cells: Both Bright Yellow 2 (BY2) tobacco suspension cells and cowpea protoplasts are easy to grow and to manipulate and show a moderate level of autofluorescence. Figure 1A displays the emission spectra for both cell types acquired at an excitation wavelength of 436 nm. The autofluorescence spectra show broad-banded emission peaks without any fine structure. The autofluorescence intensity decreases going toward 600 nm, as is also shown by the FCS intensity traces at various excitation wavelengths (Fig. 1B). The molecular brightness, obtained by analysis of the autocorrelation curves, decreases as well, when excited further in the red (Fig. 1C). However, above 600 nm a steep increase of intensity and brightness is found for the cowpea protoplasts that is due to the presence of chlorophyll in the chloroplasts. The latter emission peak is not present inside the BY2 cells that lack chloroplasts, due to their growth in a dark environment. Table I summarizes the molecular brightness values of the autofluorescent molecules at various subcellular locations using the experimental setup for detection of the fluorescent proteins (see below) CFP (cyan fluorescent protein) and YFP (yellow fluorescent protein). The brightness values are low compared to the ones obtained for CFP and YFP (Table II) and therefore the contribution of autofluorescence to the correlation curve can be neglected except for measurements performed in the cytoplasm of cowpea protoplasts, where many chloroplasts are located. To remove autofluorescent molecules from the volume element, the sample can be prebleached before the real measurement. However, this approach is not very successful in the plant cells studied due to the high mobility of the autofluorescent molecules, which quickly replace the destroyed molecules in the prebleached area.

Cell Culture and Handling Suspension cells of tobacco BY-2 (Nicotiana tabacum L. cv. Bright Yellow 2) were cultured at 22 ° under gently shaking (13 rpm) in growth medium (4.3 g/liter Murashige and Skoog plant salt base, 255 mg/liter KH2PO4, 1 mg/liter thiamin hydrochloride, 0.2 mg/liter 2,4-dichlorophenoxyacetic acid, 30 g/liter sucrose, and 100 g/liter myo-inositol, pH 5.8) and weekly subcultured at 50 times dilution with fresh medium. Protoplasts were prepared from the cells cultured after 3 days of subculture by adding 10 ml enzyme solution consisting of 1% cellulase, 0.1%

BIOPHOTONICS

98

[5]

A 407

. . . .

I

. . . .

i

,

I

. . . .

i

,

I

. . . .

i

,

oc. o •

"~

20

~..~_ 0 450 ,

,

,

,

,

,

,

i

,

,

,

,

,

550 650 Excitation wavelength (nm)

B 60 -r

o t-

~ 30 o o

<

0

458 488 514 543 633 Excitation wavelength (nm)

C 1.03

o o o

<"5 1.00 0.01

1 Tau (ms)

100

FIG. 1. Autofluorescence characteristics of BY2 suspension cells (gray) and cowpea protoplasts (black). (A) Whole cell emission spectra were obtained by spectral imaging using excitation at 436 nm. (B) Average fuorescence intensities and (C) autocorrelation curves of autofluorescent cytoplasm of cowpea protoplasts measured with various excitation wavelengths during 90 sec.

[5]

F C S OF G F P FUSION PROTEINS IN PLANT CELLS

99

TABLE I MOLECULAR BRIGHTNESS AND INTENSITY OF AUTOFLUORESCENT MOLECULESa

Molecular brightness 0 (kHz/molecule) Nucleus Cell

Membrane

CFP

YFP

BY2

0.1

Cowpea protoplast

0.0

Cytoplasm

Vacuole

CFP

YFP

CFP

YFP

CFP

YFP

0.1

0.1

0.0

0.1

0.2

0.3

0.2 0.5

0.1 0.4

0.2 0.3

0.1 0.3

3 16

2 12

Fluorescence intensity I (kHz) BY2

Cowpea protoplast

6 8

4 7

2 8

2 8

6 43

5 29

a At several subcellular locations determined by FCS measurements using the experimental setup to detect CFP or YFP at excitation intensities of 2.5 and 3.1 kW cm -2, respectively.

pectolyase, and 0.4 M mannitol, pH 5.5. After 3 hr of incubation at 28 ° in a rotating vessel at 60 rpm for 2 hr the cells were washed twice by centrifugation room temperature for 2 min at 850 rpm followed by addition of 10 ml solution containing 125 mM CaC12, 154 mM NaC1, 5 mM KC1, 5 mM sucrose, and 0.1% morpholinoethanesulfonic acid (MES), pH 5.5. Cowpea mesophyll protoplasts are prepared by peeling off the lower epidermis of the primary leaves of 10-day-old Vigna unguiculata, using forceps. Three leaves are floated on a 15 ml enzyme solution (0.1% cellulase, 0.05% pectinase, 10 mM CaC12, and 0.5 M mannitol, pH 5.5) for 3.5 hr at room temperature with gentle shaking. Cells are washed twice by adding 2 ml solution containing 10 mM CaC12 and 0.5 M mannitol followed by centrifugation for 5 min at 600 rpm.

TABLE II MOLECULAR BRIGHTNESS OF CFP AND YFP a

Molecular brightness r/(kHz/molecule) CFP Detector

Dye

)~exc 458 nm

CFP YFP

YFP Detector

~-exc 514 nm

;%xc 458 nm

)~exc 514 nm

5.8

0.0

0.0

0.0

1.9 0.3

0.1 4.9

Measured in BY2 cytoplasm (intensity) after background correction.

100

BIOPHOTONICS

[5]

Fluorescent Proteins

Studying molecules with FCS requires that the molecule of interest is fluorescent, but since most natural molecules show only weak autofluorescence, labeling with an external fluorophore is essential. In the case of living cells it is in principle possible to introduce a labeled molecule into the cell, e.g., via uptake of esterasecleavable dyes, pH-shock methods, electroporation, or microinjection. However, plant cell walls form a large physical barrier for most techniques resulting in a low efficiency of uptake. Therefore, in the case of cellular protein studies, it is far more attractive to add fluorescent tags by genetic approaches. Intrinsic fluorescent proteins (FPs) such as GFP (green fluorescent protein), 36'37 identified in jellyfish Aequorea victoria, are especially suitable for this purpose since they can be relatively easily fused to the gene of interest. At present GFP or color variants, like the cyan (CFP) or yellow (YFP) fluorescent proteins, are most often used to fluorescently tag proteins. The sequence of the GFP gene of A. victoria has been optimized for plant codon usage and in this way a cryptic splice site has been eliminated. 38 However, in the experiments described here this sequence has not been used. Advantages of the FPs are the high brightness values, a well-protected chromophore that is relatively insensitive to environmental changes, and the fact that FPs do not tend to stick to intracellular structures as some chemical dyes do. However, in recent years it has been shown that for enhanced GFP and YFP additional correlating processes occur that are superimposed on the diffusional fluctuation in the correlation c u r v e . 7'8'39 Due to a photophysical effect called "blinking," or a chemical effect such as protonation of the chromophoric group at low pH (pKa5.8), a large fraction of fluorophores can exist in a "dark" state. CFP-YFP is a widely used pair of dyes to study the colocalization of different proteins or to monitor molecular interactions, making use of fluorescence resonance energy transfer (FRET). 4° FRET, however, requires that both dyes are in close proximity (2-8 nm) of each other. For FCCS this proximity is not required since the technique is not based on physical interaction of the dyes but on the temporal coincidence of both dyes being in the same volume. A disadvantage of the CFP-YFP pair for FCCS is the relatively high cross-talk of the CFP emission in the YFP detection channel. Correction for this effect of the correlation curve of CFP fluorescence in the YFP channel is therefore required. Because FCS correlates the relative fluorescence fluctuations, an upper limit for observing a measurable correlation curve exists where the intensity fluctuations are 36 R. Y. Tsien, Annu. Rev. Biochem. 67, 509 (1998). 37 p. M. Conn, ed., Methods EnzymoL 302 (1998). 38 j. Haselhoff, K. R. Siemering, D. C. Prasher, and S. Hodge, Proc. Natl. Acad. Sci. U.S.A. 94, 2122 (1997). 39 p. Schwille, S. Kummer, A. A. Heikal, W. E. Moemer, and W. W. Webb, Proc. Natl. Acad. Sci. U.S.A. 97, 151 (2000). 40 T. W. J. Gadella, G. N. M. van der Krogt, and T. Bisseling, Trends Plant Sci. 4, 287 (1999).

[5]

FCS OF GFP FUSION PROTEINSIN PLANTCELLS

101

too small as compared to the average intensity [Eq. (1)]. In the setup used here the concentration of fluorescent molecules should not exceed 5/zM corresponding to 800 molecules in the confocal volume element. Therefore, cells should be selected that have only a moderate FP expression level. Because all constructs in our studies were transcribed using the strong 35S-promoter, measurements were performed at 8-12 hr after transfection. Longer incubation times resulted in too high levels of fluorescent protein. An alternative possibility to control the level of expressed protein is the use of inducible promoters such as tetracycline or ethanol promoters. Constructs

The open reading frame of enhanced CFP and YFP cDNA is amplified by the polymerase chain reaction (PCR) from the full-length cDNA and cloned into the pTYB 11 vector (New England Biolabs, Beverly, MA) using the following primers: FPfor (5' GGTGGTTGCTCTTCCAACATGGTGAGCAAGGGCG 3') and FPrev (5' GGTGGTGGATTCTTACTTGTACAGCTCG 3'). The pTYB 11-FP constructs are transformed via heatshock into BL21 DE3 Escherichia coli bacteria strain for high expression levels. The expression is induced after 3 hr of incubation at 37 ° by adding 0.3 mM isopropylthiogalactoside (IPTG). The bacteria were grown overnight at 20 ° to obtain soluble protein for microinjection. The AtSERK1 construct was amplified by PCR from AtSERKI full-length cDNA (accession no: A67827) and cloned downstream of the 35S promoter into the N c o I site of PMON999-YFP 41 using primers N c o I 2 1 5 f (5' CATGCCATG GTGGAGTCGAGTTATGTGG 3') and N c o i 2 0 6 8 (5' CATGCCATGGACCTTG GACCAGATAACTC 3'). 42 For targeting purposes, a 87-bp fragment (5' ATGTTGTCACTACGTCAATC TATAAGATTTTTCAAGCCAGCCACAAGAACTT'FGTGTAGCTCTAGATATC TGCTTCAGCAAAAACCC 3') encoding for the coxIV mitochondrial targeting sequence from yeast43 is cloned downstream of the 35S promoter of either into the N c o I site of either PMON999-CFP, 41 PMON999YFP or PMON999CFP-(AIa)2~YFP plasmid. All constructs are checked by sequence analysis. Transfection

Ten micrograms purified plasmid in 30 #1 water is added to 0.5-1 × 106 protoplasts in 75-150/zl solution of 0.6 M mannitol, 10 mM CaCI2, pH 5.5. After gentle mixing 3 ml solution containing 40% (w/v) polyethylene glycol (PEG) 6000, 0.6 M mannitol, 0.1 M Ca(NO3)2 is added. The protoplast suspension is incubated for 10 sec under gentle shaking followed by addition of 4.5 ml washing 41 H. van Bokhoven,J. Verver,J. Wellink, and A. van Kammen,J. Gen. Virol. 74, 2233 (1993). 42K. Shah, T. W. J. Gadella, H. Van Erp, V. Hecht, and S. C. De Vries, J. Mol. Biol. 309, 641 (2001). 43R. n. K6hler, W. R. Zipfel, W. W. Webb,and M. R. Hanson,PlantJ. 11,625 (1997).

102

BIOPHOTONICS

[5]

solution consisting of 0.5 M mannitol, 15 mM MgClz, and 0.1% MES, pH 5.5, to stop the transfection. After incubation at room temperature for 20 min the cells are washed three times and incubated for 24 hr in petri dishes at room temperature under constant illumination.

Purification of FPs Fluorescent protein was purified using the IMPACT (New England Biolabs) system, which utilizes the inducible self-cleavage activity of an intein splicing element to separate the target protein from the affinity tag. Transformed bacteria are collected by centrifugation and resuspended in 50 mM Tris, pH 8.0, 120 mM KC1, 1 mM EDTA. Cells are lysed by passage through a French pressure cell. Soluble protein is obtained after centrifugation at 20,000g for 30 rain at 4 °. The fusion protein is purified by using an affinity column matrix of chitin beads. The fusion protein binds to the chitin and after extensive wash the FPs are eluted from the column by incubating the beads overnight in 50 mM dithiothreitol (DTr). Protein purity is checked on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Dye Depletion and Cellular Damage Because the subcellular compartments are rather small, dye depletion due to photobleaching can be a serious problem. For in vitro systems the photobleached molecules will be replaced by fresh material diffusing from outside the volume element. This is often not possible in living cells due to compartmentalization of fluorescent molecules and therefore the limited number present. Photobleaching of the dye gives rise to artifacts in the correlation curves. Because the dye will be bleached during its passage through the detection volume, the apparent diffusion time becomes too small. This problem is clearly present when slowly moving molecules, due to their large size or diffusion restrictions, are being monitored. The prolonged residence time in the excitation volume will result in a higher chance of being photobleached. Comparison of the photostability of the FPs showed that YFP is more sensitive to photobleaching than the others. 42 When YFP is fused to membrane proteins the slower diffusion rates increase the chance to photobleach it further, so that very low laser intensities (< 1.0 kW cm -2) should be applied. Figure 2 shows the fluorescence intensity and correlation curves for YFP present in the cytoplasm of BY2 cells when excited with various laser intensities. At 20 and l0 kW cm -2 a significant decrease of the fluorescence intensity is present, resulting in an autocorrelation curve with a fast decay time due to the shortening of the diffusion time induced by photobleaching and faster flickering. 39 When sequential measurements are performed, an increase of the correlation amplitude and thus a decrease in number of fluorescent molecules is observed. Below 5.0 kW cm -2 no photobleaching is observed. However, for YFP fused to a transmembrane protein (AtSERK1) a significant photobleaching is already observed at intensities higher than 2.2 kW cm -2 due to the slow diffusion of the protein.

A 40 v

t"C

20 C

0

u_ 0

0

30 Time (s)

60

B "r" v. v

m

.i.,a

10

...............

•

•

•

. . . . .

..1.-,

¢-

A

•

•

.w

O C ¢.3

09

1

......... /

...........

I.t.

0.3

1

10

100

P o w e r ( k W cm -2) C ¢-

®9

20 k W . c m -2 ,5 k W . c m -2 .1 k W . c m -2

O

N

t~.'-

Eo o.9 Z

0.01

1 T a u (ms)

100

FIG. 2. (A) Photobleaching traces, (B) laser power dependency plot (after a prebleach pulse of 20 sec), and (C) autocorrelation curves (after a prebleach pulse of 20 sec) of YFP localized in the cytoplasm (squares) and AtSERK1-YFP in the cell membrane (triangles) of BY2 cells, excited with various laser powers at 514 nm.

104

BIOPHOTONICS

[5]

To check the cellular damage induced by laser light, individual cells are exposed to various laser intensities at either 458 or 488 nm and recultured for 8 hr, after which the cells are visually inspected and counted to check the growth rate. Below a laser intensity of 50 kW cm -2 no effect is seen, but at 75 and 100 kW cm -2 the growth rate is reduced about 15% and some misshapen cells are present. However, at the moderate light intensities used in the studies here no damaging effect is expected.

Signal-to-Noise Ratios FCS measurements in living cells will in general suffer from significantly lower signal-to-noise (S/N) ratios as compared to in vitro measurements. The presence of dense structures within the cell can lead to scattering of both excitation and emission light. Considering all the effects discussed in previous sections it is clear that the signal may be enhanced by increasing the intensity of the excitation source but not at an unlimited high level. The optimal setting will therefore be a compromise between high molecular brightness of the dye and a minimized contribution of effects such as photobleaching, cellular damage, and autofluorescence. Improvement of the S/N ratio can also be achieved by increasing the measurement time (Tm), since S/N improves with the square root of Tin. However, at measurements times above 1 min, special attention should be paid to movement of intracellular structures or even the complete plant cell, which may cause additional fluctuations in the correlation curve. F l u o r e s c e n t P r o t e i n s i n P l a n t Cells

Microscope The fluorescence correlation spectroscopic measurements are carried out with a Zeiss microscope system based on an inverted Axiovert microscope equipped with a baseport LSM510 module for collecting confocal laser scanning images and a sideport ConfoCor-2 module to perform fluorescence correlation spectroscopy measurements (Fig. 3). The system contains three laser modules providing excitation light at 458,488, 514, 543, and 633 nm. In our study CFP is excited at 458 nm and YFP at 514 nm. The excitation light is focused into the sample by a 40x water immersible Apochromat objective lens NA 1.2 (Zeiss). Samples are stored in (borosilicate) glass-bottomed 96-well plates (Whatman, Clifton, NJ) at room temperature. Fluorescence passes through the main dichroic filter, which reflects both 458 and 514 nm excitation light, and a secondary dichroic filter, LP510, to separate the emission in the two different detection channels. Fluorescent light is split by two emission filters (BP470-500 for CFP and BP527-562 for YFP, respectively) and is directed through size-adjustable pinholes (internal diameter 25/zm), which is placed near the image plane, and is fiber coupled to an avalanche photodiode.

[5]

FCS OF G F P FUSION PROTEINS IN PLANT CELLS .............................. i

105

i

.Ar. .+. .Laser .........

I i

APD2

APD 1

~ " ~-~-~rE j

!

APD Unit

~ H e N e L~as;r 633-nm L. . . . . . . . . . . . . . . . . . . . ;!

F/Single modefibre

Laser Unit

Opticalfibres Pinhole Emission

filter\\\

t

Collimator

......

~J

]

\

!!

r.........

i

II'V

i

i

2/! opt~

\

,

~

I ............

PH1I~

\

[ ] ConfoCor 2 FCS Detection Unit

i

Tube lens I

" Secondary beam splitter ~

i v i

[]

,iov.. too. !

Main beamsplitter

FIG. 3. Schematic overview of the experimental setup for FCCS measurements of CFP and YFP fusion proteins. The fluorescence from the confocal detection volume element is detected via fibercoupled photodiodes in the ConfoCor2-module.An additional option in this setup is to collect confocal images making use of the LSM510 scanning detection module, coupled to the base of the Axiovert microscope (not shown).

The microscope is equipped with a mercury lamp and a back-illuminated TEK 512 x 512D CCD camera (Princeton, Roper Scientific B.V., The Netherlands) to collect wide-field fluorescence images of cells expressing small amounts of FPs. A microinjection holder is attached to the side of the microscope.

Microinjection Purified protein is dissolved in 50 m M phosphate-buffered saline (PBS) pH 7.2 to a final concentration of 1 # M and centrifuged at 80,000 rpm for 10 rain at 4 c to remove possible aggregates. Femtotips (Eppendorf) with an opening diameter of 0.5 4- 0.2 # m are loaded with approximately 10 #1 fluorescent protein solution using Microloader tips (Eppendorf). The cells are injected under visual control

106

BIOPHOTONICS

[5]

using an Eppendorf microinjector 5242 and micromanipulator 5170 to control injection parameters (P1 = 4000 hPa, Pinj = 100 hPa, Pbaekpressu~e= 60 hPa, and tinjec~on = 0.2 sec). After injection FCS measurements are repeated twice at intervals of 5 min to check for leakage of the cell. Microinjection in plant cells requires specialized skills and the percentage of successful injections without collapsing the cell, caused by the high internal pressure (turgor), is in our studies ca. 50% for BY2 suspension cells and only 8% for cowpea protoplasts.

Spectral Imaging Spectral images are acquired using a Leica DMR epifluorescence microscope equipped with a 250IS imaging spectrograph (Chromex) coupled to a backilluminated 512 x 512 CH250 CCD camera (Photometrics). The sample is excited by a mercury lamp coupled to an excitation filter wheel containing a 435DF10 excitation filter. Fluorescent light is collected by the 20x Plan Neofluor objective lens, N.A. 0.5 (Leica), and passed through a 430DLCP dichroic filter (Omega) and a LP455 emission filter (Schott). Spectral images are collected during 2 sec using a 150 groove/mm grating set at a central wavelength of 500 nm and a slit entrance width of 200/zm, corresponding to 10/zm in the object plane.

Measurement Protocol By visual inspection those cells are selected in which the amount of fluorescent protein is just sufficient to be seen by confocal imaging. At lower expression levels wide-field images could be collected by integrating the fluorescence intensity over 30 sec, using the CCD camera. High levels of FPs (above approximately 5 #M) resulted in the presence of too many particles in the volume element and thus a too low correlation amplitude for reliable analysis. Spots of interest were marked in the displayed confocal image by mouse after which the x-, y-, and z-coordinates of the spots are passed to the scanning table so that experiments with the stationary laser beam of the ConfoCor2 could be performed. The laser power was set at 2.5 kW cm -2 for the 458 nm laser line and 3.1 kW cm -2 for the 514 nm laser line to prevent photobleaching, cellular damage, and photophysical effects but still sufficient to achieve good S/N ratios. In case of FCCS experiments, the cross-talk of CFP fluorescence in the YFP channel also has to be considered. Typical measurement times are 40-90 sec. Fitting parameters were averaged over 15-30 different FCS curves, each obtained in another plant cell.

Data Analysis FCS The obtained intensity traces are correlated by the software correlator, integrated in the Zeiss AIM software (Zeiss, EMBL Heidelberg). Curves are fitted in a home-developed software package that allows global fitting with several types of fitting models, using Marquardt least-squares fitting algorithms. The quality of the

[5]

FCS OF GFP FUSION PROTEINSIN PLANTCELLS

107

fitting is checked using the minimal value of X2 and by visual inspection of fitted and experimental traces and the residuals. Auto- and cross-correlation curves are corrected for uncorrelated background and triplet-state dynamics according to

G(r) = Go

1

/background/total

1 + I'~T

)

(6)

with FT the fraction of molecules in the triplet state and rT the triplet relaxation time. The axial and equatorial axis of the detection volume element are determined by fitting the calibration measurements with rhodamine 6G (D = 2.8 × 10-1°m 2 s -1) with Eq. (2). In the analysis of other data sets, these parameters are fixed. In our studies the contribution of a correlating background species could be neglected, but correction for the noncorrelating background, according to Eq. (2), is necessary, especially in the case of cowpea protoplasts (see section on autofluorescence). Figure 4 gives an example of an FCS experiment of YFP microinjected into a cowpea protoplast. YFP is homogeneously distributed throughout the cytoplasm and nucleus but is not present in the vacuole, chloroplast, and other plastids (Fig. 4A). The detection volume is positioned in the cytoplasm, where an intensity scan along the optical (z axis) confirmed the correct positioning of the volume element along the z axis (Fig. 4B). The obtained correlation curves are analyzed according to Eq. (6) yielding information about the local YFP concentration and the diffusion rate. The translational diffusion constant of 4.1 + 2.1 × 10-II m 2 s-l(n = 20) is about half the value obtained in buffer (D = 9.0 + 0.6 × l0 -it m e s- 1), which can be explained by the higher viscosity inside the cell. No differences are found between CFP and YFP or between the two cell types used. Figure 5A displays the localization of mitochondrial-targeted CFP expressed in BY2 protoplasts. Small oval-shaped structures with a diameter of ca. 2/zm can be observed in the confocal image. Colocalization with Mitotracker Red (Molecular Probes, Eugene, OR), a mitochondrial specific dye, confirmed the proper targeting of CFP to the mitochondria, as has been shown before by KOhler et al.43 The correlation curves are acquired at several locations within the cell (Fig. 5B) and analyzed with several models since the 3D triplet model [Eq. (6)] could not accurately fit the experimental data (Fig. 5C). Due to the limited spatial resolution of confocal imaging it is not clear where in the mitochondria the dye is located. K6hler et al. 34 studied the diffusional characteristics of GFP in BY2 plastid tubules. Their experiments showed that besides the normal 3D diffusion, GFP is transported actively through the tubule. Fitting our results to models including active transport or 2D diffusion (in case of protein diffusion in a planar environment such as a membrane) did not give satisfying results. However, including the condition that the diffusion may not be Brownian, but is restricted due to interactions of the protein with other particles, resulted in acceptable fits (Fig. 5C). The model for fitting correlation

108

BIOPHOTONICS

[ 51

A ;! ¸

%

10 ,um B~"

,,°

2

"

0 ' 30 60 Fluorescence intensity (kHz)

~

I

0.01

i

i

I

1 Tau (ms)

100

FIG. 4. ECS experiment of YFP microinjected into cowpea protoplasts. After localization of the protein with (A) confocal imaging and (B) intensity profiles along the optical axis, an FCS measurement was performed at the selected spot (cross on A) in the cytoplasm for 20 sec. (C) The experimental curve was fitted according to Eq. (6).

curves for anomalous diffusion32,44 is similar to Eq. (2) with a slightly altered description of Diffi:

Diff/'An =

1 -k

(z/ri) ~ ~1 "~ ~ ( T E / T i ) °t

in which ot is the coefficient that indicates the degree of restriction. A restriction coefficient of ot = 1 indicates normal Brownian motion but the smaller ot will be, the more restricted the diffusion behavior is. Here a restriction coefficient of 0.51 -4- 0.12 (n = 30) and a diffusion constant of 3.8 -4- 2.1 x 10 -13 m 2 s -1 is found. Because the diffusion is more than 200 times slower than CFP in the 44 p. Schwille, J. Korlach, and W. W. Webb, Cytometry36, 176 (1999).

[5]

F C S OF G F P FUSION PROTEINS IN PLANT CELLS

109

A

B

Location

g 1 0[~--

,

I~ ,I ___~/~,. t]~1~. <

0

0.01

N (n=20)

buffer 1.3 _+0.4 cytoplasm 0.5 + 0.2 mitochondria 32 + 6 nucleus 0.2 + 0.2 I vacuole 0.3 +0.1 1 Tau (ms)

100

C = 3.0

O

t~

3D Brownian 3D Anomalous

0 0 0

< 1.0

0.01

1 Tau (ms)

100

FIG. 5. FCS experiments of mitochondrial-targeted CFP, expressed in cowpea protoplasts. After localization of the protein with (A) confocal imaging, (B) FCS measurements of 60 sec were performed at the selected spots (crosses on A) at several subcellular locations, b, Buffer; c, cytoplasm; m, mitochondrium; n, nucleus; v, vacuole. Analysis of the corrected correlation curves confirmed that the protein was present only within the mitochondria. (C) The experimental curves acquired in the mitochondria were fitted (smooth curves) to several models including a 3D diffusion-triplet model and a 3D anomalous diffusion model. c y t o p l a s m and ot is very small, it is likely that C F P is localized in an e n v i r o n m e n t where diffusion is severely restricted, w h i c h can be explained by the high protein density in the m i t o c h o n d r i a l matrix.

Data Analysis FCCS For a correct analysis o f F C C S experiments with the c h i m e r i c protein C F P ( A l a h s - Y F P (CAY), control m e a s u r e m e n t s are p e r f o r m e d in cells expressing C F P

110

[5]

BIOPHOTONICS

or YFP only. The molecular brightness values obtained (Table II) are used to correct for the cross-talk of the CFP in the YFP detection channel. In this experimental system, having covalently linked dyes, only one green and one red dye molecule is present per protein molecule. However, when a complex is studied in which more than one green or red dye is present, a correction factor should be included as has been described by Frldes-Papp e t al. 21 This correction can also take into account effects such as homoquenching or donor quenching of the fluorescence caused by FRET. Spectral imaging of CAY does not result in an enhanced YFP/CFP emission ratio compared to control experiments and therefore FRET between CFP and YFP does not take place in CAY, as can be expected with a long linker of 25 alanine residues between the two FPs. The localization of CAY, transfected into BY2 protoplasts, is similar to the pattern observed in cells transfected with CFP or YFP only. The cross-correlation curves are fitted according to a one-component 3D diffusion-triplet model [Eq. (6)]. The diffusion constant of CAY in the cytoplasm, 3.7 + 1.8 x 10 -11 m 2 s-l(n = 30), corresponds to the value obtained for CFP or YFP alone. As discussed above, this similarity can be explained by the relative insensitivity of FCS to small mass differences. To determine the number of CAY proteins (NcAY) the cross-correlation curve is fitted to [ GD,~o,.(0)= 1 +

NCAY+

1 /Trgg GD,CP.(0)--I](-ff-~-~)}/

1]

1]]

(8)

where GD,CFP(0) and GD,YFP(0) are the amplitudes of the autocorrelation curves for the CFP and YFP channels, respectively, The number of CAY proteins equals the number of molecules found in the CFP channel and (corrected) YFP channel, indicating that all the CFP and YFP molecules are present in the doubly labeled fusion protein and no free CFP or YFP is present. Cells cotransfected with both CFP and YFP result in identical expression pattems as found for CAY (Fig. 6). When the cross-correlation curve is corrected for CFP cross-talk, no doubly labeled molecules could be found. This experiment shows that although a high amount of colocalized dyes is present, it does not automatically mean that molecular interactions are taking place, at least not on a time scale detectable by our setup (50 ns-10 hr).

Conclusions The work presented here results from an ongoing effort from our and other laboratories to optimize fluorescence-based techniques such as FCS and FCCS for studying molecular dynamics and interactions in living (plant) cells. To date our

[5]

FCS OF GFP FUSIONPROTEINSIN PLANTCELLS

.m .i..a

l 11

1.4

t~ o ¢.9 o "1

<

1.0 0.1

10

Tau (ms) FIG. 6. FCCS experiment of a CFP-YFP fused protein, expressed in BY2 protoplasts. A 90-sec measurement was performed in the cytoplasm. Cross-correlation curves for a cell cotransfected with both CFP and YFP and for a cell transfected with the CFP-(Ala)25-YFP construct. The correlation curves were fitted (smooth curves) according to Eq. (6), taking into account the cross-talk of the CFP fluorescence into the YFP detection channel. Fractions of interacting molecules were estimated using

Eq. (5). efforts have been centered on the application of fluorescent proteins, widely used to label the protein of interest by genetic engineering. Although the CFP-YFP pair used in these experiments is not an ideal couple for FCCS experiments, the potential of FCS to monitor interactions between biomolecules at physiological relevant concentrations has been demonstrated. However, to further develop this technique many aspects are subject to improvement. One example is the development of better dyes that have sharper, well-separated absorbance and emission spectra, are more photostable, and preferably are small in size. 45 Also much progress has been made in the field of data analysis, where single molecule approaches are integrated in the analysis to extract more information from the collected data, such as molecular brightness, fluorescence lifetime, a n d anisotropy.46-49 Theoreticians are currently working to derive more complex equations required to describe the complicated environmental properties and dynamic processes occurring within the living cell. The ultimate goal in plant science would be to monitor molecular dynamics not only in single living cells but in whole plants. Scattering of the light, however, drastically reduces the signal-to-noise ratio in experiments using a setup as described here. However, Schwille et al. 29 showed that the use of a 45 B. A. Griffin, S. R. Adams, and R. Y. Tsien, Science 281, 269 (1998). 46 y. Chen, J. D. Muller, P. T. C. So, and E. Gratton, Biophys. J. 77, 553 (1999). 47 K. Pal[o, U. Mets, S. J~ger, P. Kask, and K. Gall, Biophys. J. 79, 2858 (2000). 48 j. Schaffer, A. Volkmer, C. Eggeling, V. Subramaniam, G. Striker, and C. A. M. Seidel, J. Phys. Chem. A 103, 331 (1999). 49j. R. Fries, L. Brand, C. Eggeling, M. KOllner, and C. A. M. Seidel, J. Phys. Chem. A 102, 6601 (1998).

112

BIOPHOTONICS

[61

two-photon excitation source could significantlyreduce the scattering and therefore improve the signal quality sufficiently to enable FCS measurements in whole plants. Acknowledgments This work has been supported by grants from the Netherlands Council of Earth and Life Sciences (ALW-NWO), the Technology Foundation (STW-NWO), and the Mibiton Foundation. Dr. K. Shah, Department of Neurobiology, Harvard Medical School, is gratefully acknowledged for supplying the AtSERK1 construct.

[61 Building and Using Optical Traps to Study Properties of Molecular Motors B y S A R A H E. RICE, THOMAS J. PURCELL, a n d JAMES A . SPUDICH

Introduction

In the study of molecular motors, the experiments that are the most direct are also the most telling. The velocity, stall force, step size, and processive run length of molecular motors have all been determined using in vitro motility assays, both at the multiple and single molecule level. Optical trapping experiments in particular are used to gain information on stall forces, step sizes, and kinetics of a variety of molecular motors, such as kinesins, 1'2 myosins,3-6 and processive DNA enzymes7 (reviewed in Ref. 8). This information places constraints on models for the mechanisms of these molecular motors, and ultimately has led to a vastly increased understanding of how they work. The barrier for most laboratories to optical trapping has generally been the high cost and difficulty of building, maintaining, and using the devices. However, 1 K. Svoboda, C. E Schmidt, B. J. Schnapp, and S. M. Block, Nature 365, 721 (1993). 2 K. Visscher, M. J. Schnitzer, and S. M. Block, Nature 400, 184 (1999). 3 j. T. Finer, R. M. Simmons, and J. A. Spudich, Nature 368, 113 (1994). 4 A. D. Mehta, R. S. Rock, M. Rief, J. A. Spudich, M. S. Mooseker, and R. E. Cheney, Nature 400, 590 (1999). 5 M. Rief, R. S. Rock, A. D. Mehta, M. S. Mooseker, R. E. Cheney, and J. A. Spudich, Proc. Natl. Acad. Sci. U.S.A. 97, 9482 (2000). 6 R. S. Rock, S. E. Rice, A. L. Wells, T. J. Purcell, J. A. Spudich, and H. L. Sweeney, Proc. Natl. Acad. Sci. U.S.A. 98, 13655 (2001). 7 M. D. Wang, M. J. Schnitzer, H. Yin, R. Landick, J. Gelles, and S. M. Block, Science 282, 902 (1998). s A. D. Mehta and J. A. Spudich, Adv. Struct. Biol. 5, 229 (1999).

METHODSIN ENZYMOLOGY,VOL.361

Copyright2003.ElsevierScience(USA). All rightsreserved. 0076-6879/03$35.00