- Email: [email protected]
5-HT2C receptor gene polymorphisms associated with antipsychotic drug action alter promoter activity
BR A IN RE S EA RCH 1 1 49 ( 20 0 7 ) 1 4 –17
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s
Research Report
5-HT2C receptor gene polymorphisms associated with antipsychotic drug action alter promoter activity Matthew J. Hill ⁎, Gavin P. Reynolds Neuropsychiatric Genetics Research Group, Institute of Molecular Medicine, Trinity Centre for Health Sciences, St. James' Hospital, James Street, Dublin, D8, Ireland Division of Psychiatry and Neuroscience, Queen's University Belfast, Whitla Medical Building, 97 Lisburn Road, Belfast, BT9 7BL, UK
A R T I C LE I N FO
AB S T R A C T
Article history:
Polymorphisms within the 5-HT2C receptor gene promoter have been associated with
Accepted 18 February 2007
several physiological and psychiatric phenotypes. Notably, the –759T allele has been
Available online 24 February 2007
associated with resistance to antipsychotic induced weight gain. This study assessed the activity of four promoter haplotypes expressed as luciferase constructs in the SH-SY5Y
Keywords:
human neuroblastoma cell line in the presence or absence of a constitutively active 5-HT2C
5-HT2C receptor
receptor. The presence of either –759T or –697C alleles reduced promoter activity. In addition
Antipsychotic
a haplotype associated with resistance to antipsychotic induced weight showed under
Weight-gain
activity compared to the most common haplotype. In the presence of the 5-HT2C receptor a
Promoter polymorphism
similar pattern of promoter activity was observed. Both –759C/T and –697G/C polymorphic
Gene-reporter
sites are likely to play a role in basal promoter activity. Resistance to weight gain may, in part, be mediated by the consequences of reduced 5-HT2C receptor expression. © 2007 Elsevier B.V. All rights reserved.
1.
Introduction
Sequence analysis of the 5-HT2C receptor gene promoter has identified polymorphic sites within a 600 base pair fragment of the promoter. These sites consist of three single nucleotide polymorphisms (SNPs), –997G/A, –759C/T and –697G/C and a di-nucleotide GT repeat at –1028 varying from 11 to 21 repeats in length. In addition the –997 and –759 sites have been reported to be in complete linkage disequilibrium (Yuan et al., 2000; McCarthy et al., 2005). Association studies have shown that haplotypes containing the –759T allele confer resistance to obesity (Yuan et al., 2000; Pooley et al., 2004) and reduced weight gain in patients receiving antipsychotics (Reynolds et al., 2002; Templeman et al., 2005). Although there are negative reports of this association with clozapine-induced weight gain
⁎
(Tsai et al., 2002; Basile et al., 2002) an association has also been observed in chronic clozapine-treated subjects (Miller del et al., 2005). To date the –697 site has not been investigated with regards to weight gain independent of haplotype. Furthermore the –697G/C SNP has been associated with the occurrence of tardive dyskinesia (Zhang et al., 2002). It has therefore been proposed that these polymorphisms regulate promoter activity, and ultimately receptor expression, giving rise to differing phenotypes. To date four gene-reporter studies have investigated the effects of 5-HT2C receptor promoter polymorphisms on promoter activity. Yuan et al. (2000) reported that luciferase constructs containing either the –997A/–759T or –697C allele have increased transcription rates. Increased activity of the –759T allele was also found in a study which additionally reported
Corresponding author. Fax: +353 896 8461. E-mail address: [email protected] (M.J. Hill). Abbreviation: SNP, single nucleotide polymorphism
0006-8993/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2007.02.038
BR A IN RE S E A RCH 1 1 49 ( 20 0 7 ) 1 4 –1 7
15
Table 1 – Genotype profile of the cloned haplotypes Haplotype GT repeats 16/13 –997G/A –759C/T –697G/C A B C D
16 16 16 13
G G G A
C T C T
G G C C
that the –997G allele resulted in increased promoter activity (Buckland et al., 2005), although these authors did not investigate the –697G/C SNP. The same study demonstrated that length of the GT repeat and the –1165G/A SNP had little effect on transcription rates. These data support an earlier study in which the GT repeat was found not to influence levels of transcription (Meyer et al., 2002). Most recently a larger promoter fragment, containing 6 polymorphisms, was investigated using the method previously described by Yuan et al. (2000). In contrast to previous findings, no significant difference in activity between the haplotype containing the –759T and –697C alleles and the most common haplotype was reported but a haplotype containing the –759C and –697C alleles was significantly less active (21% decrease) compared to the major haplotype containing the –759C and –697G alleles (McCarthy et al., 2005). The additional 5′ polymorphisms were reportedly non-functional. It is therefore unclear as to the effects of individual promoter polymorphisms and particularly the –697 site. It is believed that neuronal 5-HT2C receptors located on hypothalamic neurons are responsible for satiety (reviewed by Simansky, 1996). This study therefore investigated the consequences of the promoter polymorphisms on promoter activity when expressed as luciferase constructs in SH-SY5Y human neuroblastoma cells, a more physiologically relevant cell line. In addition, the influence of a constitutively active 5-HT2C receptor isoform on promoter activity was investigated.
2.
Results
A total of 4 promoter haplotypes were generated, two directly from genomic DNA and two via modification of the
Fig. 1 – Promoter activity relative to haplotype A when expressed in SH-SY5Y cells (n = 5). Data are mean ± standard error. **p < 0.01 vs. haplotype A, one-sample t-test. All promoter haplotypes had reduced activity compared to haplotype A.
Fig. 2 – Promoter activity relative to haplotype A when expressed in SH-SY5Y 5-HT2C receptor expressing cells (n = 3). Data are mean ± standard error. **p < 0.01 vs. haplotype A, one-sample t-test. All promoter haplotypes had reduced activity compared to haplotype A.
pGL3-haplotype A construct using site-directed mutagenesis (Table 1). When expressed in wild type SH-SY5Y cells all haplotypes showed significantly reduced activity compared to haplotype A (Fig. 1). A similar pattern of reduced activity, compared to haplotype A, was observed in the cell line expressing the 5-HT2C (Fig. 2). All promoter constructs showed activity that was at least 15-fold higher than the basic pGL3 plasmid.
3.
Discussion
We have studied four polymorphisms in high linkage disequilibrium resulting in two common haplotypes, A and D. While A is the most common haplotype (> 50%), haplotype D accounts for >99% of haplotypes containing the –759T allele (Yuan et al., 2000; McCarthy et al., 2005). Thus haplotype D is associated with resistance to antipsychotic induced weight gain (Reynolds et al., 2002; Templeman et al., 2005). The mechanism by which the –759T and –697C alleles reduce promoter activity is likely to arise from the loss or reduced affinity of a transcription factor-binding site. However the profound effect of the substitution at the –697 position could be due to the disruption of the major transcription initiation site reported to be at –703, or the additional minor sites at –728, –720 and –692 (Xie et al., 1996). Furthermore, the –697 site, when present in the transcript, could play a role in mRNA processing. The –997 site and GT repeat length are likely to be non-functional as previously reported, as the additive effects of the –759T and –697C genotypes appear to account for the total reduction in activity of haplotype D, although their contribution to the activity of haplotype D can not be ruled out. Relative promoter activities compared to haplotype A did not obviously differ between cell lines i.e. in the presence or absence of the 5-HT2C receptor (Figs. 1 and 2). The constitutively active isoform of the 5-HT2C receptor couples to Gproteins in the absence of agonist binding thereby inducing second messenger signalling. It was speculated that the 5-
16
BR A IN RE S EA RCH 1 1 49 ( 20 0 7 ) 1 4 –17
HT2C receptor signalling cascade could potentially regulate promoter activity in a haplotype-dependent manner. However, no haplotype-specific regulation of promoter activity was observed. It may therefore be likely that the polymorphic sites do not play a role in 5-HT2C receptor signalling-mediated regulation of the promoter and exert their effects predominately by altering basal expression levels. In contrast to some earlier reports these data show that both the –697C and the –759T genotype reduce promoter activity. It is therefore important to explore the methodological differences employed in each study. Firstly, Yuan et al. (2000) expressed the constructs, containing the SV40 viral enhancer, in a mouse embryonic carcinoma cell line. Secondly, the study by Buckland et al. (2005), although examining a larger promoter fragment, did not include the –697 site and employed phenotypically less relevant cell lines for the expression of the construct. Interestingly the study by McCarthy et al. (2005) failed to replicate these earlier studies but this could be attributed to the inclusion of additional 5′ polymorphisms or the use of a vector that did not contain the SV40 enhancer. The use of the SH-SY5Y cell line for promoter studies may provide a model, divergent from non-neuronal cell lines, in which to investigate neuronal gene expression. Such cell line-specific events have recently been reported for the 5-HT2A receptor gene promoter polymorphisms which alter promoter activity when expressed in SH-SY5Y cells but not in the nonneuronal C6 cell line (Myers et al., 2006). Furthermore, the direction of change in promoter activity for the –1019C/G 5HT1A receptor gene polymorphism has been shown to be cell line/context-dependent (Czesak et al., 2006). It is also notable that the SH-SY5Y cell line expresses 5-HT2C receptor mRNA (Flomen et al., 2004) and may therefore contain some of the regulatory elements required for neuronal expression. It has not, however, been reported to express the 5-HT2C receptor protein. The protective effect of the –759T allele on weight gain may therefore result from decreased neuronal expression of the receptor, although it is possible that subsequent compensatory changes in other systems mediate this resistance. One possible mechanism involves the increased levels of circulating leptin observed in carriers of the –759T allele (Templeman et al., 2005). However, the mechanism by which the 5-HT2C receptor influences leptin levels is still unknown. This study has shown that the –759C/T and, particularly, the –697G/C SNPs are likely to be important in basal activity of the 5-HT2C receptor gene promoter. It is proposed that decreased expression of the receptor leads to adaptive changes in other systems that control feeding, and that mediate the effects of antipsychotic drugs on that control system, resulting in resistance to weight gain.
4.
Experimental procedures
4.1.
Cell culture
SH-SY5Y cells were grown in DMEM (Invitrogen) supplemented with 10% foetal bovine serum at 37 °C with 5% carbon
dioxide. SH-SY5Y cells stably expressing the un-edited isoform of the human 5-HT2C receptor under the control of the human cytomegalovirus promoter were maintained in the presence of 400 μg/ml geneticin.
4.2.
Transfection
Cells were seeded into 24-well plates at a density of 104 cells/ well 24 h prior to transfection. On the day of transfection the medium was replaced with DMEM containing 10% heatinactivated foetal bovine serum. Cells were co-transfected with 1.5 μg luciferase construct or empty pGL3 plasmid and 9 ng pRL-CMV using Lipofectamine 2000 (Invitrogen). Transfections were repeated at least three times with multiple plasmid preparations.
4.3.
Generation of luciferase reporter constructs
A 600-bp fragment of the 5-HT2C receptor gene promoter was amplified from human genomic DNA (male) by polymerase chain reaction. PCR products, flanked by KpnI and XhoI restriction sites, for haplotypes A and D (Table 1) were generated by amplification of approximately 100 ng of genomic DNA using 100 pmol forward primer, 5′CGGGGTACCTTGAAGGGAGTTTCAAAG, and reverse primer, 5′-CCGCTCGAGTATGCAATCGGCAGGTAAGG, by a PCR containing 250 μM dNTPs, 2 mM magnesium, 5 μl deep vent reaction buffer and 2.5 U Deep Vent polymerase. PCR was carried out with the following cycle parameters: 95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min for 35 cycles. Purified PCR products were ligated into the pGL3 luciferase vector (Promega).
4.4.
Mutagenic PCR
An adaptation of the ‘megaprimer’ technique (Sarkar and Sommer, 1990) was used for site-directed mutagenesis. Briefly, 20 ng pGL3 plasmid containing haplotype A was amplified using 100 pmol of the reverse primer and an internal mutagenic primer, 5′-CTCTGGTGCTTGCCGAGGACGCTT for mutation of the –697 site or 5′-TCCCCTCATCCTGCTTTTGGCCCAAG for mutation of the –759 site by a PCR containing 250 μM dNTPs, 2 mM magnesium, 5 μl deep vent reaction buffer, 2.5 U Deep Vent polymerase (New England Biolabs). Approximately 100 ng of gel-purified ‘megaprimer’ was used for a second PCR containing 20 ng template, 250 μM dNTPs, 2 mM magnesium, 5 μl deep vent reaction buffer, 2.5 U Deep Vent polymerase (New England Biolabs) and 100 pmol forward primer. PCR was carried out with the following cycle parameters: 95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min for 35 cycles. All promoter constructs were verified by sequencing.
4.5.
Luciferase gene reporter assay
Cells were assayed 48 h after transfection and luciferase activity was measured using the dual reporter luciferase system (Promega), according to the manufacturer's protocol, and relative promoter activity was calculated. Promoter haplotype activity was expressed as percent activity relative to haplotype A and means were compared using a one-sample t-test.
BR A IN RE S E A RCH 1 1 49 ( 20 0 7 ) 1 4 –1 7
Acknowledgments We thank the Psychiatry CEDD at GlaxoSmithKline for their gift of the SH-SY5Y cell line expressing the 5-HT2C receptor. M. J. Hill is supported by a MRC studentship.
REFERENCES
Basile, V.S., Masellis, M., De Luca, V., Meltzer, H.Y., Kennedy, J.L., 2002. 759C/T genetic variation of 5HT(2C) receptor and clozapine-induced weight gain. Lancet 360, 1790–1791. Buckland, P.R., Hoogendoorn, B., Guy, C.A., Smith, S.K., Coleman, S.L., O'Donovan, M.C., 2005. Low gene expression conferred by association of an allele of the 5-HT2C receptor gene with antipsychotic-induced weight gain. Am. J. Psychiatry 162, 613–615. Czesak, M., Lemonde, S., Peterson, E.A., Rogaeva, A., Albert, P.R., 2006. Cell-specific repressor or enhancer activities of Deaf-1 at a serotonin 1A receptor gene polymorphism. J. Neurosci. 26, 1864–1871. Flomen, R., Knight, J., Sham, P., Kerwin, R., Makoff, A., 2004. Evidence that RNA editing modulates splice site selection in the 5-HT2C receptor gene. Nucleic Acids Res. 32, 2113–2122. McCarthy, S., Mottagui-Tabar, S., Mizuno, Y., Sennblad, B., Hoffstedt, J., Arner, P., Wahlestedt, C., Andersson, B., 2005. Complex HTR2C linkage disequilibrium and promoter associations with body mass index and serum leptin. Hum. Genet. 117, 545–557. Meyer, J., Saam, W., Mossner, R., Cangir, O., Ortega, G.R., Tatschner, T., Riederer, P., Wienker, T.F., Lesch, K.P., 2002. Evolutionary conserved microsatellites in the promoter region of the 5-hydroxytryptamine receptor 2C gene (HTR2C) are not associated with bipolar disorder in females. J. Neural Transm. 109, 939–946. Miller del, D., Ellingrod, V.L., Holman, T.L., Buckley, P.F., Arndt, S., 2005. Clozapine-induced weight gain associated with the 5HT2C
17
receptor –759C/T polymorphism. Am. J. Med. Genet., B Neuropsychiatr. Genet. 133, 97–100. Myers, R.L., Airey, D.C., Manier, D.H., Shelton, R.C., Sanders-Bush, E., 2006. Polymorphisms in the regulatory region of the human serotonin 5-HT(2A) receptor gene (HTR2A) influence gene expression. Biol. Psychiatry 61, 167–173. Pooley, E.C., Fairburn, C.G., Cooper, Z., Sodhi, M.S., Cowen, P.J., Harrison, P.J., 2004. A 5-HT2C receptor promoter polymorphism (HTR2C–759C/T) is associated with obesity in women, and with resistance to weight loss in heterozygotes. Am. J. Med. Genet., B Neuropsychiatr. Genet. 126, 124–127. Reynolds, G.P., Zhang, Z.J., Zhang, X.B., 2002. Association of antipsychotic drug-induced weight gain with a 5-HT2C receptor gene polymorphism. Lancet 359, 2086–2087. Sarkar, G., Sommer, S.S., 1990. The “megaprimer” method of site-directed mutagenesis. BioTechniques 8, 404–407. Simansky, K.J., 1996. Serotonergic control of the organization of feeding and satiety. Behav. Brain Res. 73, 37–42. Templeman, L.A., Reynolds, G.P., Arranz, B., San, L., 2005. Polymorphisms of the 5-HT2C receptor and leptin genes are associated with antipsychotic drug-induced weight gain in Caucasian subjects with a first-episode psychosis. Pharmacogenet. Genomics 15, 195–200. Tsai, S.J., Hong, C.J., Yu, Y.W., Lin, C.H., 2002. –759C/T genetic variation of 5HT(2C) receptor and clozapine-induced weight gain. Lancet 360, 1790. Xie, E., Zhu, L., Zhao, L., Chang, L.S., 1996. The human serotonin 5-HT2C receptor: complete cDNA, genomic structure, and alternatively spliced variant. Genomics 35, 551–561. Yuan, X., Yamada, K., Ishiyama-Shigemoto, S., Koyama, W., Nonaka, K., 2000. Identification of polymorphic loci in the promoter region of the serotonin 5-HT2C receptor gene and their association with obesity and type II diabetes. Diabetologia 43, 373–376. Zhang, Z.J., Zhang, X.B., Sha, W.W., Zhang, X.B., Reynolds, G.P., 2002. Association of a polymorphism in the promoter region of the serotonin 5-HT2C receptor gene with tardive dyskinesia in patients with schizophrenia. Mol. Psychiatry 7, 670–671.
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s
Research Report
5-HT2C receptor gene polymorphisms associated with antipsychotic drug action alter promoter activity Matthew J. Hill ⁎, Gavin P. Reynolds Neuropsychiatric Genetics Research Group, Institute of Molecular Medicine, Trinity Centre for Health Sciences, St. James' Hospital, James Street, Dublin, D8, Ireland Division of Psychiatry and Neuroscience, Queen's University Belfast, Whitla Medical Building, 97 Lisburn Road, Belfast, BT9 7BL, UK
A R T I C LE I N FO
AB S T R A C T
Article history:
Polymorphisms within the 5-HT2C receptor gene promoter have been associated with
Accepted 18 February 2007
several physiological and psychiatric phenotypes. Notably, the –759T allele has been
Available online 24 February 2007
associated with resistance to antipsychotic induced weight gain. This study assessed the activity of four promoter haplotypes expressed as luciferase constructs in the SH-SY5Y
Keywords:
human neuroblastoma cell line in the presence or absence of a constitutively active 5-HT2C
5-HT2C receptor
receptor. The presence of either –759T or –697C alleles reduced promoter activity. In addition
Antipsychotic
a haplotype associated with resistance to antipsychotic induced weight showed under
Weight-gain
activity compared to the most common haplotype. In the presence of the 5-HT2C receptor a
Promoter polymorphism
similar pattern of promoter activity was observed. Both –759C/T and –697G/C polymorphic
Gene-reporter
sites are likely to play a role in basal promoter activity. Resistance to weight gain may, in part, be mediated by the consequences of reduced 5-HT2C receptor expression. © 2007 Elsevier B.V. All rights reserved.
1.
Introduction
Sequence analysis of the 5-HT2C receptor gene promoter has identified polymorphic sites within a 600 base pair fragment of the promoter. These sites consist of three single nucleotide polymorphisms (SNPs), –997G/A, –759C/T and –697G/C and a di-nucleotide GT repeat at –1028 varying from 11 to 21 repeats in length. In addition the –997 and –759 sites have been reported to be in complete linkage disequilibrium (Yuan et al., 2000; McCarthy et al., 2005). Association studies have shown that haplotypes containing the –759T allele confer resistance to obesity (Yuan et al., 2000; Pooley et al., 2004) and reduced weight gain in patients receiving antipsychotics (Reynolds et al., 2002; Templeman et al., 2005). Although there are negative reports of this association with clozapine-induced weight gain
⁎
(Tsai et al., 2002; Basile et al., 2002) an association has also been observed in chronic clozapine-treated subjects (Miller del et al., 2005). To date the –697 site has not been investigated with regards to weight gain independent of haplotype. Furthermore the –697G/C SNP has been associated with the occurrence of tardive dyskinesia (Zhang et al., 2002). It has therefore been proposed that these polymorphisms regulate promoter activity, and ultimately receptor expression, giving rise to differing phenotypes. To date four gene-reporter studies have investigated the effects of 5-HT2C receptor promoter polymorphisms on promoter activity. Yuan et al. (2000) reported that luciferase constructs containing either the –997A/–759T or –697C allele have increased transcription rates. Increased activity of the –759T allele was also found in a study which additionally reported
Corresponding author. Fax: +353 896 8461. E-mail address: [email protected] (M.J. Hill). Abbreviation: SNP, single nucleotide polymorphism
0006-8993/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2007.02.038
BR A IN RE S E A RCH 1 1 49 ( 20 0 7 ) 1 4 –1 7
15
Table 1 – Genotype profile of the cloned haplotypes Haplotype GT repeats 16/13 –997G/A –759C/T –697G/C A B C D
16 16 16 13
G G G A
C T C T
G G C C
that the –997G allele resulted in increased promoter activity (Buckland et al., 2005), although these authors did not investigate the –697G/C SNP. The same study demonstrated that length of the GT repeat and the –1165G/A SNP had little effect on transcription rates. These data support an earlier study in which the GT repeat was found not to influence levels of transcription (Meyer et al., 2002). Most recently a larger promoter fragment, containing 6 polymorphisms, was investigated using the method previously described by Yuan et al. (2000). In contrast to previous findings, no significant difference in activity between the haplotype containing the –759T and –697C alleles and the most common haplotype was reported but a haplotype containing the –759C and –697C alleles was significantly less active (21% decrease) compared to the major haplotype containing the –759C and –697G alleles (McCarthy et al., 2005). The additional 5′ polymorphisms were reportedly non-functional. It is therefore unclear as to the effects of individual promoter polymorphisms and particularly the –697 site. It is believed that neuronal 5-HT2C receptors located on hypothalamic neurons are responsible for satiety (reviewed by Simansky, 1996). This study therefore investigated the consequences of the promoter polymorphisms on promoter activity when expressed as luciferase constructs in SH-SY5Y human neuroblastoma cells, a more physiologically relevant cell line. In addition, the influence of a constitutively active 5-HT2C receptor isoform on promoter activity was investigated.
2.
Results
A total of 4 promoter haplotypes were generated, two directly from genomic DNA and two via modification of the
Fig. 1 – Promoter activity relative to haplotype A when expressed in SH-SY5Y cells (n = 5). Data are mean ± standard error. **p < 0.01 vs. haplotype A, one-sample t-test. All promoter haplotypes had reduced activity compared to haplotype A.
Fig. 2 – Promoter activity relative to haplotype A when expressed in SH-SY5Y 5-HT2C receptor expressing cells (n = 3). Data are mean ± standard error. **p < 0.01 vs. haplotype A, one-sample t-test. All promoter haplotypes had reduced activity compared to haplotype A.
pGL3-haplotype A construct using site-directed mutagenesis (Table 1). When expressed in wild type SH-SY5Y cells all haplotypes showed significantly reduced activity compared to haplotype A (Fig. 1). A similar pattern of reduced activity, compared to haplotype A, was observed in the cell line expressing the 5-HT2C (Fig. 2). All promoter constructs showed activity that was at least 15-fold higher than the basic pGL3 plasmid.
3.
Discussion
We have studied four polymorphisms in high linkage disequilibrium resulting in two common haplotypes, A and D. While A is the most common haplotype (> 50%), haplotype D accounts for >99% of haplotypes containing the –759T allele (Yuan et al., 2000; McCarthy et al., 2005). Thus haplotype D is associated with resistance to antipsychotic induced weight gain (Reynolds et al., 2002; Templeman et al., 2005). The mechanism by which the –759T and –697C alleles reduce promoter activity is likely to arise from the loss or reduced affinity of a transcription factor-binding site. However the profound effect of the substitution at the –697 position could be due to the disruption of the major transcription initiation site reported to be at –703, or the additional minor sites at –728, –720 and –692 (Xie et al., 1996). Furthermore, the –697 site, when present in the transcript, could play a role in mRNA processing. The –997 site and GT repeat length are likely to be non-functional as previously reported, as the additive effects of the –759T and –697C genotypes appear to account for the total reduction in activity of haplotype D, although their contribution to the activity of haplotype D can not be ruled out. Relative promoter activities compared to haplotype A did not obviously differ between cell lines i.e. in the presence or absence of the 5-HT2C receptor (Figs. 1 and 2). The constitutively active isoform of the 5-HT2C receptor couples to Gproteins in the absence of agonist binding thereby inducing second messenger signalling. It was speculated that the 5-
16
BR A IN RE S EA RCH 1 1 49 ( 20 0 7 ) 1 4 –17
HT2C receptor signalling cascade could potentially regulate promoter activity in a haplotype-dependent manner. However, no haplotype-specific regulation of promoter activity was observed. It may therefore be likely that the polymorphic sites do not play a role in 5-HT2C receptor signalling-mediated regulation of the promoter and exert their effects predominately by altering basal expression levels. In contrast to some earlier reports these data show that both the –697C and the –759T genotype reduce promoter activity. It is therefore important to explore the methodological differences employed in each study. Firstly, Yuan et al. (2000) expressed the constructs, containing the SV40 viral enhancer, in a mouse embryonic carcinoma cell line. Secondly, the study by Buckland et al. (2005), although examining a larger promoter fragment, did not include the –697 site and employed phenotypically less relevant cell lines for the expression of the construct. Interestingly the study by McCarthy et al. (2005) failed to replicate these earlier studies but this could be attributed to the inclusion of additional 5′ polymorphisms or the use of a vector that did not contain the SV40 enhancer. The use of the SH-SY5Y cell line for promoter studies may provide a model, divergent from non-neuronal cell lines, in which to investigate neuronal gene expression. Such cell line-specific events have recently been reported for the 5-HT2A receptor gene promoter polymorphisms which alter promoter activity when expressed in SH-SY5Y cells but not in the nonneuronal C6 cell line (Myers et al., 2006). Furthermore, the direction of change in promoter activity for the –1019C/G 5HT1A receptor gene polymorphism has been shown to be cell line/context-dependent (Czesak et al., 2006). It is also notable that the SH-SY5Y cell line expresses 5-HT2C receptor mRNA (Flomen et al., 2004) and may therefore contain some of the regulatory elements required for neuronal expression. It has not, however, been reported to express the 5-HT2C receptor protein. The protective effect of the –759T allele on weight gain may therefore result from decreased neuronal expression of the receptor, although it is possible that subsequent compensatory changes in other systems mediate this resistance. One possible mechanism involves the increased levels of circulating leptin observed in carriers of the –759T allele (Templeman et al., 2005). However, the mechanism by which the 5-HT2C receptor influences leptin levels is still unknown. This study has shown that the –759C/T and, particularly, the –697G/C SNPs are likely to be important in basal activity of the 5-HT2C receptor gene promoter. It is proposed that decreased expression of the receptor leads to adaptive changes in other systems that control feeding, and that mediate the effects of antipsychotic drugs on that control system, resulting in resistance to weight gain.
4.
Experimental procedures
4.1.
Cell culture
SH-SY5Y cells were grown in DMEM (Invitrogen) supplemented with 10% foetal bovine serum at 37 °C with 5% carbon
dioxide. SH-SY5Y cells stably expressing the un-edited isoform of the human 5-HT2C receptor under the control of the human cytomegalovirus promoter were maintained in the presence of 400 μg/ml geneticin.
4.2.
Transfection
Cells were seeded into 24-well plates at a density of 104 cells/ well 24 h prior to transfection. On the day of transfection the medium was replaced with DMEM containing 10% heatinactivated foetal bovine serum. Cells were co-transfected with 1.5 μg luciferase construct or empty pGL3 plasmid and 9 ng pRL-CMV using Lipofectamine 2000 (Invitrogen). Transfections were repeated at least three times with multiple plasmid preparations.
4.3.
Generation of luciferase reporter constructs
A 600-bp fragment of the 5-HT2C receptor gene promoter was amplified from human genomic DNA (male) by polymerase chain reaction. PCR products, flanked by KpnI and XhoI restriction sites, for haplotypes A and D (Table 1) were generated by amplification of approximately 100 ng of genomic DNA using 100 pmol forward primer, 5′CGGGGTACCTTGAAGGGAGTTTCAAAG, and reverse primer, 5′-CCGCTCGAGTATGCAATCGGCAGGTAAGG, by a PCR containing 250 μM dNTPs, 2 mM magnesium, 5 μl deep vent reaction buffer and 2.5 U Deep Vent polymerase. PCR was carried out with the following cycle parameters: 95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min for 35 cycles. Purified PCR products were ligated into the pGL3 luciferase vector (Promega).
4.4.
Mutagenic PCR
An adaptation of the ‘megaprimer’ technique (Sarkar and Sommer, 1990) was used for site-directed mutagenesis. Briefly, 20 ng pGL3 plasmid containing haplotype A was amplified using 100 pmol of the reverse primer and an internal mutagenic primer, 5′-CTCTGGTGCTTGCCGAGGACGCTT for mutation of the –697 site or 5′-TCCCCTCATCCTGCTTTTGGCCCAAG for mutation of the –759 site by a PCR containing 250 μM dNTPs, 2 mM magnesium, 5 μl deep vent reaction buffer, 2.5 U Deep Vent polymerase (New England Biolabs). Approximately 100 ng of gel-purified ‘megaprimer’ was used for a second PCR containing 20 ng template, 250 μM dNTPs, 2 mM magnesium, 5 μl deep vent reaction buffer, 2.5 U Deep Vent polymerase (New England Biolabs) and 100 pmol forward primer. PCR was carried out with the following cycle parameters: 95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min for 35 cycles. All promoter constructs were verified by sequencing.
4.5.
Luciferase gene reporter assay
Cells were assayed 48 h after transfection and luciferase activity was measured using the dual reporter luciferase system (Promega), according to the manufacturer's protocol, and relative promoter activity was calculated. Promoter haplotype activity was expressed as percent activity relative to haplotype A and means were compared using a one-sample t-test.
BR A IN RE S E A RCH 1 1 49 ( 20 0 7 ) 1 4 –1 7
Acknowledgments We thank the Psychiatry CEDD at GlaxoSmithKline for their gift of the SH-SY5Y cell line expressing the 5-HT2C receptor. M. J. Hill is supported by a MRC studentship.
REFERENCES
Basile, V.S., Masellis, M., De Luca, V., Meltzer, H.Y., Kennedy, J.L., 2002. 759C/T genetic variation of 5HT(2C) receptor and clozapine-induced weight gain. Lancet 360, 1790–1791. Buckland, P.R., Hoogendoorn, B., Guy, C.A., Smith, S.K., Coleman, S.L., O'Donovan, M.C., 2005. Low gene expression conferred by association of an allele of the 5-HT2C receptor gene with antipsychotic-induced weight gain. Am. J. Psychiatry 162, 613–615. Czesak, M., Lemonde, S., Peterson, E.A., Rogaeva, A., Albert, P.R., 2006. Cell-specific repressor or enhancer activities of Deaf-1 at a serotonin 1A receptor gene polymorphism. J. Neurosci. 26, 1864–1871. Flomen, R., Knight, J., Sham, P., Kerwin, R., Makoff, A., 2004. Evidence that RNA editing modulates splice site selection in the 5-HT2C receptor gene. Nucleic Acids Res. 32, 2113–2122. McCarthy, S., Mottagui-Tabar, S., Mizuno, Y., Sennblad, B., Hoffstedt, J., Arner, P., Wahlestedt, C., Andersson, B., 2005. Complex HTR2C linkage disequilibrium and promoter associations with body mass index and serum leptin. Hum. Genet. 117, 545–557. Meyer, J., Saam, W., Mossner, R., Cangir, O., Ortega, G.R., Tatschner, T., Riederer, P., Wienker, T.F., Lesch, K.P., 2002. Evolutionary conserved microsatellites in the promoter region of the 5-hydroxytryptamine receptor 2C gene (HTR2C) are not associated with bipolar disorder in females. J. Neural Transm. 109, 939–946. Miller del, D., Ellingrod, V.L., Holman, T.L., Buckley, P.F., Arndt, S., 2005. Clozapine-induced weight gain associated with the 5HT2C
17
receptor –759C/T polymorphism. Am. J. Med. Genet., B Neuropsychiatr. Genet. 133, 97–100. Myers, R.L., Airey, D.C., Manier, D.H., Shelton, R.C., Sanders-Bush, E., 2006. Polymorphisms in the regulatory region of the human serotonin 5-HT(2A) receptor gene (HTR2A) influence gene expression. Biol. Psychiatry 61, 167–173. Pooley, E.C., Fairburn, C.G., Cooper, Z., Sodhi, M.S., Cowen, P.J., Harrison, P.J., 2004. A 5-HT2C receptor promoter polymorphism (HTR2C–759C/T) is associated with obesity in women, and with resistance to weight loss in heterozygotes. Am. J. Med. Genet., B Neuropsychiatr. Genet. 126, 124–127. Reynolds, G.P., Zhang, Z.J., Zhang, X.B., 2002. Association of antipsychotic drug-induced weight gain with a 5-HT2C receptor gene polymorphism. Lancet 359, 2086–2087. Sarkar, G., Sommer, S.S., 1990. The “megaprimer” method of site-directed mutagenesis. BioTechniques 8, 404–407. Simansky, K.J., 1996. Serotonergic control of the organization of feeding and satiety. Behav. Brain Res. 73, 37–42. Templeman, L.A., Reynolds, G.P., Arranz, B., San, L., 2005. Polymorphisms of the 5-HT2C receptor and leptin genes are associated with antipsychotic drug-induced weight gain in Caucasian subjects with a first-episode psychosis. Pharmacogenet. Genomics 15, 195–200. Tsai, S.J., Hong, C.J., Yu, Y.W., Lin, C.H., 2002. –759C/T genetic variation of 5HT(2C) receptor and clozapine-induced weight gain. Lancet 360, 1790. Xie, E., Zhu, L., Zhao, L., Chang, L.S., 1996. The human serotonin 5-HT2C receptor: complete cDNA, genomic structure, and alternatively spliced variant. Genomics 35, 551–561. Yuan, X., Yamada, K., Ishiyama-Shigemoto, S., Koyama, W., Nonaka, K., 2000. Identification of polymorphic loci in the promoter region of the serotonin 5-HT2C receptor gene and their association with obesity and type II diabetes. Diabetologia 43, 373–376. Zhang, Z.J., Zhang, X.B., Sha, W.W., Zhang, X.B., Reynolds, G.P., 2002. Association of a polymorphism in the promoter region of the serotonin 5-HT2C receptor gene with tardive dyskinesia in patients with schizophrenia. Mol. Psychiatry 7, 670–671.