- Email: [email protected]
[6] Expression vectors for high-level gene expression in dicotyledonous and monocotyledonous plants
66
VECTORS FOR EXPRESSING CLONED GENES
[6]
required. The advantage over other stable expression systems is the ease of selecting producer clones, not the height of expression. The expression levels are always lower in stable systems compared with the lytic viral ones. We tried to make use of the excess of T7 polymerase present in the nucleus of some clones by using episomal origin vectors. However, up to now the levels of expression could be enhanced only two- to fourfold. 44 We are currently working on the establishment of regulated systems that might allow a higher level of expression for a short period of time. The chief advantage of the modified T7 system based on mutant promoters is the strong dependence on transcription by T7 RNA polymerase. Thus, the system can be used for all purposes of selective gene expression. Cell lines or even transgenic mice carrying silent genes under the control of a mutant promoter can be established and their expression can be stimulated via subsequent introduction of T7 polymerase, for example, by retroviral vectors. Alternatively, inducible repressor systems could be used to repress either the T7 promoter or T7 polymerase expression. Additional useful applications are the expression of bi- or polycistronic mRNA as well as the efficient expression of antisense RNA or ribozymes. 44 V, Sandig and M. Strauss, unpublished observations 0991),
[6] E x p r e s s i o n V e c t o r s f o r H i g h - L e v e l G e n e E x p r e s s i o n in Dicotyledonous and Monocotyledonous Plants By REINHARD TOPFER, CHRISTOPH MAAS, CHRISTA H(SRICKE-GRANDPIERRE, J E F F SCHELL,
and
H A N S - H E N N I N G STEINBISS
Introduction High-level expression of selectable marker genes as well as that of agronomically important genes is a crucial aspect of plant molecular biology. The first chimeric genes for plant transformation experiments consisted of bacterial antibiotic resistance genes controlled by promoters derived from genes carried by the T-DNA region ofAgrobacterium tumefaciens Ti plasmids. ~-3 A second generation of constructs made use of the L. Herrera-Estrella, M. De Block, E. Messens, J.-P. Hernalsteens, M. Van Montagu, and J. Schell, EMBO J. 2, 987 (1983). M. Bevan, R. B. Flavell, and M.-D. Chilton, Nature (London) 304, 184 (1983).
METHODS IN ENZYMOLOGY,VOL.217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
67
s t r o n g e r 355 R N A p r o m o t e r o f the cauliflower m o s a i c virus ( C a M V ) , w h i c h in fact has p r o v e d to be o n e o f the m o s t effective and best c h a r a c t e r ized plant p r o m o t e r s . 4-7 This p r o m o t e r has b e e n u s e d to create e x p r e s s i o n v e c t o r c a s s e t t e s s u c h as pDH51,8 p M O N 3 1 6 , 9 and pRT100,~° with w h i c h high levels o f gene e x p r e s s i o n c a n be o b t a i n e d in a variety o f plant tissues. Interestingly, the transcriptional activity o f this p r o m o t e r could be stimulated up to 10-fold b y duplication o f the C a M V 355 e n h a n c e r s e q u e n c e s ~ or b y insertion o f a 42-bp S h r u n k e n 1 e x o n 1 s e q u e n c e j u s t d o w n s t r e a m o f the t r a n s c r i p t i o n start site. 12 M o r e o v e r , it has b e e n s h o w n that gene e x p r e s s i o n c a n also be m o d u l a t e d significantly at the posttranscriptional level. I n c l u s i o n o f introns in the t r a n s c r i p t i o n unit s e e m to influence stability o f the transcript, leading to an e n h a n c e m e n t o f gene e x p r e s s i o n of up to 150-fold. t2-14 T h e use o f different 3' p o l y ( A ) cassettes resulted in differences in gene e x p r e s s i o n o f up to 60-fold. ~5 T h e translational effic i e n c y o f c h i m e r i c transcripts w a s s h o w n to be increased by insertion o f viral u n t r a n s l a t e d leader s e q u e n c e s in the 5' u n t r a n s l a t e d region o f the t r a n s c r i p t i o n unit, resulting in an e n h a n c e d level o f gene e x p r e s s i o n o f up to 3 5 - f o l d ) 6A7 This c h a p t e r d e s c r i b e s sets o f v e c t o r s that are derivatives of the expression v e c t o r c a s s e t t e pRT100, w h i c h uses the C a M V 355 R N A p r o m o t e r in c o m b i n a t i o n with v a r i o u s r e p o r t e r and selectable m a r k e r genes. F u r t h e r m o r e , w e i n t r o d u c e a set o f e x p r e s s i o n v e c t o r s f o r e n h a n c e d gene expression in m o n o c o t y l e d o n o u s plants, especially a g r o n o m i c a l l y i m p o r t a n t ce-
3 R. T. Fraley, S. G. Rogers, R. B. Horsch, P. R. Sanders, J. S. Flick, S. P. Adams, M. L. Bittner, L. A. Brand, C. L. Fink, J. S. Fry, G. R. Galuppi, S. B. Goldberg, N. L. Hoffmann, and S. C. Woo, Proc. Natl. Acad. Sci. U,S.A. 80, 4803 (1983). 4 j. T. Odell, F. Nagy, and N.-H. Chua, Nature (London) 313, 810 (1985). D. W. Ow, J. D. Jacobs, and S. H. Howell, Proc. Natl. Acad. Sci. U.S.A. 84, 4870 (1987). 6 R.-X. Fang, F, Nagy, S. Sivasubramaniam, and N.-H. Chua, Plant Cell 1, 141 (1989). 7 p. N. Benfey and N.-H. Chua, Science 250, 959 (1990). 8 M. Pietrzak, R. D. Shillito, T. Hohn, and I. Potrykus, Nucleic Acids Res. 14, 5857 (1986). 9 S. G. Rogers, H. J. Klee, R. B. Horsch, and R. T. Fraley, this series, Vol. 153, p. 253. I0 R. TOpfer, V. Matzeit, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 14, 5890 (1987). 11R. Kay, A. Cahan, M. Daly, and J. McPherson, Science 236, 1299 (1987). ~2C. Maas, J. Laufs, S. Grant, C. Korfhage, and W. Werr, Plant Mol. Biol. 16, 199 (1991). ~3j. Callis, M. Fromm, and V. Walbot, Genes Dev. 1, 1183 (1987). t4 V. Vasil, M. Clancy, R. J. Ferl, 1. K. Vasil, and C. Hannah, Plant Physiol. 91, 1575 (1989). ~51. L. W. Ingelbrecht, L. M. F. Herman, R. A. Dekeyser, M. C. Van Montagu, and A. G. Depicker, Plant Cell 1, 671 (1989). 16S. A. Jobling and L. Gehrke, Nature (London) 325, 622 (1987). 17D. R. Gallie, D. E. Sleat, J. W. Watts, P. C. Turner, and T. M. A. Wilson, Nucleic Acids Res. 15, 3257 (1987).
68
VECTORS FOR EXPRESSING CLONED GENES
[6]
reals. These vectors have been constructed as basic tools applicable for transient gene expression as well as for stable integration of foreign genes into plant genomes. Improved Vector Cassettes for Gene Expression in Dicotyledonous Plants
Expression Vector Cassettes pRTIO0 to pRTI08 General Properties of Vectors. The vectors pRTI00-pRT108 (Fig. 1) are plant expression vector cassettes that permit expression of any gene of interest under the control of the 35S RNA promoter of CaMV and its corresponding polyadenylation [poly(A)] signal. The common feature of this set of vectors is the symmetrical arrangement of restriction sites (HindlII, SphI, and PstI) bordering both regulatory elements, providing the possibility for the simple transfer of a given chimeric construct to other vectors. The various vectors carry different polylinker sequences separating promoter and poly(A) signal sequences, as indicated schematically in Fig. 1 and at the nucleotide level in Fig. 2. With respect to application, some vectors are suitable for translational and others for transcriptional fusions. Vectors Suitable for Translational Fusions. pRT100, pRT102, pRT103, pRT104, pRTI07, and pRT108 carry an NcoI site providing an ATG codon, which can be used as the ATG codon for translational fusions. In pRT103, pRT104, pRTI07, and pRT108 the ATG is embedded in the consensus sequence for optimal ribosome initiation. ~8 Vectors Suitable for Transcriptional Fusions. pRT101, pRTI05, and pRT106 were designed to create transcriptional fusions, pRT105 and pRTI06 carry the pBluescript ~9multiple cloning site in both orientations. Construction ofpRTlO0 to pRTI08. All cloning was performed according to standard protocols as described by Sambrook et al. 2° The intergenic region of the CaMV genome carrying the 35S RNA promoter and the corresponding poly(A) signal were obtained as an 800-bp EcoRI fragment of CaMV Cabb B-D subcloned in phage fdl 1-6.z~An HphI site (at position 7437, referring to CaMV isolate CM184122) separating the promoter and 18 M. Kozak, Nucleic Acids Res. 2, 857 (1984). 19 Stratagene, 11099 North Torrey Pines Road, La Jolla, CA 92037. 2o j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NewYork, 1989. 21 V. Matzeit, Thesis. University of Cologne, Cologne, Germany, 1982. 22 R. C. Gardner, A. J. Howarth, P. Hahn, M. Brown-Luedi, R. Shepherd, and J. Messing, Nucleic Acids Res. 9, 2871 (1981).
:= ~ ,,4
v~ x
z,,,
z
m
x
'0
~, ~ - < [.-,
Y_ ~ W -"-/ ~ /
,--
-~ ~..T~
~ ~., 0
~ ~
> .=
0 "~ "~
6.~
~o
~ =
~,,
,8
X
0 8
0
~
~ < ~
69
'~
70 pRTIO0
VECTORS FOR EXPRESSING CLONED GENES ACctcgag...ggcccatgggcgagctcggtaccc
..........
[6]
ggggatcctctagagtcCG
pRTI01ACctcgag...aattc ...... gagctcggtaccc .......... ggggatcctctagagtcCG pRTI02 ACctcgag...ggcccatgggcgagctcggtaccc .......... gg ............... CG pRT103 ACctcgagtggccaccatgggcgagctcggtaccc .......... ggggatcctctagagtcCG pRTI04 ACctcgagtggccaccatgggcgagctcggtacccccgaattcggggggatcctctagagtcCG pRT105 ACccgagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattc gatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccagtcCG pRT106 ACcgggtaccgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag cccgggggatccactagttctagagcggccgccaccgcggtggagctcCG pRTI07 ACctcgagtggccaccatgggcgagctccaccgcgggggcggccgctctaEaactagtggatcc cccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccgg tacccgggtactcCG pRTl08 ACctcgagtggccaccatgggcgagctccaccgcEgtggcggccgctctagaactagtggatcc cccgggtactcCG FIG. 2. The nucleotide sequences of the multiple cloning site between the 35S R N A promoter and the corresponding poly(A) signal of each of the vectors pRT100 to pRTI08 are given. Nucleotides indicated in capital letters belong to the promoter (AC) and poly(A) signal sequence (CG), respectively. Lower-case letters describe the enti~ multiple cloning site.
poly(A) signal 4 bp downstream of the transcription initiation site was cut, converted to blunt ends with Klenow polymerase in the absence of nucleotides, and further digested with either HinclI (position 7016 of CM 1841) or RsaI (po sition 7639 of CM 1841 ). The promoter was subcloned into the HinclI and XhoI sites (filled in) of a modified pUC19 vector, which carried XhoI and NcoI restriction sites instead of SmaI and KpnI, respectively. The poly(A) signal was subcloned in the HinclI site of pUC18, a3 Promoter and terminator were combined using ScaI (in the ampicillin resistance gene of pUC) and SstI (in the multiple cloning site of pUC), resulting in the expression vector cassette pRT100 (Fig. 1). Sequence analysis of the construct revealed a 3-bp deletion at the 3' end of the promoter-carrying fragment, which most likely occurred during removal of the sticky ends of the HphI cleavage site, while leaving intact the transcription initiation site (Fig. 2). Thus, the CaMV sequence elements in pRT100 correspond to bp 7016-7434 (promoter) and bp 7436-7639 [poly(A) signal] of the CaMV isolate CM1841. 22 In addition to pRTI00, derivatives were constructed with modified multiple cloning sites between promoter and terminator (Figs. 1 and 2). 23 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985).
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
71
pRT101 to pRT104 have been described elsewhere. 24 pRT105 and pRT106 were created by insertion of KpnI and SstI linkers, respectively, into either the XhoI or XbaI site of pRT104 (compare with Fig. 2) and replacement of its polylinker by the pBluescript multiple cloning site. To obtain the vector pRT107, a KpnI linker was cloned in the S 1 nuclease-treated XbaI site of pRT104 following insertion of the pBluescript multiple cloning site into the KpnI and SstI sites, pRT108 is pRT107 with a Sinai deletion.
Plant Expression Vectors Based on these expression vector cassettes a number of fusions with different reporter genes have been constructed (Fig. 3), which were then used to investigate transient gene expression 25-z7or to establish transgenic plants. To use these expression vector cassettes for further constructions, restriction sites for cloning were chosen in such a way that a minimum of sites were maintained between promoter, structural gene, and poly(A) signal sequence. As indicated below, the sticky ends of a number of restriction fragments created during the cloning procedure were converted to blunt-ended fragments by S1 nulcease treatment prior to ligation. 1. The dhfr gene, conferring methotrexate resistance, was excised from plasmid pFR400 z~ using XbaI/NsiI and ligated with the expression vector pRT100, which was restricted with NcoI/XbaI. The sticky ends of these restriction fragments were removed by SI nuclease treatment and cloning resulted in the vector pRTlOOdhfr. 2. The hpt gene, coding for hygromycin resistance, was derived as a BamHI fragment from pHyml329 (B. Nelsen-Salz, unpublished results, 1982, which was treated with S1 nuclease. This fragment was cloned into the vector pRT100 (restricted with NcoI/XbaI) and treated with SI nuclease, leading to the plasmid pRTlOOhpt. 3. The choramphenicol acetyltransferase (cat) gene of pCAP2123o was subcloned as a BamHI fragment into both pRT101 and M13mp9, leading to pRTlOlcat 25 and M13mp9cat, respectively. An Ncol site at the first .,4 R. TOpfer, V. Matzeit, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 14, 5890 (1987). 25 M. Pr61s, R. T6pfer, J. ScheIl, and H.-H. Steinbiss, Plant Cell Rep. 7, 221 (1988). 26 R. T6pfer, M. Pr61s, J. Schell, and H.-H. Steinbiss, Plant Cell Rep. 7, 225 (1988). .,7 R. T6pfer, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Plant Cell 1, 133 (1989). 28 C. C. Simonsen and A. D. Levinson, Proc. Natl. Acad. Sci. U.S.A. 80, 2495 (1983). 29 Originally, the HPT coding sequence is derived from pVU 1011 (P. J. M. van den Elzen), which is equivalent to pLG90 [P. J. M. van den Elzen, J. Townsend, K. Y. Lee, and J. R. Bedbrook, Plant Mol. Biol. 5, 299 (1985)] but carries ATA instead of ATG in the untranslated 5' leader. 30 j. Velten and J. Schell, Nucleic Acids Res. 13, 6981 (1985).
72 HSPHII
VECTORS FOR EXPRESSING CLONED GENES
EV X Sc
Ss
---~m:~m~m-~'~ I pRT100dhfr
HSPHII
[6]
PSH
r////.g---
I
EV XSm E P
PSH
F/////2-
pRT'lOOhpt
HSPHII
EVXBN
BN Sc
PSH
pRTlO3cat HR
HSPHII
EVXBN
~VI~
---~.'.~-~JH~ii~iL~
EV
I
PSH
HII
I
~////2-
pRTlO3gus
HSPHII EVXBN P ~mamHwJ~.i( I
SN
II
PSH p-///,Y,L_.
pRTlO3neo HR
HSPHa
EVXBH
pRT103pat
S~ SS K
PSH ~bp
Fro. 3. Scheme describing the various expression vectors based on expression vector cassettes (Fig. 1). pRTI00 and pRTI03 were used to insert the coding sequences for dehydro-
folate reductase (DHFR), hygomycin phosphotransferase (HPT), chloramphenicol acetyltransferase (CAT), /3-glucuronidase (GUS), neomycin phosphotransferase (NPT II), and phosphinotricin acetyltransferase (PAT). In all of these constructs the cloning sites between the coding sequence and poly(A) signal have been deleted. Restriction endonuclease cleavage sites are abbreviated: B, Bali; E, EcoRI; EV, EcoRV; H, HindllI; HII, HinclI; K, KpnI; N, NcoI; P, PstI; S, SphI; Sa, Sail; Sc, ScaI; Sin, Smal; Ss, SstI; X, XhoI. The bar indicates 100 bp.
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
73
ATG codon of the CAT-coding region in M 13mp9cat was introduced using site-directed mutagenesis. 3~The modified cat gene was then inserted into pRTI03 using NcoI and BamHI. Finally, the remaining restriction endonuclease cleavage sites for BamHI and XbaI were removed using S1 nuclease, resulting in plasmid pRTlO3cat. 26 4. An NcoI/EcoRI fragment of pRAJ275,3z carrying the/3-glucuronidase (gus) gene, was cloned into pRT104. Deletion of the restriction sites EcoRI, BamHI, and XbaI was achieved by using S I nuclease treatment, thus creating pRTlO3gus. 26 5. pRTlO3neo z6 resulted from cloning of an NcoI (partially digested)/ BamHI fragment of pRT 100neo, carrying the neomycin phosphotransferase (neo) gene, into pRT 103 followed by removal of the remaining BamHI and XbaI site with S1 nuclease. 6. The bialaphos resistance (bar) gene from pGSFR133 was subcloned into pRT104 as an NcoI/BamHI fragment, subsequently digested with BamHI and XbaI, and the 5' protruding ends converted to blunt ends by S1 nuclease treatment, resulting in the plasmid pRTlO3pat. These vectors (except for the cat vectors) have also been used to create a related set of expression vectors: pRT55, pRT66, pRT77, pRT88, and pRT99 (Fig. 4). They are based on a pUC18 derivative whose PstI site has been substituted by NsiI and which carries a chimeric neomycin phosphotransferase II (NPT II) gene inserted into the MaeI site at position 1554 of pUC18. The NPT II gene of this basic construct, pRT99, 34 has been replaced by the structural genes for dehydrofolate reductase (DHFR--pRT55), hygromycin phosphotransferase (HPT--pRT66), phosphinotricin acetyltransferase (PAT--pRT77), and fl-glucuronidase (GUS--pRT88) using XhoI and PstI. These vectors are suitable for expression and transformation studies and they allow the possibility of cloning a fragment of DNA into the multiple cloning site, taking advantage of the blue/white selection via the lacZ system as in pUC plasmids. 23 Improved Vectors for Gene Expression in Monocotyledonous Plants As already described, the CaMV 35S RNA promoter is highly active in dicotyledonous plants. However, use of this promoter in monocotyle31 W. Kramer, V. Drutsa, H.-W. Jansen, B. Kramer, M. Pflugfelder, and H. Fritz, Nucleic Acids Res. 12, 9441 (1984). 32 R. A. Jefferson, Plant Mol. Biol. Rep. 5, 387 (1987). 33 M. De Block, J. Botterman, M. Vandewiele, J. Dockx, C. Thoen, V. Gossel& N. Rao Movva, C. Thompson, M. Van Montagu, and J. Leemans, EMBO J. 6, 2513 (1987). 34 R. T6pfer, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 16, 8725 (1988).
~::~ ~.~ ~
0", I'ne
0~0 ~
In
.i..-
x'
0..
-R
I00
,,e
I.-- u'~
l:'--
re"
,,.., ~
.
i
,.o~
4.
I--n,-
.a .,/
,"~w
C 0
"~
=
~, . _
o
r,-
,..,~
. o .~
< ~ ~ ~ ~ .-~ 0
I
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
75
donous plants revealed that gene expression from the CaMV 35S RNA promoter is only 0.1-1% of the level that can be achieved in dicotyledonous plants. Therefore, to increase gene expression in monocotyledonous plants, regulatory elements of the maize Shrunken 1 gene 35 were inserted into the expression vector pRTlOlcat 25(Fig. 5), resulting in the cassettes ~2 described in detail in the following section.
Vector Construction The constructs made use of sequences from the 5' untranslated region of the maize Shrunken 1 gene (Sh 1). A HinclI Sh 1 intron 1 fragment ( + 43 to + 1084) was isolated from a Shrunken 1 promoter clone containing sequences from - 1076 to + 1084 (pSP1076 + 108412). This Sh 1 intron 1 was inserted into the untranslated leader of the chimeric gene of pRT 101 cat by using the unique SmaI site, leading to the construct pRT-int/s-cat (Fig. 5). A sequence from the untranslated Sh 1 exon 1 ( + 4 C C C T C C C T C C CTCCTCCATT GGACTGCTTG CTCCCTGTT+42CCC) was synthesized and inserted into the Sinai site of pRTlOlcat, giving rise to the construct pRT-ex/s-cat (Fig. 5A). The 3'-CCC of the inserted oligonucleotide restored the SmaI site in pRT-ex/s-cat, which was used to insert the HinclI Sh 1 intron I fragment (+ 43 to + 1084) isolated from the Shrunken 1 clone pSP1076 + 1084, thus giving rise to the construct pRt-ex/s-int/s-cat (Fig. 5A).
Expression Studies To analyze these constructs protoplasts of a barley (Hordeum vulgare L. cv. 'Golden Promise '36) and tobacco suspension cell line (Nicotiana tabacum L. cv. W 38; H.-H. Steinbiss, unpublished observations) were used. Preparation of protoplasts from barley and tobacco was essentially as described for maize 37 except that an osmolarity of 720 mOsm was used. Transfection and analysis of CAT activity was as described previously.12'38 Transfection was carried out by using 25/zg plasmid DNA, 100/,~g sonicated calf thymus DNA, polyethylene glycol (PEG 1500) [25% (v/v) PEG, 0.1 M MgClz, pH 6.0], and 1 × 106 protoplasts. Expression was assessed after 40 hr of cultivation. Due to high CAT activities in undiluted extracts, dilutions were made (1 : 10, 1 : 100, and I : 1000) to obtain CAT activities in a linear range for densitometric scanning of autoradiographs. The results -~ W. Werr, W.-B. Frommer, C. Maas, and P. Starlinger, EMBO J. 5, 1373 (1985). 36 R. Liihrs and H. L6rz, Planta 175, 71 (1988). 37 C. Maas and W. Werr, Plant Cell Rep. 8, 148 (1989). ~8 C. Maas, S. Schaal, and W. Werr, EMBO J. 11, 3447 (1990).
76
VECTORS FOR EXPRESSINGCLONED GENES
•
A
HindllI
/
\ LSphI
(
~PstI
p R T 101cat
\\"
/ / BamHI
Hind III \ sphi ~ Pst I ~ H~ncI
/ / /~ / ..~.~Y
~
Xhol/
\ 4 42
II
pRT-ex/s-cat
Sma I
43
1084
I
~'
I
Sst I HindIII 4 42/43 []
~
tel. CAT activity 22 74
pRT-int/s-cat,
Barn HI XbaI 1084 1
!
Sst 1 HindIII
B
[6]
pRT-ex/s-int/s-cat
Barn HI XbaI
tobacco ex+int
(-)
barley 940
ex+int int
130
ex (-)
9 1 controls
no DNA CM only CAT enzyme 1,3
3
1
CM
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
77
of the 1/10 dilution (equal to 1 × 105 protoplasts) of the extracts (adjusted to give comparable amounts of protein) are shown in Fig. 5B. Comparison of pRTlOlcat expression in protoplasts of the monocot barley and the dicot tobacco clearly reveals the reduced activity of the CaMV 35S RNA promoter in monocotyledonous plants (Fig. 5B). Expression driven from this promoter in barley was enhanced up to 940-fold by the combined action of a Sh 1 exon 1 and an intron 1 segment inserted into the transcription unit (pRT-ex/s-int/s-cat). Individual stimulation of gene expression by either the Sh 1 exon 1 (pRT-ex/s-cat) or the Sh 1 intron 1 (pRT-int/s-cat) is also observed. These results compare quite well with the data obtained by using protoplasts of other monocotyledonous plant species: Oryza sativa, Panicum maximum, Pennisetum purpureum, and Zea mays. 12,14 Data obtained from these experiments imply that the ninefold stimulation by Sh 1 exon 1, which is conserved among angiosperms, must occur at the transcriptional level. A position just downstream of the transcription start site is highly unusual for an RNA polymerase II-dependent transcriptional activator. However, reports concerning the human glial fibrilliary acidic protein 39 and the adenovirus IVa2 gene 4° have revealed other members of this new class of RNA polymerase II-dependent transcriptional activators. The dramatic 130-fold stimulation of gene expression by the Shrunken 1 intron 1 appears to be closely linked to the splicing process. Stimulation 39 y . Nakatani, M. Horikoshi, M. Brenner, T. Yamamoto, F. Besnard, R. Roeder, and E. Freese, Nature (London) 348, 87 (1990). 4o j. Carcamo, E. Maldonado, P. Cortes, M.-H. Ahn, I. Ha, Y. Kasai, J. Flint, and D. Reinberg, Genes Dev. 4, 1611 (1990).
FIG. 5. (A) Chimeric gene constructions used in transient gene expression experiments. From the maize Shrunken 1 (Sh 1) gene the Sh 1 exon (represented by the black boxes) and/or the Sh 1 intron 1 (represented by the open boxes, "intron 1") were inserted into the Sinai site of plasmid pRTlOlcat. The position of the terminal nucleotides of both Sh 1 elements is indicated. Restriction sites relevant for cloning have been included, ex, exon 1; int, intron 1 ; s, sense orientation of the insert. (B) Result of a CAT assay performed with a 1 : 10 dilution of crude extracts of tobacco and barley protoplasts that were homogenized 40 hr after DNA delivery, Relative CAT activity of barley protoplasts transfected with pRTlOlcat (--) is referred to 1. The constructions used have been indicated in abbreviated form beside the corresponding lane: (--), pRTlOlcat; ex, pRT-ex/s-cat; int, pRT-int/s-cat; ex + int, pRT-ex/s-int/s-cat. Autoradiographs were scanned densitometrically. CM, [~4Clchloramphenicol; CAT enzyme, chloramphenicol acetyltransferase enzyme; CM only, only [t4C]chloramphenicol was loaded; no DNA, protein extract of untransfected protoplasts was used; 1, 3, 3, 1, CM, acetylation products of the CAT reaction.
78
VECTORS FOR EXPRESSING CLONED GENES
[6]
can be observed only when intron 1 is positioned in the transcription unit and in the sense orientation. 12Data obtained from animal model systems imply that the molecular nature of stimulation by insertion of intron sequences is mainly due to the formation of spliceosomes and an increased resistance of the primary transcript to turnover processes by nuclease attack in the nucleus. 41 The failure of exon 1/intron 1 to stimulate gene expression in tobacco (pRT-ex/s-int/s-cat shows a 70% reduced value as compared to pRTlOlcat) could be due to apparent differences in the splicing process (e.g., formation of spliceosomes by correct splice site recognition) between monocotyledonous and dicotyledonous cells. 42'43 In conclusion, improvement of the cassette pRTlOlcat to produce pRT-ex/s-int/s-cat gave us a construct leading to a high level of gene expression in monocotyledonous plants and in particular in agronomically important cereals. The construct pRT-ex/s-int/s-cat has been constructed to facilitate the replacement of the CAT-coding region as a BamHI or XbaI fragment or an exchange of the promoter region as a HinclI/XhoI or HinclI/KpnI fragment. The entire chimeric gene can be transferred to other vectors using PstI or SphI. Moreover, the construct pRT-ex/s-int/scat might be helpful for the analysis of plant promoters or to achieve high levels of gene product in transgenic plants. Acknowledgment A part of this work was supported financially by Hoechst AG Frankfurt am Main, Germany.
41 A. R. Buchman and P. Berg, Mol. Cell Biol. 8, 4395 (1988). 42 B. Keith and N.-H. Chua, EMBO J. 5, 2419 (1986). 43 G. J. Godall and W. Filipowicz, Cell 30, 763 (1989).
VECTORS FOR EXPRESSING CLONED GENES
[6]
required. The advantage over other stable expression systems is the ease of selecting producer clones, not the height of expression. The expression levels are always lower in stable systems compared with the lytic viral ones. We tried to make use of the excess of T7 polymerase present in the nucleus of some clones by using episomal origin vectors. However, up to now the levels of expression could be enhanced only two- to fourfold. 44 We are currently working on the establishment of regulated systems that might allow a higher level of expression for a short period of time. The chief advantage of the modified T7 system based on mutant promoters is the strong dependence on transcription by T7 RNA polymerase. Thus, the system can be used for all purposes of selective gene expression. Cell lines or even transgenic mice carrying silent genes under the control of a mutant promoter can be established and their expression can be stimulated via subsequent introduction of T7 polymerase, for example, by retroviral vectors. Alternatively, inducible repressor systems could be used to repress either the T7 promoter or T7 polymerase expression. Additional useful applications are the expression of bi- or polycistronic mRNA as well as the efficient expression of antisense RNA or ribozymes. 44 V, Sandig and M. Strauss, unpublished observations 0991),
[6] E x p r e s s i o n V e c t o r s f o r H i g h - L e v e l G e n e E x p r e s s i o n in Dicotyledonous and Monocotyledonous Plants By REINHARD TOPFER, CHRISTOPH MAAS, CHRISTA H(SRICKE-GRANDPIERRE, J E F F SCHELL,
and
H A N S - H E N N I N G STEINBISS
Introduction High-level expression of selectable marker genes as well as that of agronomically important genes is a crucial aspect of plant molecular biology. The first chimeric genes for plant transformation experiments consisted of bacterial antibiotic resistance genes controlled by promoters derived from genes carried by the T-DNA region ofAgrobacterium tumefaciens Ti plasmids. ~-3 A second generation of constructs made use of the L. Herrera-Estrella, M. De Block, E. Messens, J.-P. Hernalsteens, M. Van Montagu, and J. Schell, EMBO J. 2, 987 (1983). M. Bevan, R. B. Flavell, and M.-D. Chilton, Nature (London) 304, 184 (1983).
METHODS IN ENZYMOLOGY,VOL.217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
67
s t r o n g e r 355 R N A p r o m o t e r o f the cauliflower m o s a i c virus ( C a M V ) , w h i c h in fact has p r o v e d to be o n e o f the m o s t effective and best c h a r a c t e r ized plant p r o m o t e r s . 4-7 This p r o m o t e r has b e e n u s e d to create e x p r e s s i o n v e c t o r c a s s e t t e s s u c h as pDH51,8 p M O N 3 1 6 , 9 and pRT100,~° with w h i c h high levels o f gene e x p r e s s i o n c a n be o b t a i n e d in a variety o f plant tissues. Interestingly, the transcriptional activity o f this p r o m o t e r could be stimulated up to 10-fold b y duplication o f the C a M V 355 e n h a n c e r s e q u e n c e s ~ or b y insertion o f a 42-bp S h r u n k e n 1 e x o n 1 s e q u e n c e j u s t d o w n s t r e a m o f the t r a n s c r i p t i o n start site. 12 M o r e o v e r , it has b e e n s h o w n that gene e x p r e s s i o n c a n also be m o d u l a t e d significantly at the posttranscriptional level. I n c l u s i o n o f introns in the t r a n s c r i p t i o n unit s e e m to influence stability o f the transcript, leading to an e n h a n c e m e n t o f gene e x p r e s s i o n of up to 150-fold. t2-14 T h e use o f different 3' p o l y ( A ) cassettes resulted in differences in gene e x p r e s s i o n o f up to 60-fold. ~5 T h e translational effic i e n c y o f c h i m e r i c transcripts w a s s h o w n to be increased by insertion o f viral u n t r a n s l a t e d leader s e q u e n c e s in the 5' u n t r a n s l a t e d region o f the t r a n s c r i p t i o n unit, resulting in an e n h a n c e d level o f gene e x p r e s s i o n o f up to 3 5 - f o l d ) 6A7 This c h a p t e r d e s c r i b e s sets o f v e c t o r s that are derivatives of the expression v e c t o r c a s s e t t e pRT100, w h i c h uses the C a M V 355 R N A p r o m o t e r in c o m b i n a t i o n with v a r i o u s r e p o r t e r and selectable m a r k e r genes. F u r t h e r m o r e , w e i n t r o d u c e a set o f e x p r e s s i o n v e c t o r s f o r e n h a n c e d gene expression in m o n o c o t y l e d o n o u s plants, especially a g r o n o m i c a l l y i m p o r t a n t ce-
3 R. T. Fraley, S. G. Rogers, R. B. Horsch, P. R. Sanders, J. S. Flick, S. P. Adams, M. L. Bittner, L. A. Brand, C. L. Fink, J. S. Fry, G. R. Galuppi, S. B. Goldberg, N. L. Hoffmann, and S. C. Woo, Proc. Natl. Acad. Sci. U,S.A. 80, 4803 (1983). 4 j. T. Odell, F. Nagy, and N.-H. Chua, Nature (London) 313, 810 (1985). D. W. Ow, J. D. Jacobs, and S. H. Howell, Proc. Natl. Acad. Sci. U.S.A. 84, 4870 (1987). 6 R.-X. Fang, F, Nagy, S. Sivasubramaniam, and N.-H. Chua, Plant Cell 1, 141 (1989). 7 p. N. Benfey and N.-H. Chua, Science 250, 959 (1990). 8 M. Pietrzak, R. D. Shillito, T. Hohn, and I. Potrykus, Nucleic Acids Res. 14, 5857 (1986). 9 S. G. Rogers, H. J. Klee, R. B. Horsch, and R. T. Fraley, this series, Vol. 153, p. 253. I0 R. TOpfer, V. Matzeit, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 14, 5890 (1987). 11R. Kay, A. Cahan, M. Daly, and J. McPherson, Science 236, 1299 (1987). ~2C. Maas, J. Laufs, S. Grant, C. Korfhage, and W. Werr, Plant Mol. Biol. 16, 199 (1991). ~3j. Callis, M. Fromm, and V. Walbot, Genes Dev. 1, 1183 (1987). t4 V. Vasil, M. Clancy, R. J. Ferl, 1. K. Vasil, and C. Hannah, Plant Physiol. 91, 1575 (1989). ~51. L. W. Ingelbrecht, L. M. F. Herman, R. A. Dekeyser, M. C. Van Montagu, and A. G. Depicker, Plant Cell 1, 671 (1989). 16S. A. Jobling and L. Gehrke, Nature (London) 325, 622 (1987). 17D. R. Gallie, D. E. Sleat, J. W. Watts, P. C. Turner, and T. M. A. Wilson, Nucleic Acids Res. 15, 3257 (1987).
68
VECTORS FOR EXPRESSING CLONED GENES
[6]
reals. These vectors have been constructed as basic tools applicable for transient gene expression as well as for stable integration of foreign genes into plant genomes. Improved Vector Cassettes for Gene Expression in Dicotyledonous Plants
Expression Vector Cassettes pRTIO0 to pRTI08 General Properties of Vectors. The vectors pRTI00-pRT108 (Fig. 1) are plant expression vector cassettes that permit expression of any gene of interest under the control of the 35S RNA promoter of CaMV and its corresponding polyadenylation [poly(A)] signal. The common feature of this set of vectors is the symmetrical arrangement of restriction sites (HindlII, SphI, and PstI) bordering both regulatory elements, providing the possibility for the simple transfer of a given chimeric construct to other vectors. The various vectors carry different polylinker sequences separating promoter and poly(A) signal sequences, as indicated schematically in Fig. 1 and at the nucleotide level in Fig. 2. With respect to application, some vectors are suitable for translational and others for transcriptional fusions. Vectors Suitable for Translational Fusions. pRT100, pRT102, pRT103, pRT104, pRTI07, and pRT108 carry an NcoI site providing an ATG codon, which can be used as the ATG codon for translational fusions. In pRT103, pRT104, pRTI07, and pRT108 the ATG is embedded in the consensus sequence for optimal ribosome initiation. ~8 Vectors Suitable for Transcriptional Fusions. pRT101, pRTI05, and pRT106 were designed to create transcriptional fusions, pRT105 and pRTI06 carry the pBluescript ~9multiple cloning site in both orientations. Construction ofpRTlO0 to pRTI08. All cloning was performed according to standard protocols as described by Sambrook et al. 2° The intergenic region of the CaMV genome carrying the 35S RNA promoter and the corresponding poly(A) signal were obtained as an 800-bp EcoRI fragment of CaMV Cabb B-D subcloned in phage fdl 1-6.z~An HphI site (at position 7437, referring to CaMV isolate CM184122) separating the promoter and 18 M. Kozak, Nucleic Acids Res. 2, 857 (1984). 19 Stratagene, 11099 North Torrey Pines Road, La Jolla, CA 92037. 2o j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NewYork, 1989. 21 V. Matzeit, Thesis. University of Cologne, Cologne, Germany, 1982. 22 R. C. Gardner, A. J. Howarth, P. Hahn, M. Brown-Luedi, R. Shepherd, and J. Messing, Nucleic Acids Res. 9, 2871 (1981).
:= ~ ,,4
v~ x
z,,,
z
m
x
'0
~, ~ - < [.-,
Y_ ~ W -"-/ ~ /
,--
-~ ~..T~
~ ~., 0
~ ~
> .=
0 "~ "~
6.~
~o
~ =
~,,
,8
X
0 8
0
~
~ < ~
69
'~
70 pRTIO0
VECTORS FOR EXPRESSING CLONED GENES ACctcgag...ggcccatgggcgagctcggtaccc
..........
[6]
ggggatcctctagagtcCG
pRTI01ACctcgag...aattc ...... gagctcggtaccc .......... ggggatcctctagagtcCG pRTI02 ACctcgag...ggcccatgggcgagctcggtaccc .......... gg ............... CG pRT103 ACctcgagtggccaccatgggcgagctcggtaccc .......... ggggatcctctagagtcCG pRTI04 ACctcgagtggccaccatgggcgagctcggtacccccgaattcggggggatcctctagagtcCG pRT105 ACccgagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattc gatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccagtcCG pRT106 ACcgggtaccgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag cccgggggatccactagttctagagcggccgccaccgcggtggagctcCG pRTI07 ACctcgagtggccaccatgggcgagctccaccgcgggggcggccgctctaEaactagtggatcc cccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccgg tacccgggtactcCG pRTl08 ACctcgagtggccaccatgggcgagctccaccgcEgtggcggccgctctagaactagtggatcc cccgggtactcCG FIG. 2. The nucleotide sequences of the multiple cloning site between the 35S R N A promoter and the corresponding poly(A) signal of each of the vectors pRT100 to pRTI08 are given. Nucleotides indicated in capital letters belong to the promoter (AC) and poly(A) signal sequence (CG), respectively. Lower-case letters describe the enti~ multiple cloning site.
poly(A) signal 4 bp downstream of the transcription initiation site was cut, converted to blunt ends with Klenow polymerase in the absence of nucleotides, and further digested with either HinclI (position 7016 of CM 1841) or RsaI (po sition 7639 of CM 1841 ). The promoter was subcloned into the HinclI and XhoI sites (filled in) of a modified pUC19 vector, which carried XhoI and NcoI restriction sites instead of SmaI and KpnI, respectively. The poly(A) signal was subcloned in the HinclI site of pUC18, a3 Promoter and terminator were combined using ScaI (in the ampicillin resistance gene of pUC) and SstI (in the multiple cloning site of pUC), resulting in the expression vector cassette pRT100 (Fig. 1). Sequence analysis of the construct revealed a 3-bp deletion at the 3' end of the promoter-carrying fragment, which most likely occurred during removal of the sticky ends of the HphI cleavage site, while leaving intact the transcription initiation site (Fig. 2). Thus, the CaMV sequence elements in pRT100 correspond to bp 7016-7434 (promoter) and bp 7436-7639 [poly(A) signal] of the CaMV isolate CM1841. 22 In addition to pRTI00, derivatives were constructed with modified multiple cloning sites between promoter and terminator (Figs. 1 and 2). 23 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985).
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
71
pRT101 to pRT104 have been described elsewhere. 24 pRT105 and pRT106 were created by insertion of KpnI and SstI linkers, respectively, into either the XhoI or XbaI site of pRT104 (compare with Fig. 2) and replacement of its polylinker by the pBluescript multiple cloning site. To obtain the vector pRT107, a KpnI linker was cloned in the S 1 nuclease-treated XbaI site of pRT104 following insertion of the pBluescript multiple cloning site into the KpnI and SstI sites, pRT108 is pRT107 with a Sinai deletion.
Plant Expression Vectors Based on these expression vector cassettes a number of fusions with different reporter genes have been constructed (Fig. 3), which were then used to investigate transient gene expression 25-z7or to establish transgenic plants. To use these expression vector cassettes for further constructions, restriction sites for cloning were chosen in such a way that a minimum of sites were maintained between promoter, structural gene, and poly(A) signal sequence. As indicated below, the sticky ends of a number of restriction fragments created during the cloning procedure were converted to blunt-ended fragments by S1 nulcease treatment prior to ligation. 1. The dhfr gene, conferring methotrexate resistance, was excised from plasmid pFR400 z~ using XbaI/NsiI and ligated with the expression vector pRT100, which was restricted with NcoI/XbaI. The sticky ends of these restriction fragments were removed by SI nuclease treatment and cloning resulted in the vector pRTlOOdhfr. 2. The hpt gene, coding for hygromycin resistance, was derived as a BamHI fragment from pHyml329 (B. Nelsen-Salz, unpublished results, 1982, which was treated with S1 nuclease. This fragment was cloned into the vector pRT100 (restricted with NcoI/XbaI) and treated with SI nuclease, leading to the plasmid pRTlOOhpt. 3. The choramphenicol acetyltransferase (cat) gene of pCAP2123o was subcloned as a BamHI fragment into both pRT101 and M13mp9, leading to pRTlOlcat 25 and M13mp9cat, respectively. An Ncol site at the first .,4 R. TOpfer, V. Matzeit, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 14, 5890 (1987). 25 M. Pr61s, R. T6pfer, J. ScheIl, and H.-H. Steinbiss, Plant Cell Rep. 7, 221 (1988). 26 R. T6pfer, M. Pr61s, J. Schell, and H.-H. Steinbiss, Plant Cell Rep. 7, 225 (1988). .,7 R. T6pfer, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Plant Cell 1, 133 (1989). 28 C. C. Simonsen and A. D. Levinson, Proc. Natl. Acad. Sci. U.S.A. 80, 2495 (1983). 29 Originally, the HPT coding sequence is derived from pVU 1011 (P. J. M. van den Elzen), which is equivalent to pLG90 [P. J. M. van den Elzen, J. Townsend, K. Y. Lee, and J. R. Bedbrook, Plant Mol. Biol. 5, 299 (1985)] but carries ATA instead of ATG in the untranslated 5' leader. 30 j. Velten and J. Schell, Nucleic Acids Res. 13, 6981 (1985).
72 HSPHII
VECTORS FOR EXPRESSING CLONED GENES
EV X Sc
Ss
---~m:~m~m-~'~ I pRT100dhfr
HSPHII
[6]
PSH
r////.g---
I
EV XSm E P
PSH
F/////2-
pRT'lOOhpt
HSPHII
EVXBN
BN Sc
PSH
pRTlO3cat HR
HSPHII
EVXBN
~VI~
---~.'.~-~JH~ii~iL~
EV
I
PSH
HII
I
~////2-
pRTlO3gus
HSPHII EVXBN P ~mamHwJ~.i( I
SN
II
PSH p-///,Y,L_.
pRTlO3neo HR
HSPHa
EVXBH
pRT103pat
S~ SS K
PSH ~bp
Fro. 3. Scheme describing the various expression vectors based on expression vector cassettes (Fig. 1). pRTI00 and pRTI03 were used to insert the coding sequences for dehydro-
folate reductase (DHFR), hygomycin phosphotransferase (HPT), chloramphenicol acetyltransferase (CAT), /3-glucuronidase (GUS), neomycin phosphotransferase (NPT II), and phosphinotricin acetyltransferase (PAT). In all of these constructs the cloning sites between the coding sequence and poly(A) signal have been deleted. Restriction endonuclease cleavage sites are abbreviated: B, Bali; E, EcoRI; EV, EcoRV; H, HindllI; HII, HinclI; K, KpnI; N, NcoI; P, PstI; S, SphI; Sa, Sail; Sc, ScaI; Sin, Smal; Ss, SstI; X, XhoI. The bar indicates 100 bp.
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
73
ATG codon of the CAT-coding region in M 13mp9cat was introduced using site-directed mutagenesis. 3~The modified cat gene was then inserted into pRTI03 using NcoI and BamHI. Finally, the remaining restriction endonuclease cleavage sites for BamHI and XbaI were removed using S1 nuclease, resulting in plasmid pRTlO3cat. 26 4. An NcoI/EcoRI fragment of pRAJ275,3z carrying the/3-glucuronidase (gus) gene, was cloned into pRT104. Deletion of the restriction sites EcoRI, BamHI, and XbaI was achieved by using S I nuclease treatment, thus creating pRTlO3gus. 26 5. pRTlO3neo z6 resulted from cloning of an NcoI (partially digested)/ BamHI fragment of pRT 100neo, carrying the neomycin phosphotransferase (neo) gene, into pRT 103 followed by removal of the remaining BamHI and XbaI site with S1 nuclease. 6. The bialaphos resistance (bar) gene from pGSFR133 was subcloned into pRT104 as an NcoI/BamHI fragment, subsequently digested with BamHI and XbaI, and the 5' protruding ends converted to blunt ends by S1 nuclease treatment, resulting in the plasmid pRTlO3pat. These vectors (except for the cat vectors) have also been used to create a related set of expression vectors: pRT55, pRT66, pRT77, pRT88, and pRT99 (Fig. 4). They are based on a pUC18 derivative whose PstI site has been substituted by NsiI and which carries a chimeric neomycin phosphotransferase II (NPT II) gene inserted into the MaeI site at position 1554 of pUC18. The NPT II gene of this basic construct, pRT99, 34 has been replaced by the structural genes for dehydrofolate reductase (DHFR--pRT55), hygromycin phosphotransferase (HPT--pRT66), phosphinotricin acetyltransferase (PAT--pRT77), and fl-glucuronidase (GUS--pRT88) using XhoI and PstI. These vectors are suitable for expression and transformation studies and they allow the possibility of cloning a fragment of DNA into the multiple cloning site, taking advantage of the blue/white selection via the lacZ system as in pUC plasmids. 23 Improved Vectors for Gene Expression in Monocotyledonous Plants As already described, the CaMV 35S RNA promoter is highly active in dicotyledonous plants. However, use of this promoter in monocotyle31 W. Kramer, V. Drutsa, H.-W. Jansen, B. Kramer, M. Pflugfelder, and H. Fritz, Nucleic Acids Res. 12, 9441 (1984). 32 R. A. Jefferson, Plant Mol. Biol. Rep. 5, 387 (1987). 33 M. De Block, J. Botterman, M. Vandewiele, J. Dockx, C. Thoen, V. Gossel& N. Rao Movva, C. Thompson, M. Van Montagu, and J. Leemans, EMBO J. 6, 2513 (1987). 34 R. T6pfer, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 16, 8725 (1988).
~::~ ~.~ ~
0", I'ne
0~0 ~
In
.i..-
x'
0..
-R
I00
,,e
I.-- u'~
l:'--
re"
,,.., ~
.
i
,.o~
4.
I--n,-
.a .,/
,"~w
C 0
"~
=
~, . _
o
r,-
,..,~
. o .~
< ~ ~ ~ ~ .-~ 0
I
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
75
donous plants revealed that gene expression from the CaMV 35S RNA promoter is only 0.1-1% of the level that can be achieved in dicotyledonous plants. Therefore, to increase gene expression in monocotyledonous plants, regulatory elements of the maize Shrunken 1 gene 35 were inserted into the expression vector pRTlOlcat 25(Fig. 5), resulting in the cassettes ~2 described in detail in the following section.
Vector Construction The constructs made use of sequences from the 5' untranslated region of the maize Shrunken 1 gene (Sh 1). A HinclI Sh 1 intron 1 fragment ( + 43 to + 1084) was isolated from a Shrunken 1 promoter clone containing sequences from - 1076 to + 1084 (pSP1076 + 108412). This Sh 1 intron 1 was inserted into the untranslated leader of the chimeric gene of pRT 101 cat by using the unique SmaI site, leading to the construct pRT-int/s-cat (Fig. 5). A sequence from the untranslated Sh 1 exon 1 ( + 4 C C C T C C C T C C CTCCTCCATT GGACTGCTTG CTCCCTGTT+42CCC) was synthesized and inserted into the Sinai site of pRTlOlcat, giving rise to the construct pRT-ex/s-cat (Fig. 5A). The 3'-CCC of the inserted oligonucleotide restored the SmaI site in pRT-ex/s-cat, which was used to insert the HinclI Sh 1 intron I fragment (+ 43 to + 1084) isolated from the Shrunken 1 clone pSP1076 + 1084, thus giving rise to the construct pRt-ex/s-int/s-cat (Fig. 5A).
Expression Studies To analyze these constructs protoplasts of a barley (Hordeum vulgare L. cv. 'Golden Promise '36) and tobacco suspension cell line (Nicotiana tabacum L. cv. W 38; H.-H. Steinbiss, unpublished observations) were used. Preparation of protoplasts from barley and tobacco was essentially as described for maize 37 except that an osmolarity of 720 mOsm was used. Transfection and analysis of CAT activity was as described previously.12'38 Transfection was carried out by using 25/zg plasmid DNA, 100/,~g sonicated calf thymus DNA, polyethylene glycol (PEG 1500) [25% (v/v) PEG, 0.1 M MgClz, pH 6.0], and 1 × 106 protoplasts. Expression was assessed after 40 hr of cultivation. Due to high CAT activities in undiluted extracts, dilutions were made (1 : 10, 1 : 100, and I : 1000) to obtain CAT activities in a linear range for densitometric scanning of autoradiographs. The results -~ W. Werr, W.-B. Frommer, C. Maas, and P. Starlinger, EMBO J. 5, 1373 (1985). 36 R. Liihrs and H. L6rz, Planta 175, 71 (1988). 37 C. Maas and W. Werr, Plant Cell Rep. 8, 148 (1989). ~8 C. Maas, S. Schaal, and W. Werr, EMBO J. 11, 3447 (1990).
76
VECTORS FOR EXPRESSINGCLONED GENES
•
A
HindllI
/
\ LSphI
(
~PstI
p R T 101cat
\\"
/ / BamHI
Hind III \ sphi ~ Pst I ~ H~ncI
/ / /~ / ..~.~Y
~
Xhol/
\ 4 42
II
pRT-ex/s-cat
Sma I
43
1084
I
~'
I
Sst I HindIII 4 42/43 []
~
tel. CAT activity 22 74
pRT-int/s-cat,
Barn HI XbaI 1084 1
!
Sst 1 HindIII
B
[6]
pRT-ex/s-int/s-cat
Barn HI XbaI
tobacco ex+int
(-)
barley 940
ex+int int
130
ex (-)
9 1 controls
no DNA CM only CAT enzyme 1,3
3
1
CM
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
77
of the 1/10 dilution (equal to 1 × 105 protoplasts) of the extracts (adjusted to give comparable amounts of protein) are shown in Fig. 5B. Comparison of pRTlOlcat expression in protoplasts of the monocot barley and the dicot tobacco clearly reveals the reduced activity of the CaMV 35S RNA promoter in monocotyledonous plants (Fig. 5B). Expression driven from this promoter in barley was enhanced up to 940-fold by the combined action of a Sh 1 exon 1 and an intron 1 segment inserted into the transcription unit (pRT-ex/s-int/s-cat). Individual stimulation of gene expression by either the Sh 1 exon 1 (pRT-ex/s-cat) or the Sh 1 intron 1 (pRT-int/s-cat) is also observed. These results compare quite well with the data obtained by using protoplasts of other monocotyledonous plant species: Oryza sativa, Panicum maximum, Pennisetum purpureum, and Zea mays. 12,14 Data obtained from these experiments imply that the ninefold stimulation by Sh 1 exon 1, which is conserved among angiosperms, must occur at the transcriptional level. A position just downstream of the transcription start site is highly unusual for an RNA polymerase II-dependent transcriptional activator. However, reports concerning the human glial fibrilliary acidic protein 39 and the adenovirus IVa2 gene 4° have revealed other members of this new class of RNA polymerase II-dependent transcriptional activators. The dramatic 130-fold stimulation of gene expression by the Shrunken 1 intron 1 appears to be closely linked to the splicing process. Stimulation 39 y . Nakatani, M. Horikoshi, M. Brenner, T. Yamamoto, F. Besnard, R. Roeder, and E. Freese, Nature (London) 348, 87 (1990). 4o j. Carcamo, E. Maldonado, P. Cortes, M.-H. Ahn, I. Ha, Y. Kasai, J. Flint, and D. Reinberg, Genes Dev. 4, 1611 (1990).
FIG. 5. (A) Chimeric gene constructions used in transient gene expression experiments. From the maize Shrunken 1 (Sh 1) gene the Sh 1 exon (represented by the black boxes) and/or the Sh 1 intron 1 (represented by the open boxes, "intron 1") were inserted into the Sinai site of plasmid pRTlOlcat. The position of the terminal nucleotides of both Sh 1 elements is indicated. Restriction sites relevant for cloning have been included, ex, exon 1; int, intron 1 ; s, sense orientation of the insert. (B) Result of a CAT assay performed with a 1 : 10 dilution of crude extracts of tobacco and barley protoplasts that were homogenized 40 hr after DNA delivery, Relative CAT activity of barley protoplasts transfected with pRTlOlcat (--) is referred to 1. The constructions used have been indicated in abbreviated form beside the corresponding lane: (--), pRTlOlcat; ex, pRT-ex/s-cat; int, pRT-int/s-cat; ex + int, pRT-ex/s-int/s-cat. Autoradiographs were scanned densitometrically. CM, [~4Clchloramphenicol; CAT enzyme, chloramphenicol acetyltransferase enzyme; CM only, only [t4C]chloramphenicol was loaded; no DNA, protein extract of untransfected protoplasts was used; 1, 3, 3, 1, CM, acetylation products of the CAT reaction.
78
VECTORS FOR EXPRESSING CLONED GENES
[6]
can be observed only when intron 1 is positioned in the transcription unit and in the sense orientation. 12Data obtained from animal model systems imply that the molecular nature of stimulation by insertion of intron sequences is mainly due to the formation of spliceosomes and an increased resistance of the primary transcript to turnover processes by nuclease attack in the nucleus. 41 The failure of exon 1/intron 1 to stimulate gene expression in tobacco (pRT-ex/s-int/s-cat shows a 70% reduced value as compared to pRTlOlcat) could be due to apparent differences in the splicing process (e.g., formation of spliceosomes by correct splice site recognition) between monocotyledonous and dicotyledonous cells. 42'43 In conclusion, improvement of the cassette pRTlOlcat to produce pRT-ex/s-int/s-cat gave us a construct leading to a high level of gene expression in monocotyledonous plants and in particular in agronomically important cereals. The construct pRT-ex/s-int/s-cat has been constructed to facilitate the replacement of the CAT-coding region as a BamHI or XbaI fragment or an exchange of the promoter region as a HinclI/XhoI or HinclI/KpnI fragment. The entire chimeric gene can be transferred to other vectors using PstI or SphI. Moreover, the construct pRT-ex/s-int/scat might be helpful for the analysis of plant promoters or to achieve high levels of gene product in transgenic plants. Acknowledgment A part of this work was supported financially by Hoechst AG Frankfurt am Main, Germany.
41 A. R. Buchman and P. Berg, Mol. Cell Biol. 8, 4395 (1988). 42 B. Keith and N.-H. Chua, EMBO J. 5, 2419 (1986). 43 G. J. Godall and W. Filipowicz, Cell 30, 763 (1989).