- Email: [email protected]
5-HT2A receptor gene polymorphisms, anorexia nervosa, and obesity
THE LANCET
confidence limit is about 1·4. The revised data are still thus compatible with the association with conceptus loss in the study by Czeizel et al,4 and with an effect considerably above that. Apparently small associations with conceptus loss (even closer to unity than 1·06) are compatible with unexpectedly large effects on recognised defect, depending on malformation proportion in unevaluated conceptus loss. This was a main point of the analysis by Czeizel and me (see also ref 5 and references therein). In view of the discrepancies in data between Wald 3 and Wald and Hackshaw,2 it is not clear what the MRC study found in respect of conceptus loss. Only re-examination of the raw data will resolve this, but whatever the outcome of such an exercise it appears unlikely to be able to exclude a terathansia effect. Ernest B Hook *School of Public Health, University of California, Berkeley, CA 94720-7360, USA; and Department of Pediatrics, University of California, San Francisco 1
2
3
4
5
Hook EB, Czeizel AE. Can terathanasia explain the protective effect of folic-acid supplementation upon birth defects? Lancet 1997; 350: 513–15. Wald N, Hackshaw A. Folic acid and prevention of neural tube defects. Lancet 1997; 350: 665. Wald N. Maternal nutrition and pregnancy outcome. Ann NY Acad Sci 1993; 678: 112–29. Czeizel AE, Dudas I, Metneki J. Pregnancy outcomes in a randomized controlled trial of periconceptual multivitamin supplementation: final report. Arch Gynecol Obstet 1994: 255: 131–39. Hook EB, Regal R. Representative and misrepresentative associations of birth defects in live births. Amer J Epidemiol 1993; 137: 660–75.
Persistent vegetative state SIR—Adam Zeman (Sept 13, p 795)1 is to be congratulated on his excellent discussion of the concept of persistent vegetative state (PVS). As he points out, this concept is based on a particular model of consciousness and wakefulness that has certain shortcomings. The shortcomings are well illustrated by two consecutive sentences in his conclusion: “Consciousness [or awareness], in all its aspects, is a matter of degree”, and “The vegetative state [is] a condition of wakefulness without awareness”. The first correctly identifies awareness as a continuum rather than a quality that is either present or absent. The second should therefore define PVS as a state of wakefulness without a set amount of awareness. This definition makes the concept less superficially attractive (and begs the question how awareness is measured and how much is allowed in
1324
PVS), but I suspect that doctors would make fewer diagnostic errors if such a definition was used.
security as a label on which they can depend? Jack Colover
T C Britton King’s College Hospital, London SE5 9RS, UK
56 Eyre Court, Finchley Road, London NW8 9TU, UK
1
1
Zeman A. Persistent vegetative state. Lancet 1997; 350: 795–99.
2
SIR—I read Adam Zeman’s seminar1 on persistent vegetative state (PVS) with some misgivings and even disquiet. PVS is a clinical disorder with no single recognisable pathology that makes diagnosis certain. Similarly, the clinical features, are by no means established with any degree of certainty. At present PVS is a variable collection of symptoms, mainly of social and legal interest, of uncertain prognosis. The label PVS is emotive and should not be used in a medical diagnosis of patients under medical supervision and nursing care. Persistent is a vague term that implies a nuisance that will not go away. Surely the word chronic is more appropriate and less emotive. The word vegetative, although not defined as such in the dictionary, is derogatory and suggests a vegetable rather than a human being with a severe medical condition. Different degrees of coma and unconsciousness can be defined, but how can this be done with consciousness? In a post-traumatic state, with no means of communication with the patient not even the most skilful and experienced observer can assess the state of awareness. There may, in fact, be moments of awareness alternating with periods of unawareness. This state could only be ascertained subsequently in the absence of Korsakow’s psychosis. Since the brain contains 911 or 1011 neurons, some are inhibitory, and there is also two-way control of synapses by post-synaptic neurons.2 Simple diagrams of the brain with directive lines and arrows drawn over them have no real meaning. Serious consideration must be given to the possibility that after head injury many neurons have structural damage to somatic components not revealed in any detail by currently available techniques. Since the most frequent cause of PVS is head injury, any theory must also explain the effects of mild head injury, such as concussion, which is still a mystery, but is a common neurological condition. I have known patients apparently unaware of their surroundings, who when a comb was put into their hands began to comb their hair, or others who began to smoke when a lighted cigarette was put between their fingers, much to the amazement of their attendants. Would it not be better to abandon the diagnosis of PVS, which is so unreliable medically but gives lawyers a false sense of
Zeman A. Persistent vegetative state. Lancet 1997; 350: 795–99. Fitzsimonds RM, Song H-J, Poo M-M. Propogation of activity-dependent synaptic depression in simple neural networks. Nature 1997; 338: 439–43.
5-HT2A receptor gene polymorphisms, anorexia nervosa, and obesity Sir—David Collier and colleagues (Aug 9, p 412)1 report an association between a polymorphism (⫺1438G/A) in the promoter region of the 5-HT2A gene and anorexia nervosa. Such investigations are warranted because the serotonergic system is probably involved in the aetiology of anorexia nervosa and in weight regulation in general. We investigated the role of polymorphisms in genes of the serotonergic system in patients with anorexia nervosa and in obese and healthy underweight individuals. We found no evidence for an association or for transmission disequilibrium of an allele of the serotonin transporter gene linked polymorphic region to extreme obesity, underweight, or anorexia nervosa.2 In addition, an involvement of the Cys-23-Ser polymorphism of the 5-HT 2C receptor gene in weight regulation was not detected.3 We did association studies of anorexia nervosa and the promotor polymorphism ⫺1438A/G and two other polymorphisms in the coding region of the 5-HT2A receptor gene leading to aminoacid substitutions (Thr25Asn; His452Tyr).4 100 patients with anorexia nervosa (according to DSM-IV criteria), 254 severely obese children and adolescents, and 101 underweight students in whom lifetime occurrence of anorexia nervosa had been excluded,3 were genotyped. All the study groups have been described previously.2,3 All participants or their parents gave their informed written consent. The investigation was approved by the ethics committee of the University of Marburg. We used single-strand conformation analysis to detect the promoter polymorphism (M M Nöthen and colleagues, unpublished observations). The promoter polymorphism was analysed by PCR (primers: 5'ACTGCGAAACCAACTTATTTCC3' and 5'-TGCAGATTCCCATTAAGG-3') with subsequent restriction
Vol 350 • November 1, 1997
THE LANCET
Study group
Allele frequency (%) ⫺1438 A/G polymorphism
Anorexia nervosa (n=100) Underweight (n=101) Obese (n=254)
Thr25Asn polymorphism
His452Tyr polymorphism
A
G
Thr
Asn
His
Tyr
79 (0·40) 86 (0·43) 215 (0·42)
121 (0·60) 116 (0·57) 293 (0·58)
198 (0·99) 197 (0·98) 491 (0·97)
2 (0·01) 5 (0·02) 17 (0·03)
182 (0·91) 185 (0·92) 445 (0·88)
18 (0·09) 17 (0·08) 63 (0·12)
Allele frequencies of three 5-HT2A receptor gene polymorphisms in patients with anorexia nervosa, and in healthy underweight and obese individuals
fragment length polymorphism analysis (PCR-RFLP) with Hpa II, which cuts the ⫺1438G allele product into two fragments. The other polymorphisms were analysed by PCR-RFLPs.4 Allele frequencies (table) and genotype frequencies (data not shown) were similar between the three study groups for each of the polymorphisms (all nominal p values >0·14). A separate analysis based on the inclusion of women alone revealed similar results (data not shown). The power of the continuity corrected onesided 2-test was 63% and 77% for individuals with anorexia nervosa versus underweight and obese individuals, respectively, at the 5% test level with the allele frequencies for the ⫺1438A/G polymorphism as estimated by Collier and colleagues. 1 To circumvent possible stratification effects we also tested for transmission disequilibrium5 of the ⫺1438G allele in 57 trios consisting of patients with anorexia nervosa and both parents and 103 trios with obese probands and their parents; nominal p values were 0·16 and 0·33, respectively. Allele and genotype frequencies were similar in our three study groups. The ⫺1438A allele was less frequent in our group of patients with anorexia nervosa than in the patients with anorexia nervosa reported by Collier (40% vs 51%). The frequency of the ⫺1438A allele in our anorexia nervosa patients was similar to that of the control group in Collier’s study (41%). We found no evidence for transmission disequilibrium of the ⫺1438A/G polymorphism for anorexia nervosa or obesity. Possible explanations for the discrepant results are false-positive and false-negative results, stratification effects, and genetic heterogeneity. We thank G Lehmkuhl, F Poustka, M H Schmidt, H Mayer, and W Siegfried for their contribution, and H Herrmann and K Rosenkranz for their technical assistance. This study was supported by the Deutsche Forschungsgemeinschaft.
*Anke Hinney, Andreas Ziegler, Markus M Nöthen, Helmut Remschmidt, Johannes Hebebrand *Departments of Child and Adolescent Psychiatry, and Institute of Medical Biometry and Epidemiology, University of Marburg, 35033 Marburg, Germany; and Institute of Human Genetics, University of Bonn, Bonn
Vol 350 • November 1, 1997
1
2
3
4
5
Collier DA, Arranz MJ, Li T, Mupita D, Brown N, Treasure J. Association between 5-HT2A gene promoter polymorphism and anorexia nervosa. Lancet 1997; 350: 412. Hinney A, Barth N, Ziegler A, et al. Serotonin transporter gene-linked polymorphic region: allele distributions in reltionship to body weight and in anorexia nervosa. Life Sci 1997; 61: 295–303. Lentes KU, Hinney A, Ziegler A, et al. Evaluation of a Cys23Ser mutation within the human 5-HT2C receptor gene: no evidence for an association of the mutant allele with obesity or underweight in children, adolescents and young adults. Life Sci 1997; 61: PL 9–16. Erdmann J, Shimron-Abarbanell D, Rietschel M, et al. Systematic screening for mutations in the human serotonin-2A (5HT2A) receptor gene: identification of two naturally occurring receptor variants and association analysis in schizophrenia. Hum Genet 1996; 97: 614–19. Spielman RS, McGinnis RE, Ewens WJ. Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet 1993; 52: 506–16.
Chronotherapy with 5-fluorouracil, oxaliplatin, and folinic acid in colorectal cancer SIR—Frances Levi and colleagues (Sept 6, p 681)1 report a difference in response rate and toxicity between colon cancer patients treated with infusional 5-fluorouracil, folinic acid, and oxaliplatin given by chronotherapy, compared with patients given a 24-hour constant-rate infusion of these agents. They take these findings to support the hypothesis that the pharmacological effects of certain chemotherapeutic agents are influenced by circadian rhythms, and that their efficacy can be improved and their toxicity diminished by appropriately timing the therapies with respect to these rhythms. The trial design, however, does not seem to directly address this hypothesis. This trial compares a group of patients treated with a variable-rate, 12hour infusion of oxaliplatin followed by a similar 12-hour infusion of 5fluorouracil and folinic acid, with a control group treated with a 24 hour constant-rate infusion of all three drugs. In addition to the difference in the circadian timing of the
chemotherapy, the test and control groups differ substantially with respect to the expected pharmacokinetics produced by the schedules used, as well as in the use of sequential versus concomitant administration of 5fluorouracil and oxaliplatin. Certainly, in the case of 5-fluorouracil, the effects of schedule on toxicity and efficacy are well described.2 For cisplatin combined with fluorouracil, preliminary data suggest that enhancement of cytotoxicity is more pronounced when cells are exposed to high 5-fluorouracil concentrations and when exposure to this drug precedes exposure to cisplatin.3 Concomitant versus sequential exposure to 5-fluorouracil and oxaliplatin may also have different cytotoxic profiles due to differences in peak 5-fluorouracil concentrations as well as the sequencing of the agents. These factors cannot be excluded as causes of the results in this trial. To test the stated hypothesis, the controls should more appropriately have been a group treated with a pharmacokinetically equivalent regimen, given sequentially, but in a different relation to the circadian rhythm. Pharmacokinetic data, as well as in-vitro data describing the effects of concomitant compared with sequential exposure to the agents on their synergism, additivity, or antagonism, would help to provide a basis to evaluate the biological effects of the confounding variables in this trial design. This trial may be interpreted as demonstrating that the sequential 12hour infusion regimen has advantages over the 24-hour continuous infusion regimen. However, because other equally, if not more, biologically and pharmacologically plausible reasons for the observed differences are present and not controlled for, the data do not support any conclusions about biological validity or clinical relevance of the chronotherapy approach in general. This trial design lacks the appropriate controls to address the larger question of the specific role of chronotherapy in achieving that superiority. Victor Sandor National Institutes of Health, National Cancer Institute, Medicine Branch, Bethesda, MD 20892, USA 1
2
3
Levi F, Zidani R, Misset J-L. Randomized multicentre trial of chronotherapy with oxaliplatin, fluorouracil, and folinic acid in metastatic colorectal cancer. Lancet 1997; 350: 681–86. Lokich JJ, Bothe A, Fine N, et al. Phase I study of protracted infusion of 5-fluorouracil. Cancer 1981; 48: 2565–68. Allegrini G, Falcone A, Antonuzzo M, et al. High dose chronomodulated 48 hour infusion 5-fluorouracil (5FU) in
1325
confidence limit is about 1·4. The revised data are still thus compatible with the association with conceptus loss in the study by Czeizel et al,4 and with an effect considerably above that. Apparently small associations with conceptus loss (even closer to unity than 1·06) are compatible with unexpectedly large effects on recognised defect, depending on malformation proportion in unevaluated conceptus loss. This was a main point of the analysis by Czeizel and me (see also ref 5 and references therein). In view of the discrepancies in data between Wald 3 and Wald and Hackshaw,2 it is not clear what the MRC study found in respect of conceptus loss. Only re-examination of the raw data will resolve this, but whatever the outcome of such an exercise it appears unlikely to be able to exclude a terathansia effect. Ernest B Hook *School of Public Health, University of California, Berkeley, CA 94720-7360, USA; and Department of Pediatrics, University of California, San Francisco 1
2
3
4
5
Hook EB, Czeizel AE. Can terathanasia explain the protective effect of folic-acid supplementation upon birth defects? Lancet 1997; 350: 513–15. Wald N, Hackshaw A. Folic acid and prevention of neural tube defects. Lancet 1997; 350: 665. Wald N. Maternal nutrition and pregnancy outcome. Ann NY Acad Sci 1993; 678: 112–29. Czeizel AE, Dudas I, Metneki J. Pregnancy outcomes in a randomized controlled trial of periconceptual multivitamin supplementation: final report. Arch Gynecol Obstet 1994: 255: 131–39. Hook EB, Regal R. Representative and misrepresentative associations of birth defects in live births. Amer J Epidemiol 1993; 137: 660–75.
Persistent vegetative state SIR—Adam Zeman (Sept 13, p 795)1 is to be congratulated on his excellent discussion of the concept of persistent vegetative state (PVS). As he points out, this concept is based on a particular model of consciousness and wakefulness that has certain shortcomings. The shortcomings are well illustrated by two consecutive sentences in his conclusion: “Consciousness [or awareness], in all its aspects, is a matter of degree”, and “The vegetative state [is] a condition of wakefulness without awareness”. The first correctly identifies awareness as a continuum rather than a quality that is either present or absent. The second should therefore define PVS as a state of wakefulness without a set amount of awareness. This definition makes the concept less superficially attractive (and begs the question how awareness is measured and how much is allowed in
1324
PVS), but I suspect that doctors would make fewer diagnostic errors if such a definition was used.
security as a label on which they can depend? Jack Colover
T C Britton King’s College Hospital, London SE5 9RS, UK
56 Eyre Court, Finchley Road, London NW8 9TU, UK
1
1
Zeman A. Persistent vegetative state. Lancet 1997; 350: 795–99.
2
SIR—I read Adam Zeman’s seminar1 on persistent vegetative state (PVS) with some misgivings and even disquiet. PVS is a clinical disorder with no single recognisable pathology that makes diagnosis certain. Similarly, the clinical features, are by no means established with any degree of certainty. At present PVS is a variable collection of symptoms, mainly of social and legal interest, of uncertain prognosis. The label PVS is emotive and should not be used in a medical diagnosis of patients under medical supervision and nursing care. Persistent is a vague term that implies a nuisance that will not go away. Surely the word chronic is more appropriate and less emotive. The word vegetative, although not defined as such in the dictionary, is derogatory and suggests a vegetable rather than a human being with a severe medical condition. Different degrees of coma and unconsciousness can be defined, but how can this be done with consciousness? In a post-traumatic state, with no means of communication with the patient not even the most skilful and experienced observer can assess the state of awareness. There may, in fact, be moments of awareness alternating with periods of unawareness. This state could only be ascertained subsequently in the absence of Korsakow’s psychosis. Since the brain contains 911 or 1011 neurons, some are inhibitory, and there is also two-way control of synapses by post-synaptic neurons.2 Simple diagrams of the brain with directive lines and arrows drawn over them have no real meaning. Serious consideration must be given to the possibility that after head injury many neurons have structural damage to somatic components not revealed in any detail by currently available techniques. Since the most frequent cause of PVS is head injury, any theory must also explain the effects of mild head injury, such as concussion, which is still a mystery, but is a common neurological condition. I have known patients apparently unaware of their surroundings, who when a comb was put into their hands began to comb their hair, or others who began to smoke when a lighted cigarette was put between their fingers, much to the amazement of their attendants. Would it not be better to abandon the diagnosis of PVS, which is so unreliable medically but gives lawyers a false sense of
Zeman A. Persistent vegetative state. Lancet 1997; 350: 795–99. Fitzsimonds RM, Song H-J, Poo M-M. Propogation of activity-dependent synaptic depression in simple neural networks. Nature 1997; 338: 439–43.
5-HT2A receptor gene polymorphisms, anorexia nervosa, and obesity Sir—David Collier and colleagues (Aug 9, p 412)1 report an association between a polymorphism (⫺1438G/A) in the promoter region of the 5-HT2A gene and anorexia nervosa. Such investigations are warranted because the serotonergic system is probably involved in the aetiology of anorexia nervosa and in weight regulation in general. We investigated the role of polymorphisms in genes of the serotonergic system in patients with anorexia nervosa and in obese and healthy underweight individuals. We found no evidence for an association or for transmission disequilibrium of an allele of the serotonin transporter gene linked polymorphic region to extreme obesity, underweight, or anorexia nervosa.2 In addition, an involvement of the Cys-23-Ser polymorphism of the 5-HT 2C receptor gene in weight regulation was not detected.3 We did association studies of anorexia nervosa and the promotor polymorphism ⫺1438A/G and two other polymorphisms in the coding region of the 5-HT2A receptor gene leading to aminoacid substitutions (Thr25Asn; His452Tyr).4 100 patients with anorexia nervosa (according to DSM-IV criteria), 254 severely obese children and adolescents, and 101 underweight students in whom lifetime occurrence of anorexia nervosa had been excluded,3 were genotyped. All the study groups have been described previously.2,3 All participants or their parents gave their informed written consent. The investigation was approved by the ethics committee of the University of Marburg. We used single-strand conformation analysis to detect the promoter polymorphism (M M Nöthen and colleagues, unpublished observations). The promoter polymorphism was analysed by PCR (primers: 5'ACTGCGAAACCAACTTATTTCC3' and 5'-TGCAGATTCCCATTAAGG-3') with subsequent restriction
Vol 350 • November 1, 1997
THE LANCET
Study group
Allele frequency (%) ⫺1438 A/G polymorphism
Anorexia nervosa (n=100) Underweight (n=101) Obese (n=254)
Thr25Asn polymorphism
His452Tyr polymorphism
A
G
Thr
Asn
His
Tyr
79 (0·40) 86 (0·43) 215 (0·42)
121 (0·60) 116 (0·57) 293 (0·58)
198 (0·99) 197 (0·98) 491 (0·97)
2 (0·01) 5 (0·02) 17 (0·03)
182 (0·91) 185 (0·92) 445 (0·88)
18 (0·09) 17 (0·08) 63 (0·12)
Allele frequencies of three 5-HT2A receptor gene polymorphisms in patients with anorexia nervosa, and in healthy underweight and obese individuals
fragment length polymorphism analysis (PCR-RFLP) with Hpa II, which cuts the ⫺1438G allele product into two fragments. The other polymorphisms were analysed by PCR-RFLPs.4 Allele frequencies (table) and genotype frequencies (data not shown) were similar between the three study groups for each of the polymorphisms (all nominal p values >0·14). A separate analysis based on the inclusion of women alone revealed similar results (data not shown). The power of the continuity corrected onesided 2-test was 63% and 77% for individuals with anorexia nervosa versus underweight and obese individuals, respectively, at the 5% test level with the allele frequencies for the ⫺1438A/G polymorphism as estimated by Collier and colleagues. 1 To circumvent possible stratification effects we also tested for transmission disequilibrium5 of the ⫺1438G allele in 57 trios consisting of patients with anorexia nervosa and both parents and 103 trios with obese probands and their parents; nominal p values were 0·16 and 0·33, respectively. Allele and genotype frequencies were similar in our three study groups. The ⫺1438A allele was less frequent in our group of patients with anorexia nervosa than in the patients with anorexia nervosa reported by Collier (40% vs 51%). The frequency of the ⫺1438A allele in our anorexia nervosa patients was similar to that of the control group in Collier’s study (41%). We found no evidence for transmission disequilibrium of the ⫺1438A/G polymorphism for anorexia nervosa or obesity. Possible explanations for the discrepant results are false-positive and false-negative results, stratification effects, and genetic heterogeneity. We thank G Lehmkuhl, F Poustka, M H Schmidt, H Mayer, and W Siegfried for their contribution, and H Herrmann and K Rosenkranz for their technical assistance. This study was supported by the Deutsche Forschungsgemeinschaft.
*Anke Hinney, Andreas Ziegler, Markus M Nöthen, Helmut Remschmidt, Johannes Hebebrand *Departments of Child and Adolescent Psychiatry, and Institute of Medical Biometry and Epidemiology, University of Marburg, 35033 Marburg, Germany; and Institute of Human Genetics, University of Bonn, Bonn
Vol 350 • November 1, 1997
1
2
3
4
5
Collier DA, Arranz MJ, Li T, Mupita D, Brown N, Treasure J. Association between 5-HT2A gene promoter polymorphism and anorexia nervosa. Lancet 1997; 350: 412. Hinney A, Barth N, Ziegler A, et al. Serotonin transporter gene-linked polymorphic region: allele distributions in reltionship to body weight and in anorexia nervosa. Life Sci 1997; 61: 295–303. Lentes KU, Hinney A, Ziegler A, et al. Evaluation of a Cys23Ser mutation within the human 5-HT2C receptor gene: no evidence for an association of the mutant allele with obesity or underweight in children, adolescents and young adults. Life Sci 1997; 61: PL 9–16. Erdmann J, Shimron-Abarbanell D, Rietschel M, et al. Systematic screening for mutations in the human serotonin-2A (5HT2A) receptor gene: identification of two naturally occurring receptor variants and association analysis in schizophrenia. Hum Genet 1996; 97: 614–19. Spielman RS, McGinnis RE, Ewens WJ. Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet 1993; 52: 506–16.
Chronotherapy with 5-fluorouracil, oxaliplatin, and folinic acid in colorectal cancer SIR—Frances Levi and colleagues (Sept 6, p 681)1 report a difference in response rate and toxicity between colon cancer patients treated with infusional 5-fluorouracil, folinic acid, and oxaliplatin given by chronotherapy, compared with patients given a 24-hour constant-rate infusion of these agents. They take these findings to support the hypothesis that the pharmacological effects of certain chemotherapeutic agents are influenced by circadian rhythms, and that their efficacy can be improved and their toxicity diminished by appropriately timing the therapies with respect to these rhythms. The trial design, however, does not seem to directly address this hypothesis. This trial compares a group of patients treated with a variable-rate, 12hour infusion of oxaliplatin followed by a similar 12-hour infusion of 5fluorouracil and folinic acid, with a control group treated with a 24 hour constant-rate infusion of all three drugs. In addition to the difference in the circadian timing of the
chemotherapy, the test and control groups differ substantially with respect to the expected pharmacokinetics produced by the schedules used, as well as in the use of sequential versus concomitant administration of 5fluorouracil and oxaliplatin. Certainly, in the case of 5-fluorouracil, the effects of schedule on toxicity and efficacy are well described.2 For cisplatin combined with fluorouracil, preliminary data suggest that enhancement of cytotoxicity is more pronounced when cells are exposed to high 5-fluorouracil concentrations and when exposure to this drug precedes exposure to cisplatin.3 Concomitant versus sequential exposure to 5-fluorouracil and oxaliplatin may also have different cytotoxic profiles due to differences in peak 5-fluorouracil concentrations as well as the sequencing of the agents. These factors cannot be excluded as causes of the results in this trial. To test the stated hypothesis, the controls should more appropriately have been a group treated with a pharmacokinetically equivalent regimen, given sequentially, but in a different relation to the circadian rhythm. Pharmacokinetic data, as well as in-vitro data describing the effects of concomitant compared with sequential exposure to the agents on their synergism, additivity, or antagonism, would help to provide a basis to evaluate the biological effects of the confounding variables in this trial design. This trial may be interpreted as demonstrating that the sequential 12hour infusion regimen has advantages over the 24-hour continuous infusion regimen. However, because other equally, if not more, biologically and pharmacologically plausible reasons for the observed differences are present and not controlled for, the data do not support any conclusions about biological validity or clinical relevance of the chronotherapy approach in general. This trial design lacks the appropriate controls to address the larger question of the specific role of chronotherapy in achieving that superiority. Victor Sandor National Institutes of Health, National Cancer Institute, Medicine Branch, Bethesda, MD 20892, USA 1
2
3
Levi F, Zidani R, Misset J-L. Randomized multicentre trial of chronotherapy with oxaliplatin, fluorouracil, and folinic acid in metastatic colorectal cancer. Lancet 1997; 350: 681–86. Lokich JJ, Bothe A, Fine N, et al. Phase I study of protracted infusion of 5-fluorouracil. Cancer 1981; 48: 2565–68. Allegrini G, Falcone A, Antonuzzo M, et al. High dose chronomodulated 48 hour infusion 5-fluorouracil (5FU) in
1325