9 Parathyroid hormone-related protein: A novel gene product

9 Parathyroid hormone-related protein: a novel gene product T. J. M A R T I N L. J. S U V A

The study of abnormal calcium metabolism in cancer has led to the isolation and cloning of a previously unrecognized hormone which is related structurally to parathyroid hormone (PTH). Indeed, this new protein may be the predecessor in evolution of PTH, which could have arisen by a process of gene duplication. This chapter reviews the discovery and properties of the PTH-related protein (PTHrP).

Malignant hypercalcaemia and ectopic PTH Several malignant tumours in man and animals have profound effects on bone and bone mineral metabolism. It was noted more than 40 years ago that hypercalcaemia could occur in association with cancers in the absence of any bony metastases, and it was suggested by Albright (1941) that this was due to inappropriate production by the cancers of PTH or a PTH-like substance. This signalled the development of the 'ectopic PTH' concept as the explanation for hypercalcaemia in cancer without significant bone metastases. The term came to be applied to those turnouts associated with the syndrome, most commonly squamous cell carcinoma of the lung, renal cortical carcinoma, epithelial cancers of various sites, and less commonly other tumours including those of liver, gastrointestinal tract, ovary and pancreas. In these patients the biochemical features resembled those of patients with primary hyperparathyroidism, with elevated plasma calcium and lowered phosphorus, so that the concept of the ectopic PTH syndrome seemed a reasonable one, it became established in the literature (Lafferty, 1966) and remained there. When the first radioimmunoassays for PTH were developed, they provided supporting evidence for the concept. Thus Berson and Yalow (1966) found significantly elevated levels of PTH in normocalcaemic patients with bronchogenic cancer, and in the next few years several reports appeared of the measurement of PTH by radioimmunoassay in plasma or tumour extracts from patients with this syndrome (Sherwood et al, 1967; Buckle et al, 1970; Knill-Jones et al, 1970; Melick et al, 1972). An arteriovenous gradient of PTH across a hepatic tumour bed was described (Knill-Jones et al, 1970) .and, in cell culture established from a renal cortical Bailli~re's Clinical Endocrinology and Metabolism--Vol. 2, No. 4, November 1988

1003

1004

Z . J . MARTIN AND L. J. SUVA

carcinoma of a hypercalcaemic patient, we demonstrated synthesis of protein precipitable by an anti-PTH antiserum (Greenberg et al, 1973). In none of these instances, however, were circulating levels of PTH as high as those frequently found in patients with primary hyperparathyroidism who had comparable elevations of plasma calcium. Furthermore, when the data of those early publications are reviewed now, in the light of the known structure of PTHrP, it is possible to explain virtually all of the observations by the production of PTHrP rather than PTH. This will be discussed later in this chapter. The same comment applies to evidence from immunohistology data for the ectopic PTH concept. As late as the 1980s, immunohistochemical studies of some tumours from hypocalcaemic cancer patients indicated the presence of PTH-like immunoreactivity (Mayes et al, 1984; Gonzalez et al, 1985; Hardi and Faro, 1985). Thus, the general view until the 1970s was that the syndrome of hypercalcaemia in cancer without bony metastases was probably due to ectopic production of PTH. It seemed to accord with the data and fitted with other ideas and observations of ectopic humoral syndromes which were of interest at that time (Rees and Ratcliffe, 1974).

Humoral hypercalcaemia of malignancy When radioimmunoassays for PTH began to improve, the early 1970s saw some doubt beginning to emerge about the involvement of PTH in the cancer syndrome. Two groups of workers published results indicating that the circulating immunoreactive PTH in the cancer patients differed from authentic PTH (Riggs et al, 1971; Roof et al, 1971; Benson et al, 1974) and, furthermore, the levels in plasma were lower than in primary hyperparathyroidism. In one study, the cancer immunoreactivity was significantly non-parallel to PTH standard (Roof et al, 1971) and in another it was of higher molecular weight than PTH (Benson et al, 1974). In our own observations of 'PTH' immunoreactivity in extracts of a breast cancer and a retroperitoneal sarcoma (Melick et al, 1972), and in culture medium from a renal cortical carcinoma (Greenberg et al, 1973), we noted lack of parallelism to pure PTH standards, but did not conclude at that time what is evident from current knowledge--that the tumours were producing a protein which was not PTH itself but was sufficiently similar in structure to be recognized by some antisera, especially when they were used at high concentrations. In discussing 'PTH' secretion from renal cortical carcinoma cells in culture (Greenberg et al, 1973) we suggested that the non-parallelism of assay curves might be due to PTH fragments. A crucial study at that time was that of Powell et al (1973) who found in several patients with non-metastatic hypercalcaemia whose tumour extracts resorbed bone in vitro, that PTH could not be detected either in plasma or in tumour extracts, despite the use of a wide range of PTH antisera directed against several different parts of the molecule. This study had been prompted by their participation in a case discussion at the Massachusetts General Hospital, in which PTH could not be detected in plasma or extracts of a squamous cell carcinoma from a patient with hypercalcaemia and

PARATHYROID HORMONE-RELATED PROTEIN

1005

hypophosphataemia. Their careful study was the first to raise the serious possibility that a factor chemically quite different from PTH might contribute to the biochemical and clinical features of the ectopic PTH syndrome. Other work, including our own (Atkins et al, 1977), showed that renal tumours could produce bone resorbing activity in vitro which was due to something other than PTH. We subsequently reviewed the available evidence of the pathogenesis of the syndrome and concluded that these cancers caused hypercalcaemia by producing a factor which was not PTH, but which produced PTH-like effects, and proposed the use of the term 'humoral hypercalcaemia of malignancy' (HHM) to describe the syndrome (Martin and Atkins, 1979). 'PTH-like' activity of tumours

Until that time, the biochemical similarity to primary hyperparathyroidism was confined to the elevated calcium, low phosphorus and increased phosphorus excretion. It was soon to become apparent that the similarity was even more profound. In careful clinical investigations, three groups (Kukreja et al, 1980; Stewart et al, 1980; Rude et al, 1981) showed that patients with HHM exhibited increased renal production of cAMP, an effect specifically associated with excess of PTH. Despite that, in all these studies the plasma PTH levels were low or undetectable. These studies were therefore an important landmark in this field of clinical science, in that they finally made it abundantly clear that the HHM turnouts were producing some factor with biological effects strikingly similar to those of PTH, but that the factor could not be PTH itself because of the radioimmunoassay data. The PTH-like biological activity in plasma of patients with HHM was also assayed by a highly sensitive cytochemical assay (Goltzman et al, 1981) and found to circulate in increased amounts with HHM, in the face of low or undetectable PTH levels by radioimmunoassay. The cytochemical assay, although very sensitive, was too laborious and time consuming to be applied to attempts to purify factor from tumour extracts. However, by the early 1980s methods were available to assay PTH-like activity using sensitive, robust, high capacity assays based on cAMP responses in clonal osteogenic sarcoma cells (Martin et al, 1976; Crawford et al, 1978; Majeska et al, 1980; Partridge et al, 1980). The clinical investigations prompted an energetic search for such activity and these assays were applied to work which resulted in the discovery of PTH-like biological activity in extracts of turnouts of patients with HHM (Stewart et al, 1983), in conditioned medium from a turnout cell culture of such a patient (Strewler et al, 1983), in extracts of cancers from animal tumour models of HHM (Rodan et al, 1983), and ultimately in our purification and chemical characterization of the molecule (Moseley et al, 1987; Suva et al, 1987). ISOLATION OF PTH-RELATED PROTEIN Production of PTH-like activity by human lung cancer cells

It was, therefore, clear that purification and characterization of the PTH-

1006

T . J . MARTIN AND L. J. SUVA

like tumour activity was an achievable aim. We discovered that a human lung cancer cell line (BEN), which we had been studying for several years from other points of view, produced amounts of PTH-like activity which could be readily assayed by measuring cAMP generated in a rat PTHresponsive rat osteogenic sarcoma cell line, UMR 106-01. We had developed this assay and studied it extensively (Martin et al, 1976, 1987; Crawford et al, 1978; Partridge et al, 1983; Forrest et al, 1985). The BEN cell line had been established originally by Ellison, from a patient with hypercalcaemia and squamous cell carcinoma of the lung (Ellison et al, 1975). When conditioned medium from early BEN cell cultures was assayed for bone-resorbing activity none was found, reflecting the greater sensitivity which was subsequently possible with PTH assays in osteoblast-like cells. The BEN cells were found to produce calcitonin (Ellison et al, 1975), a property which we studied for some years (Martin et al, 1981; Zajac et al, 1985). We also found them to possess specific, high affinity receptors for calcitonin, linked to adenylate cyclase (Hunt et al, 1977; Findlay et al, 1980). PTH-like biological activity could be detected readily in dilutions of BEN conditioned medium, and activity was unimpaired by prior incubation with a goat antiserum against human PTH(1-34), which completely blocked the activity of human PTH(1-34) (Figure 1). On the other hand, specific peptide 100

80 60Fr"l Io

60

A

-Ab 40-

i_1

~: 4o 20-

"~J

0 .01 (a)

0.1

1

10

[PTH] ng/m[

0

100 (b)

t

i

/

"'1

1 1 1 1 500 250 100 10 diln.0f BEN ceil CM

Figure 1. Effect of pre-incubation with goat anti-human PTH(1-34) on response of UMR 106-01 ceils to (a) PTH(1-34) or to (b) dilutions of B.EN conditioned medium (CM). - A b in the absence of goat anti-human PTH(1-34); +Ab in the presence of goat anti-human PTH(1-34).

PARATHYROIDHORMONE-RELATEDPROTEIN

1007

antagonists of P T H were able to inhibit the activity from B E N cell medium in a manner similar to their inhibition of P T H activity in these assays (Figure 2). These observations suggested that BEN conditioned medium contained an activity which was not P T H itself, but which exerted actions on P T H target cells through the P T H receptor, or at a site intimately associated with it. The B E N conditioned medium activity did not promote adenylate cyclase activity in cells which were not P T H targets. The activity was found to be heat stable and destroyed by proteolytic enzyme digestion. Thus, in all respects it resembled the PTH-like activity found in H H M tumour extracts and in a renal cortical carcinoma conditioned medium (Rodan et al, 1983; Stewart et al, 1983; Strewler et al, 1983). The BEN cell line appeared to be the most abundant renewable source of this activity and further work was directed towards purification of the protein. 6000-

t

+ u

400C

I

L.J

~: 200C < :2[2

(a)

3-34 5-34 7-34 8-34 )-34 PTH 8ng/ml. + An~togue 10/ug/m[ 1500-

t

-t-

t.~

~o 1000o_ u

ID_

z< u 212 m

(b)

500-

t 3-3, 5-34 '7-34 8-34 9-34 BEN 1/100 ,An(l[ogue 10/ug/m[

Figure 2. Effect of PTH antagonist peptides, [34Tyr]hPTH(3-34)amide and other analogues as indicated, on the cyclicAMP response in UMR 106-01 cells (a) to hPTH(l-34) or (b) to BEN conditioned medium (1/100).

1008

T . J . MARTIN AND L. J. SUVA

Purification and sequence analysis of PTH-related protein

Purification of the active component from BEN cell conditioned medium was achieved (Moseley et al, 1987) by processing large batches of serum-free conditioned medium through cation exchange chromatography and several reversed phase high pressure liquid chromatography (HPLC) steps, with monitoring of purification at all stages by use of the biological assay for PTH-like activity, measuring cAMP production in osteoblast-like cells. Batch elution of active material from SP-Sephadex in 0.5M NaC1 was followed by successive reversed phase high pressure liquid chromatography steps, with elution in gradients of acetonitrile in 0.1% trifluoroacetic acid (Moseley et al, 1987). Biological assay of all fractions during purification allowed us to identify two major peaks of biological activity at the HPLC steps, one eluting at 32% (peak A) and the other at 37% acetonitrile (peak B) (Moseley et al, 1987). Peak B was chosen for further purification because it was consistently less associated with other pretein. The activities of the two peaks were identical in their effects in the biological assay, including inhibition by PTH antagonist peptides. The only discernible difference between the two was in their apparent molecular weights on SDS-PAGE, in which peak A migrated at approximately 22kDa and peak B at approximately 18 kDa. When peak B was fully purified (Moseley et al, 1987) (Figure 3), it was found to have specific biological activity 3-5 times higher than PTH itself in the osteogenic sarcoma cell adenylate cyclase assay. Microsequencing carried out on very small amounts of purified material provided sufficient aminoterminal sequence to show that the purified protein had significant homology with PTH, with 8 of the first 13 residues identical with those in PTH (Moseley et al, 1987). The differences were clearcut, however, and it was obvious that the protein was the product of a gene other than the PTH gene. It was evident even on that limited sequence information that the similarity to PTH about the aminoterminus could be sufficient to explain the shared biological actions with PTH. Furthermore, with the earliest antisera we obtained, based on the first 11 amino acids of sequence, it was clear that despite the similarities in sequence about the aminoterminus, antisera against the PTH-related protein cross-reacted poorly or not at all with PTH (Moseley et al, 1987). This has been a consistent feature with subsequent antisera based on longer sequence peptides, and will be discussed further. The importance of these observations early in this work was that it also indicated that many of the earlier radioimmunoassay and other immunological data in patients with HHM could be explained by their production of a protein which failed to cross-react with most PTH antisera, but was recognized by some, and especially if such polyclonal antisera were used at high concentrations, e.g. in immunohistology. Subsequent purification batches resulted in higher yields of pure protein, and sequence to residue 50 was obtained by a combination of sequencing from the aminoterminus to residue 40 with an overlapping tryptic peptide from 38 to 50 (Suva et al, 1987). In the same work, further tryptic peptides provided sequences of other parts of the molecule which were ultimately

PARATHYROID HORMONE-RELATED PROTEIN

1009

0.25-

; iii i, iii iiZ i

47

0"20

46,11

0'15

7K

E

c-

c~

46

010

S

47

/,5 005

49 44 32

54

58

3

Fraction no. Figure 3. Final purification step on reversed phase HPLC. SDS-PAGE with silver-staining of tubes 46, 47 and standards (inset shows single major band of apparent molecular weight 17 kDa, coinciding with biological activity).

confirmed by cDNA sequence analysis and prediction of the total sequence (Suva et al, 1987). ISOLATION OF PTHrP cDNA CLONES AND STRUCTURAL ANALYSIS

Based on the sequence of the first 24 amino acids of PTHrP, two 72-base oligonucleotides were synthesized. An equivalent mixture of the two was used, one based on mammalian codon usage, the other using codons from

1010

T . J . MARTIN AND L. J. SUVA

PTH for the positions of amino acid match. Of a total of 250 000 cDNA clones screened in a Xgt 10 library prepared from BEN cells, 6 positive clones were identified (Suva et al, 1987). The cDNA cloning predicted a mature protein of 141 amino acids, with a 36 amino acid leader sequence. The mature protein contains no cysteine or methionine residues and has no N-linked glycosylation sites. The predicted amino acid sequence confirmed the actual sequence data, and the similarity which had been noted to the sequence of PTH was found to be confined to the aminoterminal region (Figure 4). Thus, 8 of the first 13 residues were identical in PTHrP and human PTH, with only occasional amino acid matches throughout the rest of

bpm ' r'Pl~ hpTH

plTqrP PPlt~ b~TH

rpTH

.............................~Pv~ KK~ K F iIi~E~sTV si H"I_

. . . . ~M S~K D ..... MS ST .... IP KD

~

V

~ L V

I[IF~A RS V L TQA I F TKS

SVKKRAVS EE II QQLF~M GI(~ H " HNL G PVKKRAVSEIQLMHNLBiKH: S VSEIQLMHNLGKH

MQRRLVQQI~SVAVFLLSYAVPS~JGRSVEGLSRRLNKRA ~VS

~S~L ERv EWL RKKL QDVHNFVAL GAA~QSS l i H G ~ ] Q R PRKKEDNVLVE S~Q S MERVEWLRKKLQDVHNFVALBAS I YRDGSSQRPRKKEDNVLVESHQ AVE R~WL RKKL QDVGNF V[~L G M A QRPFTTKKE~. VL V S

hp13~

PTH~P

I QDL h:t~. h FRUit H L , A , I t ~ T AE I R A T U E V S~NN -

~

S

~

D

~

-

D

PPll~ SLGEADKADVDVLI

be~

rPTH hpXlq p~AFP P~

i

SLGE~DK ADVDVLV SLGAEDKADVDVLT GRYLTQETNKVETY

KT PGKKI KGl p GKRKEQEI(~KI(~RRTRSAWL D

SGVTGSGLEGDHLSDTSTTSLELDSRRH

Figure 4. Predicted amino acid sequence of PTHrP, compared with known PTH sequences. Residues of identity are boxed.

the molecule. The overall structure of the PTHrP leader sequence is reminiscent of that of the pre-pro-sequence of PTH itself, including the sequence of 5 basic residues ( - 5 to - 1 ) in PTHrP, analogous to the pro-PTH sequence of 6 basic residues. Based on a hydropathy plot (Suva et al, 1987), the leader sequence of PTHrP is noted to contain a hydrophobic core of amino acids flanked by charged residues, as expected for a secretion signal sequence. Cleavage of this signal sequence after glycine - 8 or serine - 6 would leave a short, basic pro-sequence like that in PTH, which would be cleaved off to give the mature protein. The experiments to establish such a process for PTH itself were carried out several years ago in studies of PTH biosynthesis and secretion in parathyroid gland slices (Kemper et al, 1972). Such approaches will be necessary to determine the nature of these events for PTHr-P. A striking feature of the PTHrP sequence is the long (25 residue) stretch

PARATHYROID HORMONE-RELATED PROTEIN

1011

of basic sequence (60% lysine and arginine) beginning at residue 84. This is followed by a sequence of 33 amino acids which is not homologous to any known protein. At present, the function of the basic sequence and the terminal peptide structure is unknown. There are several potential cleavage sites within the PTHrP molecule which could give rise to peptides of various chain lengths. It is quite possible that, in addition to the PTH-like activity associated with the aminoterminal region of PTHrP, other parts of the molecule mediate separate actions. We would predict that this is indeed the case, based on our data which suggests that PTHrP (but not PTH) promotes calcium transport across the placenta from mother to fetus (Rodda et al, 1988). This will be discussed further but it implies that PTHrP is capable of interacting with at least two receptors: one, the PTH receptor, and the other a receptor which recognizes another part of the molecule and which mediates separate actions. Experiments are in progress to determine whether this is the case. HETEROGENEITY OF PTHrP mRNA AND PROTEIN

In analysing cDNA clones from BEN cells we noted two classes of cDNA clones which diverged in sequence from each other at 22 bp 5' of the initiating ATG (Suva et al, 1987). This could be explained by an alternative splicing mechanism or by some cDNA cloning artefact. Two major bands of BEN cell m R N A for PTHrP were noted at 1700 and 1350 bp (Suva et al, 1987). Subsequent cDNA cloning of PTHrP in renal carcinoma cell lines (Mangin et al, 1988; Thiede et al, 1988) revealed several species of PTHrP m R N A that can be accounted for by divergent 3'-untranslated regions, the result of alternate m R N A splicing. In our analysis of the structure of the 5' region of the human PTHrP gene, to be described below, we concluded the existence of two promoters responsible for generation of the two differing 5'-untranslated regions of the PTHrP cDNA clones we had observed. This, together with the alternative 3' splicing noted above, suggests that multiple forms of PTHrP m R N A can be generated. The alternate splicing at the 3' end is also capable of generating protein with an altered carboxyterminus. Thus Thiede et al (1988) reported a cDNA clone which predicts a 139 amino acid form of PTHrP, with a splicing mechanism interrupting the PTHrP m R N A at Arg139, 9 bp upstream of the termination codon of the full-length PTHrP mRNA (Suva et al, 1987). Furthermore, Mangin et al (1988) have reported another cDNA clone which predicts the production of a 166 amino acid PTHrP, with a unique sequence from amino acid 142-166. In our own purification of PTHrP we noted two major peaks of PTHrP activity on HPLC profiles (see above). Subsequent analysis of these by Western blotting of SDS-PAGE gels, using antisera against PTHrP (1-16) and PTHrP(1-34), showed that peak B, of apparent molecular weight 17 kDa, actually was of the same size as recombinant PTHrP(I-108) (Wood et al, 1989). Peak A, on the other hand, was a broad band on Western analysis, corresponding approximately to PTHrP(1-141). Thus, it was

1012

r.J.

MARTIN AND L. J. SUVA

apparent that the BEN cells consistently cleaved PTHrP to a smaller form by proteolytic removal of a carboxyterminal sequence of approximately 30 residues. Other attempts to isolate PTHrP from tumours and culture media have given rise to a range of estimates of molecular weight, from 6 to 40 kDa. In all cases the preparations were assayed by the PTH assay, usually by generating cyclic AMP in osteogenic sarcoma cells. Thus it appears that varying sites of proteolytic cleavage can operate in different tumours. Within any one tumour this may be a consistent mechanism. For example, the renal cortical carcinoma cell line (786-0) studied by Strewler et al (1983) consistently yielded PTHrP of molecular weight 6-9 kDa. Thus, there are a number of factors which can contribute to apparent heterogeneity of PTHrP. It can be explained by alternative splicing of the 3' end of mRNA, and also to varying proteolysis of synthesized PTHrP. It is not necessary on present information to explain PTHrP heterogeneity by any other mechanism, particularly any involving more than one gene. Evidence from our laboratory and Mangin et al (1988) would suggest that PTHrP is the product of a single copy gene. It will be important to define the nature of PTHrP secreted by different tumour classes and by normal cells, in developing two-site assays for measurement of the protein in plasma. ACTIONS OF PTHrP SYNTHETIC PEPTIDES AND RECOMBINANT MATERIAL

Because of the striking aminoterminal homology with PTH and the fact that the biological activity of PTH is considered to be contained within the first 34 residues (Tregear et al, 1973), we investigated the biological activity of synthetic peptide analogues of the aminoterminal sequence of PTHrP. These were prepared by automated solid phase synthesis (Kemp et al, 1987) and purified by HPLC. PTHrP(1-34) stimulated cAMP formation in the clonal osteogenic sarcoma celt line, UMR 10601, with a potency four to six times greater than that of either human or bovine PTH(l-34) (Kemp et al, 1987) (Figure 5). Its potency was approximately equal to that of rat PTH(1-34), which is several times more potent than either the human or bovine peptide (Keutmann et al, 1985). Synthesis of PTHrP(1-29) yielded a peptide which had about 10% of the activity of PTHrP(1-34), and peptides of shorter chain length were essentially inactive (Kemp et al, 1987). The same relative potencies of PTHrP peptides was observed when their actions were studied in later cellular events in the UMR 106-01 cells, for example in production of plasminogen activator activity. In contrast to the greater potency of PTHrP(1-34) in acting directly upon osteoblast-like cells, its potency in promoting resorption in fetal rat long bones was less than that of either human or bovine PTH(1-34) (Kemp et al, 1987). The consistently lesser potency of PTHrP(l-34) which we have observed in this system has also been noted in studies of stimulation of resorption in newborn mouse calvaria (Lorenzo et al, 1988). Although there is some disagreement about the relative potencies of PTHrP(1-34) and

PARATHYROID HORMONE-RELATED

1013

PROTEIN

90-

I

o 60×

E n

n Z

30C~e3

i

i

1

1()

100

Peptide (ng/mt) Figure5. Effect of PTHrP(1-34) (Q), rat ([3), human (O) and bovine(11)PTH(1-34) on cyclic AMP productionin UMR 106-01 cells, From Kemp et al (1987), with permission.

PTH(1-34) in stimulating bone resorption (Yates et al, 1988), there can be little doubt that PTHrP(1-34) is capable of resorbing bone. This has been confirmed in vivo also by the demonstration that injection of PTHrP(1-34) results in hypercalcaemia in rats and mice (Horiuchi et al, 1987; Yates et al, 1988). Kidney adenylate cyclase is activated directly by PTH, and chick kidney is particularly sensitive in its response (Martin et al, 1974). Chick kidney membranes respond to PTHrP(1-34) with a dose-dependent increase in adenylate cyclase activity and the same structure-activity relationships within the PTHrP molecule were observed as had been in the osteogenic sarcoma cells. Furthermore, peptides truncated at the aminoterminus were synthesized and tested for antagonist activity by analogy with PTH (Tregear et al, 1973). Both PTHrP(4-34) and PTHrP(7-34) were capable of antagonizing the actions of PTHrP and PTH in the adenylate cyclase response. However, there is sufficient agonist activity in these peptides to limit their use as antagonists. Similar observations with PTHrP(7-34) have been made by McKee et al (1988). In view of the likely potent actions of PTHrP on renal mineral handling, experiments were carried out on the isolated, perfused rat kidney, to determine responses to PTHrP(1-34). PTHrP(1-34) infusion resulted in an increased cAMP excretion, decreased calcium excretion and increased phosphorus excretion (Kemp et al, 1987; Ebeling et al, 1988). It was not possible in those initial experiments to determine whether the kidney was

1014

T. J. MARTIN AND L. J. SUVA

more or less responsive to PTHrP(1-34) than to PTH(1-34). Again, these results have been confirmed in vivo (Horiuchi et al, 1987; Yates et al, 1988). The overall conclusion from these early studies of in vitro and in vivo effects of peptides is that PTHrP(1-34) produces responses which are very similar to those of the corresponding PTH peptides. There are some subtle differences being observed, and some significant differences in responses between laboratories. It seems likely that these will be resolved with further experiments, and that PTHrP(1-34) will be found to produce its effects by acting upon the PTH receptor. Studies with recombinant PTHrP (Hammonds et al, 1988) have been carried out in the PTH assay systems in UMR 106-01 cells. PTHrP(1-141) stimulates both adenylate cyclase and plasminogen activator activity, and on a molar basis is equipotent with PTHrP(1-34). In the only bone resorption experiments carried out at the time of writing, L. G. Raisz (personal communication) has shown that PTHrP(1-141) directly resorbed fetal rat long bones in vitro with a molar potency comparable to that of PTHrP(134). Furthermore, S. C. Kukreja (personal communication) has infused PTHrP(1-141) via mini-pump into mice, with resultant hypercalcaemia and hypophosphataemia. It is evident, therefore, that the PTH-like actions of PTHrP are effected by the full-length molecule both in vitro and in vivo. None of these experiments addressed the question of other possible effects of the PTHrP molecule, unrelated to its homology with PTH. Studies of the actions of PTHrP(1-34) carried out so far are useful, and needed to be undertaken. However, the information resulting from them is relevant only to PTH-like actions of PTHrP, and it would be surprising if any substantial difference between PTHrP(1-34) actions and those of PTH(1-34) were to be observed. GENOMIC STRUCTURE AND CHROMOSOMAL LOCALIZATION OF PTHrP

Apart from the basic interest generated by the discovery of a new hormone, the isolation of cDNA clones with a divergent 5'-untranslated region (UTR) indicated the need to analyse the structure of the human (hPTHrP) gene. One of the full length PTHrP cDNA clones, (pBRF50), was used to screen a human genomic library containing Sau 3AI fragments inserted into h EMBL3, from which two positive plaques were isolated. Both were found to contain the 5' end of the gene (Suva et al, 1988). Restriction endonuclease and Southern blot analysis demonstrated that the genomic clones contained an identical 15 kb genomic fragment. The nucleotide sequence of the human genomic clone was determined by conventional dideoxy sequencing technique (Sanger et al, 1980) (Figure 6). The location of the exons in the 5' e n d of the hPTHrP gene were determined by comparison with the cDNA sequence of clones pBRF61 and pBRF52 and the intron--exon boundaries of the homologous human parathyroid hormone (hPTH) gene (Vasicek et al, 1983) (Figure 7). Located within the 5' end of the hPTHrP gene are three exons separated by two

1015

PARATHYROID HORMONE-RELATED PROTEIN -1610

aaaggatgggt tagactcccgaccatgagtgaaaagqgccgtgtgcgtgctccaggagtgtcggtccccctctgcaat tcaaaag

-1525

g g g g a t c t c t c c t g t g c g c g g g tt t t t t g g g a c c g g c t c c a g a t g t c t c c c a g c g a g t t c t g a a a c a g ~ g t g c a a t t tag

-1440

C a t a t gaaatctggaaCTG TTTTTGTTCTTC[AAGCAAAAGATCTCCCTCTC[C TAGCCGATGCTCCCCACTCAG TTCATCCCGGG

-1355

AATGGGCCAGGGAGGAAGGTTCTCA T._~GCATCGCCCCGAGCTGCCAGGCGACCTTCGGGCTCCTTAAATTCACAGGCCAACAGCCC

-1270

GCGTCCTCTCCGCGCAGGCTCCCGGTTGCCCGCGGTCCCCGGCCCAGCTCC TTGGCCTCCTCCTCGTCGGTCCGCCCCTGGTGGT

-1185

CTTGGCGCCCGCTCG TCCAGCTCGGCGCGCCGGGGACCGCCGGCTGCCCGGGGCAGTCCGCACGCCC

-1100

G C GG C C GGATCCGCCGCGCCGGCAGGAGCCGGCCGGGCCTGGAGGGAGCAAGCGGATCGCCACGCCCCCGGCACGGATGGGCGACAGGGCC

-1015

*** C C GGGCTCCGGGGTGGGGCTCGGCAGAGCTCCTGACAGC TCCGGGGTCGGCAGCGGGGAGGGGGGAGCTCCGCCGCTCGCCGCTCAT

930

CG C TCCCGGCTCGGGGCTCCCCTCCACTCGCTCGGGCGGCGCGGGGCCCGTTGCGCCGCCCGTCGCGCCCCCGCCCCCCGCGCGCCCG owlm, oa

845

T C TCGCT CCG CCCGCCAGCCCGCCCGTGCCCGCTTCGCCCCGCGCGCGTTCCTAGGGCGCCACC TC TTTGCGACTAGCTCAC TTCTAGCAGGTTT

760

CC CCCG GCCTCGGAGCGTGTGAACAT TCC TCCGCTCGG T T TTCAAC TCGCC TCCAACCTGCGGCCCGGCCAGCA T.=.~GTC TCCGCCCGTGAAG

675

CC ~ GCC CGGGCTCGCC TCCC TGGCTCCGGC TGCCACTAACGACCCGCCC TCGCCCGACC TGGCCC TCC TGATCGACGACACACGCACTTGA ooaooo

590

AACTTGTTCTCAGGGTG TGTGGAATCAACTTTCCGGAAGCAACCAGCCCACCAGAGGAGgt agacagacagc t a t g ~

505

gt gggt t tcgc t acaag t g g c t c tggaacgaaagGGCC TGGTTCGCAAAGAAGCTGACTTCAGAGGGGGAAACTT TCTTCTTT[A

420

GGAGGCGGTTAGCCCTGTTCCACGAACCCAG•AGAACTGCTGGCCAGA•TAATTAGACATTGCTATGGGAGACGTGTAAACACAC

335

TACT•A•CATTGAT•CATATATAAAACCATTTTATTT[C•CTATTATTTCAGAGGAAGCGCCTCTGATTTGTTTCTTTTTTCCCT

250

TTTTGCTCTTTCTGGCTGTGTGGTTTGGAGAAAGCACAGTTGGAGTAGCCGGTTGCTAAATAAgtaagtgctgagaggctccaga

165

gaaat t t t t t t t c t

TCGGGGATCTCGGCTCCC

t t t c a a c t t g g g a g a t g c c c t t g a t g ttgaagaggct t t ttgagagcgggctaaaaagggggagcggagta -i

80

M

Q

gt gcggggaga t ggagagtcctgact 9acacc t cgggt ccca t t ccc t t c t g t t gcagGTCCCGAGCGCGAGCGGAGACGATGCA R

R

L

V

Q

Q

W

S

V

A

V

F

L

L

S

Y

A

V

P

S

C

G

R

S

V

E

G

L

+

6

GCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGT TCCTGCTGAGCTACGCGGTGCCC TCCTGCGGGCGCTCGGTGGAGGGTC TC

+

91

S R R" L AGCCGCCGCCTgtaagtcccccatcctccccagggcgccgggt t ggggaggccagggggaggggct gcca agctggga t gct gcc

+ 176

gaggcgttgcagcggtcacc•atcgtccttgcccg•gttagggagagggaccatcccgcatacctgccgggcctgagccgttctc

÷ 261

aaacctggcaggagaactggt t g a t c t tcaaccggagacaggcaagagagagact

+ 356

acagaatctct t c t a g g g a a a g a t c c t t g c c t c t a

t tatgt gtgtttccataagagggagctttc

Figure 6. Nucleotide sequence of the 5' region of the human PTHrP gene. Nucleotides are numbered - 1 from the initiating ATG codon. Exons are represented in upper case, and introns in lower case, and potential T A T A sequences are boxed. Positions of upstream ATGs are underlined, and the in-frame stop codons are indicated with asterisks. Spl binding site and its inverted repeat are indicated by dots. The bases given as superscripts represent the differences between the genomic sequence and the c D N A clone (X HHM-8) of Mangin et al (1988). From Suva et al (1988), with permission.

introns. This region of the gene comprises exon la (approximately 900 bp), intron A (60bp), exon lb (283bp), intron B (165bp), exon 2 (123bp) and intron C. The exact size of intron C is unclear at present. Interestingly, intron B interrupts the c D N A sequence 22 bp upstream of the initiating ATG and corresponds exactly to the point of divergence between c D N A clones and pBRF52 and pBRF61. The exon sequences in the hPTHrP gene agree precisely with those described for BEN cells.

1016

T.J.

MARTIN AND L. J. SUVA

lkb Sat

BL

BL

E H

BS BL S Sa[

I

i

~

pBRF52

Figure 7. Structure of the 5' region of the human PTHrP gene. PTHrP coding region begins with the ATG in exon 2 (see Figure 6). The positions of the exons in the 5' terminal region are shown, along with the potential alternate spicing mechanism that results in the variable 5'-untranslated region of PTHrP cDNA. The positions of the introns are indicated by A, B and C.

The region of the human PTHrP gene upstream of the translation initiation codon appears to contain two transcriptional start sites. One possible regulatory domain that contains a consensus TATA motif is located in intron A, -22 bp upstream of the exon lb cap site. Initiation of transcription in this putative promoter region (b) would produce mRNA transcripts equivalent to cDNA clone pBRF52. From our analysis of divergent cDNA clones, we would expect another regulatory domain (promoter A) to be located some distance upstream of the exon la cap site. It is possible that the CAAAAA sequence (Corden et al, 1980) 26 nucleotides upstream of the exon la cap site may function as promoter A. Initiation in this region would generate mRNA transcripts identical to cDNA clone pBRF61. The position of the exon lb cap site has recently been determined by Thiede et al (1988) who analysed cDNA clones from a human renal carcinoma cell line (786-0) and found by sequence analysis and primer extension only a single species of 5'-untranslated sequence for PTHrP mRNA. This mRNA would be initiated 15-17 bp downstream of promoter B, in agreement with the genomic sequence information. We have confirmed the position of promoter B by $1 mapping and primer extension studies (Suva et al, 1989). The nucleotide sequence of the 5'-UTR of 786-0 mRNA is identical to the sequence of pBRF52. Evidence of the initiation of transcription in the region of promoter A is provided by the BEN cell cDNA clones pBRF52 and pBRF61 (Suva et al, 1987) that contain different 5'-umranslated sequences. Additional informa-

PARATHYROID HORMONE-RELATED PROTEIN

1017

tion in support of the existence of promoter A comes from the work of Mangin et al (1988). These workers identified a cDNA clone from a renal carcinoma cell line (SKRC-1) with a cDNA sequence identical to pBRF61 which we had isolated, but which was extended a further 826 bp upstream. The exact position of promoter A has not yet been accurately mapped, but it is clear that the production of multiple PTHrP mRNA species that contain divergent 5'-untranslated regions is occurring by the initiation of transcription from two separate promoter regions. We have confirmed by Northern gel analysis using specific 5'- and 3'-UTR region oligonucleotides that two promoters are functioning in BEN cells (Suva et al, 1988). As yet, there is no data available regarding the regulation of PTHrP gene expression, so the existence of two promoter regions is intriguing. These two promoters may confer tissue specificity on PTHrP gene expression, perhaps analogous to the expression of the mouse-a-amylase gene (Hagenbuchle et al, 1981; Young et al, 1981). In the o~-amylase gene, alternative mRNA species specific for particular tissues are generated that differ only in their 5'-UTR, leaving the protein coding sequence unaffected. Left et al (1986) suggest that the alternative splicing of a single gene may serve as a potential mechanism for developmental and tissue-specific gene expression. To the present time, the BEN cells represent the only source in which the two types of 5'-UTR have been shown to occur. Of the six clones analysed in our work, only one was divergent (corresponding to pBRF52, promoter B), suggesting that promoter A is dominant in BEN cells. In the work of Mangin et al (1988) and Thiede et al (1988), mRNA species were obtained which were consistent with the operation of promoter A in one case and promoter B in the other. The region upstream of promoter B in the hPTHrP gene is unusually long, suggesting that a novel mechanism for the regulationof PTHrP gene expression may exist. This long 5'-UTR contains a number of AUGs, each of which is followed by in-frame stop codons. None of these AUGs are preceded by the Kozak (1983) consensus for mRNA initiation. The precise role of these upstream AUGs or secondary loop structures in mRNA translation is unclear, but it is thought that they could place some translational control over gene expression. Upstream AUGs have recently been shown to be involved in the control of translation in both yeast GCN4 (Mueller and Hinnebusch, 1986) and mouse bcl-2 genes (Negrini et al, 1987). In the case of the hPTHrP gene, the existence of two potentially tissue specific alternative promoters in conjunction with a mechanism that provides some translational control presents an interesting picture of gene expression for this new protein. The complex nature of PTHrP gene expression is supported by the Northern blot analysis of Mangin et al (1988) which shows multiple transcripts of PTHrP mRNA, and is similar to our earlier work (Suva et al, 1987). More recently, the complex pattern of gene expression has been shown in a variety of normal tissues including fetal liver, brain, kerat;nocytes, parathyroid, adrenal cortex, medulla and stomach mucosa (Ikeda et al, 1988a). In the genomic region upstream of the transcription start sites we would expect to find the enhancer elements or control elements involved in the

1018

T . J . MARTIN AND L. J. SUVA

regulation of the rate of transcription (reviewed in Maniatis et al, 1987). There are no consensus enhancer sequences within exon 1A which immediately precedes promoter B. This region does have a high GC content of around 70% and contains one GGGCGG sequence that is the core sequence that binds the DNA binding protein Spl in vitro (Dynan and Tjian, 1985). The CCGCCC inverted repeat of the Spl binding sequence is located at -683 bp near promoter B. The region upstream of the putative promoter A sequence C A A A A A contains a number of sequence motifs that have been suggested to be involved in the regulation of several different genes. The CCAAT box that is thought to be critical for optimal promoter activity in mouse-[3-globin genes (Myers et al, 1986) and the HSV thymidine kinase gene (Graves et al, 1986) is located at -1537bp to -1533 bp, 80 nucleotides upstream of putative promoter A, as expected. In the PTHrP gene this enhancer region has the sequence G C A A T that has been shown to have the same enhancer activity as the consensus CCAAT box in a number of systems (Hatamochi et al, 1988). Another repeat of this G C A A T sequence is located four nucleotides downstream of the putative promoter A sequence. A CCTG sequence thought to be involved in the regulation of the rat alkaline phosphatase gene (Zernik et al, 1988) is located at -1515 bp to -1512 bp and the cAMP DNA regulatory sequence T C A G A G (Nagamine and Reich, 1985) is located at -1616bp to -1611 bp. At present no information is available regarding the sequence of the 3' end of the hPTHrP gene; the evidence for 3' alternate splicing has already been discussed, and suggests the presence of multiple intron-exon junctions at the 3' end which allows such splicing to occur. The existence of tissuespecific alternative promoters and alternate 3' splicing mechanisms may partly explain the multiple PTHrP mRNA species observed in Northern analysis (Suva et al, 1987; Ikeda et al, 1988a,b; Mangin et al, 1988; Thiede et al, 1988). Examples of genes that produce mRNA species with heterogeneous 5' and 3' regions via alternative promoters and alternate splicings are very rare, although the mouse dihydrofolate reductase (DHFR) gene is one such example (Setzer et al, 1982). At present, the role of alternate 3' non-coding regions in gene expression is unknown, although the 3' sequence analysis of Miyata et al (198) and Yaffe et al (1985) suggests that these regions are involved in developmental or tissue specific gene expression. Thus, the position of one regulatory domain in the hPTHrP gene has been characterized and the position of the other suggested by genomic sequence analysis. The possible function and tissue specificity of these promoter regions will be clarified only by functional analysis of gene activity. Our understanding of the role of PTHrP gene expression will be enhanced once the entire genomic structure is elucidated. Our earlier suggestion of some evolutionary relationship between PTH and PTHrP (Moseley et al, 1987) is supported by the conservation of intron-exon boundaries in the two genes and by their similar biological actions. This idea is further supported by the localization of the hPTHrP gene to the short arm of chromosome 12 (Mangin et al, 1988). We have independently localized the hPTHrP gene (Suva et al, 1988), with

PARATHYROID HORMONE-RELATED PROTEIN

1019

essentially the same results as Mangin et al (1988), suggesting that sub-band 12 p l l . 2 is the point location of the hPTHrP gene. Human chromosomes 11 and 12 are similar in size, centromere index and banding pattern and are thought to have a common origin, possibly in tetraploidy (Comings, 1972). The chromosomal relationship of the genes for PTHrP and PTH suggests that they have a common evolutionary origin through duplication of the two chromosomes. IMMUNOLOGICAL STUDIES

Antiserum development When we obtained the first aminoterminal sequence data (Moseley et al, 1987), PTHrP (1-1]) and analogues were synthesized, coupled to soya bean trypsin inhibitor, and polyclonal antisera developed in rabbits. It was clear from the first antisera developed that the aminoterminal region of PTHrP differed strikingly in its immunological properties from PTH itself. Despite the close structural similarities, antisera cross-reacted very poorly with PTH peptides (Moseley et al, 1987). Subsequently, antisera have been raised against human PTHrP(1-16) and PTHrP(1-34). Most of these rabbit antisera cross-react very poorly or not at all with aminoterminal PTH peptides of various species. Several such specific antisera have been raised against PTHrP(1-16) and PTHrP(1-34). The immunological difference between aminoterminal PTH and PTHrP can be predicted theoretically from calculations based on those of Welling et al (1985), which use the properties of hydrophilicity and primary structure to determine antigenicity. Although this lack of cross-reactivity under radioimmunoassay conditions was promising in its implications for the specificity of assays to be applied ultimately to plasma, we were interested to test cross-reactivities under conditions of high antibody concentration. This was for two reasons, firstly in order to validate the use of antisera in immunohistology and in therapy of hypercalcaemia in vivo, and secondly to develop specific antibody affinity reagents to be applied eventually to two-site assays. The antisera were tested at high concentration for their ability to neutralize the in vitro biological activity of PTHrP. A goat antiserum against human PTH(1-34) was also used in these experiments. Several rabbit antisera against PTHrP(1-16) or PTHrP(1-34) were obtained, which virtually completely neutralized the biological activity of PTHrP while having no detectable effect on the activity of PTH(1-34). An example is provided in Table 1, which also indicates that the goat anti-human PTH(1-34) is very specific in its neutralizing effect, having no influence on the response to PTHrP(1-34). The antisera were used at very high concentrations (up to 1/20 for anti-PTHrP in some experiments), comparable to those used in immunohistology. Antisera which were found to be specific in recognizing PTHrP, but not PTH, were considered suitable for application to immunohistology and in vivo anti-hypercalcaemic studies.

1020

T. J. MARTINAND L. J. SUVA Table 1. Effect of antibody incubation on biological activity. Non-immune Anti-hPTH(l-34) Anti-PTHrP(1-34) rabbit serum (goat,dilution 1/200 (rabbit,dilution 1/50)

Control hPTH(1-34) (10 ng/ml) PTHrP(1-34) (2 ng/ml) PTHrP(I-141) (20 ng/ml)

2078 + 144 27 842 + 280 27182 + 526 29 764 + 602

2122_+221 3850+ 127 32 874 + 1876 35 742 + 1842

2096 + 176 30 084 + 1287 3084+ 188 4376 + 521

Human PTH(1-34), PTHrP(1-34) and recombinant PTHrP(t-141)0 were incubated for 18hrs at 4°C with rabbit antiserum against PTHrP(1-34) or goat antiserum against hPTH(1-34), or with non-immunerabbit serum. Sampleswere then assayedto measure cyclicAMP response in UMR 106-01 cells (Moseley et al, 1987). Values are means _ se~ of triplicates. In vivo neutralizing effect of antisera The effects of anti-PTHrP(1-34) antiserum and affinity-purified antiP T H r P ( 1 - 1 6 ) antiserum on serum calcium and cAMP excretion were studied in two animal models of humoral hypercalcaemia of malignancy (Kukreja et al, 1988). These consisted of two tumours from patients with the H H M syndrome, one a squamous cell carcinoma of the lung and the other of the larynx, maintained as transplanted tumours in athymic mice (Abramson et al, 1984). In each case the mice bearing the turnouts developed hypercalcaemia, hypophosphataemia and elevated urinary cAMP. With each antiserum and in both tumour models intravenous injection of antiserum resulted in significant lowering of serum calcium and urinary cAMP in the turnout-bearing mice. The effects were seen first at 3 h after injection and lasted for at least 48 h (Kukreja et al, 1988). The fact that serum calcium levels did not return completely to normal in all animals suggests either that more antibody needs to be administered, or that other factors (e.g. cytokines, transforming growth factors) might contribute to the development of hypercalcaemia, as has been suggested (Mundy et al, 1985). The 24-48 h duration of the hypocalcaemic effect is consistent with the half-life of IgG in the mouse. The data suggest that P T H r P secreted by the tumours is at least responsible to a major extent for the hypercalcacmia. It also raises the interesting possibility that monoclonal antibodies against P T H r P could be applied to the emergency treatment of hypercalcaemia in the H H M syndrome. Immunohistological localization of PTHrP in cancers and in normal skin Antisera were chosen for use in immunohistology on the basis of their specificity in radioimmunoassay, their ability to neutralize P T H r P biological activity without effect on PTH, and their low background in immunoperoxidase studies. A series of squamous cell and other cancers were studied (Danks et al, 1989) using paraffin sections and a peroxidase-antiperoxidase m e t h o d modified from that of Sternberger et al (1970). Strongly positive staining was observed in all 31 squamous cell cancers examined (Table 2) (Danks et al, 1989). In a series of adenocarcinomas tested in our own work, only one was

1021

PARATHYROID HORMONE-RELATED PROTEIN Table 2. Immunoperoxidase-staining of PTHrP in unselected human cancers. Tumour

Number of neoplasms positive/number tested

Staining intensity

Squamous cell carcinoma Skin Floor of mouth Lip Tonsil Oesophagus Lung Anus

16/16 2/2 3/3 3/3 4/4 4/4 2/2

++ ++ ++ ++ ++ ++ ++

Basal cell carcinoma

0/2

-

Basi-squamous carcinoma

1/1

+ + (areas of squamous differentiation only)

Small cell anaplastic carcinoma Lung

3/3

+

Melanoma

3/3

+

Renal carcinoma Adenocarcinoma Colon Stomach Lung Breast Prostate

4/4

+

0/4 0/4 1/6 0/3 0/3

+/-

Lymphoma Non-Hodgkin's

0/2

-

+ + , strong to very strong staining; +, weak to moderate staining; + / - , subset stained; - , negative.

positive for PTHrP, in this case a carcinoma of the breast. It is of interest that a breast cancer was a source of purified PTHrP used by Burtis et al (1987). The spinous keratinocytes of normal skin also stained strongly, while the cells of the basal, parabasal, granular and cornified (horny) layers did not stain. Hair follicles of normal skin stained positively for PTHrP in the inner root sheath of the hair follicle. Associated sebaceous glands did not stain. Histologically, the spinous keratinocyte, or acanthocyte, with its characteristic extensive intracellular bridges, is a cell type that is seen as one of the differentiating features of squamous cell carcinomas that also include individual cell keratinization and pearl formation (Carter and Eggleston, 1980). The finding of PTHrP in keratinocytes of normal skin is in agreement with the original observation of Merendino et al (1986), who detected PTH-like bioactivity in supernatants from human keratinocyte cultures. In all the immunoperoxidase work, the appearance of controls with nonimmune rabbit serum did not differ from that of unstained sections, nor did the sections treated with antiserum pre-absorbed with PTHrP(1-34), except that in each case some non-specific staining of collagen or of denatured keratin in superficial layers was sometimes seen. The physiological significance of PTHrP production in skin is unknown. It is uncertain in what form it is released from the keratinocytes, or whether

1022

T . J . MARTIN AND L. J. SUVA

significant amounts reach the circulation from that source. It is possible that it has a local function in skin differentiation, along with other cytokines. Its presence there certainly poses many questions for investigation. There are many published instances of detection of 'PTH' by immunohistology in turnouts. Palmieri et al (1974) used an immunofluorescence method with a guinea pig antiserum against partially purified PTH to show fuorescence in the cytoplasm in six of seven cancers from patients with HHM. Similarly, immunoreactivity ascribed to PTH was detected in a rhabdoid Wilms' tumour (Mayes et al, 1984) using an uncharacterized anti-PTH antiserum, and in squamous cell cancers from four patients with HHM (Ilardi and Faro, 1985), with an antiserum against PTH(1-84). In these cases the findings can be explained by significant cross-reaction of the anti-PTH antisera against PTHrP under the conditions used. It seems likely on the basis of present evidence that PTHrP production may be an almost invariable finding in squamous cell cancers. The ectopic production of PTH, if it occurs, probably does so very rarely and would need to be demonstrated immunologically using very strict controls, which have not been carried out in any of the published work so far. It should be emphasized that PTHrP production is not confined to squamous cell cancers, occurring as it does in, for example, renal cortical carcinoma. Furthermore, it is of considerable interest to note the observations of Fukumoto et al (1988), that the biochemical findings in patients with adult T-cell leukaemia/lymphoma (ATLL) resemble closely those in patients with HHM associated with solid tumours. ATLL is probably caused by human T-cell lymphotrophic virus type 1 (HTLV-1) infection, and these same workers have found that PTHrP mRNA could be detected in a HTLV-l-infected T cell line, but not in uninfected T cell or B cell lines (Motokura et al, 1988). PTHrP--A PHYSIOLOGICAL ROLE IN FETAL CALCIUM METABOLISM?

In the mammalian fetus, plasma calcium levels are maintained at a higher level than maternal by means of a placental calcium pump which is driven by some hitherto unknown mechanism (Fisher, 1986). Plasma PTH levels by radioimmunoassay are lower in the fetus than in the mother, but PTH-like bioactivity, measured by a sensitive cytochemical assay, is higher in the fetus than in the mother (Allgrove et al, 1981, 1985). Thyroparathyroidectomy (with thyroxine replacement) of the fetal lamb results in loss of the placental calcium gradient, the fetal plasma calcium levels fall to below those of the mother, and the lambs are born rachitic (Care et al, 1985). This suggests that the parathyroid gland is responsible for maintenance of the placental calcium gradient which provides maternal calcium for the needs of the growing fetal skeleton. In earlier experiments it had been shown that infusion of PTH into term placentae of thyroparathyroidectomized lamb fetuses failed to restore the calcium gradient (Care et al, 1985, 1986). This, together with the low PTH levels by radioimmunoassay in the fetus and the

PARATHYROID HORMONE-RELATED PROTEIN

1023

high levels of biological activity, focused our attention on the possibility that PTHrP might be such a fetal factor. Biological assay of extracts of fetal and maternal ovine tissues provided evidence for the existence of PTHrP in both fetal lamb parathyroid and placenta (Kubota et al, 1987; Loveridge et al, 1988; Rodda et al, 1988). The placental content of the PTHrP was higher in early than in late pregnancy (Rodda et al, 1988). Experiments were carried out in which the placentae of fetal lambs were perfused with autologous fetal blood at the end of pregnancy (Rodda et al, 1988). Since the lambs had been removed before perfusion, the calcium level in the closed-circuit perfusion increased progressively, since the skeleton was not available to take up the transported calcium. In lambs which had been thyroparathyroidectomized some weeks earlier, this gradient was either abolished or greatly diminished. A series of experiments were carried out in twin pregnancies in which one lamb was thyroparathyroidectomized and thyroxine replaced, the other was not. At term, the placentae were perfused with autologous fetal blood. Infusion of PTH into the closed-circuit perfusion through the thyroparathyroidectomized placenta had no effect on the gradient, but preparations of PTHrP prepared from BEN cell medium or from fetal parathyroid substantially restored the calcium gradient after it had reached a plateau. The results of these experiments identify a possible role for PTHrP in fetal calcium metabolism. In the postnatal mammal, PTH has the role of maintaining extracellular fluid calcium by the several means at its disposal: bone resorption, conservation via the kidney, and promotion of intestinal calcium absorption indirectly. We propose that PTHrP is the fetal equivalent of PTH, and that it maintains the fetal extracellular calcium level by the principal means available to it, i.e. transporting calcium across the placenta from the mother. This implies a fundamental and very important physiological role for PTHrP and raises the possibility that PTHrP could occupy a central evolutionary place in the regulation of extracellular calcium. Its mechanism of action would vary with different species, for example if present in fish, it might be expected to influence gill calcium transport. SUMMARY

Many factors, such as interleukin 1, transforming growth factor eL, tumour necrosis factor a and [3, and prostaglandins, have been implicated in the pathogenesis of the humoral hypercalcaemia of malignancy (Mundy and Martin, 1982; Martin and Mundy, 1987; Mundy et al, 1984). Much interest in the past has also centred upon the likelihood of ectopic secretion of PTH in this condition. We have purified a protein (PTHrP) implicated in HHM from a human lung cancer cell line (BEN). Full-length cDNA clones have been isolated and found to encode a pre-pro-peptide of 36 amino acids and a mature protein of 141 amino acids. Eight of the first 13 amino acids were identical with human PTH, although antisera directed to the aminoterminus of PTHrP do not recognize PTH; this homology is not maintained in the remainder of the molecule. PTHrP therefore represents a previously

1024

T . J . MARTIN AND L. J. SUVA

unrecognized hormone, possibly related to the PTH gene by a gene duplication mechanism. In support of this notion, the PTHrP gene has been localized to the short arm of chromosome 12; it is believed that chromosome 11, containing the PTH gene, and chromosome 12 are evolutionarily related. In addition, the human PTHrP gene has been isolated, characterized, and shown to have an intron-exon arrangement that is more complex than the PTH gene. It is possible that the original ancestral gene is indeed the PTHrP gene; resolution of this question awaits studies in lower species. Peptides synthesized to the predicted protein sequence have allowed detailed structure-function studies that have identified aminoterminal sequences to be responsible for the biological effects of the molecule. Antibodies raised against the various synthetic peptides have led to the immunohistochemical localization of PTHrP in many human squamous cell carcinomas as well as in a subpopulation of keratinocytes of normal skin. The availability of these antibodies has opened the way for the development of a radioimmunoassay to detect PTHrP in the sera of cancer patients at risk of developing hypercalcaemia. The recent characterization of PTHrP-like activity in the ovine fetus suggests some physiological function for PTHrP. It is possible that PTHrP, as the fetal counterpart of PTH, has the role of maintaining the maternal-fetal calcium gradient. The isolation and characterization of PTHrP has added to our understanding of the mechanisms of hypercalcaemia and may contribute to the understanding of other metabolic bone diseases, such as osteoporosis and Paget's disease. Finally, and perhaps most importantly, PTHrP may play a hitherto unrecognized role in normal cell physiology.

Acknowledgements Research in the authors' laboratories was supported by the National Health and Medical Research Council of Australia, the Anti-Cancer Council of Victoria and the Australian Government Department of Veterans' Affairs.

REFERENCES Abramson EC, Kukla LJ, Shevrin DH, Lad TE, McGuire WP & Kukreja SC (1984) A model for malignancy associated hypercalcemia. Calcified Tissue International 36: 563-567. Albright F (1941) Case Records of the Massachusetts General Hospital (Case 27401). New England Journal of Medicine 225: 789-791. Allgrove J, Manning RM, Adami S, Chayen J & O'Riordan JLH (1981) Biologically active parathyroid hormone in maternal and cord blood. Clinical Science 60: 11P. Allgrove J, Adami S, Manning RM & O'Riordan JLH (1985) Cytochemical bioassay of parathyroid hormone in maternal and cord blood. Archives of Diseases in Childhood 60: 110-115. Atkins D, Ibbotson K J, Hillier K, Hunt NH, Hammonds JC & Martin TJ (1977) Secretion or prostaglandins as bone-resorbing agents by renal cortical carcinoma in culture. British Journal of Cancer 36: 601-607. Benson RC, Riggs BL, Pickard BM & Arnaud CD (1974) Immunoreactive forms of circulating parathyroid hormone in primary and ectopic hyperparathyroidism. Journal of Clinical Investigation 54: 175-181.

PARATHYROID HORMONE-RELATED PROTEIN

1025

Berson SA & Yalow RS (1966) Parathyroid hormone in plasma in adenomatous hyperparathyroidism, uremia and bronchogenic sarcoma. Science 154: 907-909. Buckle RM, McMillan M & Mallison C (1970) Ectopic secretion of parathyroid hormone by a renal adenocarcinoma in a patient with hypercalcemia. British Medical Journal IV: 724726. Burtis WJ, Wu J, Bunch CM, Sysolmerski JJ, Isogna JL, Weir EC, Broadus AE & Stewart AF (1987) Identification of a novel 17 000-dalton parathyroid hormone-like adenylate cyclasestimulating protein from a tumour associated with humoral hypercalcemia of malignancy. Journal of Biological Chemistry 262: 7151-7156. Care AD, Caple IW & Pickard DW (1985) In Jones CT & Nathanielz PW (eds) The Physiological Development of the Fetus and Newborn, pp 135-140. London: Academic Press. Care AD, Caple IW, Abbas SK & Pickard DW (1986) The effect of fetal thyroparathyroidectomy on the transport of calcium across the ovine placenta to the fetus. Placenta 7: 417-424. Carter D & Eggleston JC (1980) In Atlas of Tumor Pathology. Tumors of the Lower Respiratory Tract. Washington, DC: Armed Forces Institute of Pathology. Comings DE (1972) Evidence for ancient tetraploidy and conservation of linkage groups in mammalian chromosomes. Nature 238: 455-457. Corden J, Wasylyk B, Buchwalder A, Sassone-Corsi P, Kedinger C & Chambon P (1980) Promoter sequences of eukaryotic protein-coding genes. Science 209: 1406-1414. Crawford A, Hunt NH, Dawborn JK, Michelangeli VP & Martin TJ (1978) Journal of Endocrinology 22: 213-224. Danks JA, Ebeling PR, Hayman J, Chou ST, Moseley JM, Dunlop J, Kemp BE & Martin TJ (1989) Parathyroid hormone-related protein of cancer: Immunohistochemical localisation in cancers and in normal skin. Journal of Bone Mineral Research 4: 273-278. Dynan WS & Tjian R (1985) Control of enkaryotic messenger RNA synthesis by sequencespecific DNA-bindingproteins. Nature 316: 774-778. Ebeling PR, Adam WR, Moseley JM & Martin TJ (1989) Actions of synthetic parathyroid hormone-related protein (1-34) on the isolated rat kidney. Journal of Endocrinology 120: 45-50. Ellison M, Woodhouse D, Hillyard CJ, Dowsett J, Coombes RC, Gilby ED, Greenberg PB & Neville AM (1975) Immunoreactive calcitonin production by human lung cancers in culture. British Journal of Cancer 32: 373-379. Findlay DM, De Luise M, Michelangeli VP & Martin TJ (1980) Properties of a calcitonin receptor and adenylate cyclase in BEN cells, a human cancer cell line. Cancer Research 40: 1311-1317. Fisher JA (1986) The unique endocrine milieu of the fetus. Journal of Clinical Investigation 78: 603-611. Forrest SM, Ng KW, Findlay DM, Michelangeli VP, Partridge NC, Zajac JD & Martin TJ (1985) Characterization of an osteoblast-like clonal cell line which responds to both parathyroid hormone and calcitonin. Calcified Tissue International 37: 51-56. Fukumoto S, Matusmoto T, Ikeda K, Yamashita T, Watanabe T, Yamaguchi K, Kiyokawa T, Takatsuki K, Shibuya N & Ogata E (1988) Clinical evaluation of calcium metabolism in adult T-cell leukemia/lymphoma. Archives of Internal Medicine 148: 921-925. Goltzman D, Stewart AF & Broadus AE (1981) Malignancy-associated hypercalcemia: evaluation with a cytochemical bioassay for parathyroid hormone. Journal of Clinical Endocrinology and Metabolism 53: 89%904. Gonzalez RD, Barrientos A, Larrodera L, Ruilope LM, Leiva O & Barobia V (1985) Squamous cell carcinoma of the renal pelvis associated with hypercalcemia and the presence of parathyroid hormone-like substances in the tumor. Journal of Urology 133: 102%1034. Graves BJ, Johnson PF & McKnight SL (1986) Homologous recognition of a promoter domain common to the MSV LTR and the KSV tk gene. Cell 44: 565-576. Greenberg PB, Martin TJ & Sutcliffe HS (1973) Synthesis and release of parathyroid hormone by a renal carcinoma in cell culture. Clinical Science and Molecular Medicine 45: 183-187. Hagenbuchle O, Tosi M, Schibler U, Borey R, Wellaver PK & Young RA (1981) Mouse liver and salivary gland c~-amylasemRNA differ only in their 5'-untranslatedsequences. Nature 289: 643-646. Hammonds RG, Winslow G, Moseley JM, Martin TJ & Wood WI (1988) Expression of full

1026

T.J. MARTIN AND L. J. SUVA

length PTH-related protein in E. Coli. Journal of Bone and Mineral Research 3(supplement 1): 569 (abstract). Hatamochi A, Golumbek PT, Van Schaftingen E & de Crambruggle BA (1988) A CCAAT DNA binding factor consisting of two different components that are both required for DNA binding. Journal of Biological Chemistry 263: 5940-5947. Horiuehi N, Caulfield MP, Fisher JE et al (1987) Similarity of synthetic peptide from human turnout to parathyroid hormone in vivo and in vitro. Science 238: 1566-1569. Hunt NH, Ellison ME, Underwood JCE & Martin TJ (1977) Calcitonin responsive adenylate eyclase in a calcitonin-producing human lung cancer cell line. British Journal of Cancer 35: 777-784. Ikeda K, Weir E, Mangin M, Brown E & Broadus AE (1988a) Tissue-specific and developmental expression of mRNAs encoding a PTH-Like peptide. Journal of Bone and Mineral Research 3(supplement 1): 578 (abstract). Ikeda K, Mangin M, Dreyer BE, Webb AC, Posillico JT, Stewart AF, Bander NH, Weir EC, Insogna KL & Broadns AE (1988b) Identification of transcripts encoding a parathyroid hormone-like peptide in messenger RNAs from a variety of human and animal tumors associated with the humoral hyperealcemia of malignancy. Journal of ClinicaIInvestigation 81: 2010-2014. Ilardi CF & Faro JC (1985) Localization of parathyroid hormone-like substance in squamous cell carcinoma. Archives of Pathology and Laboratory Medicine 109" 752-755. Kemp BE, Stapleton D, Rodda CP et al (1987) Parathyroid hormone-related protein of malignancy: active synthetic fragments. Science 238: 1568-1570. Kemper B, Habener JF, Potts JT Jr & Rich A (1972) Proparathyroid hormone: identificationof a biosynthetic precursor to parathyroid hormone. Proceedings of the NationaIAcademy of Sciences USA 69: 643-647. Keutmann HT, Griscom AW, Nassbaum SR, Reiner BF, Goud NAN, Potts JT Jr & Rosenblatt M (1985) Rat parathyroid hormone-(1-34) fragment, renal adenylate cyclase activity and receptor binding properties in vitro. Endocrinology 117: 1230-1236. Knill-Jones RP, Buckle RM, Parsons V, Calne RY & Williams R (1970) Hypercalcemia and increased parathyroid hormone activity in a primary hepatoma. Studies before and after hepatic transplantation. New England Journal of Medicine 282: 704-708. Kozak M (1983) Comparison of initiation of protein synthesis in prokaryotes, eukaryotes and organelles. Microbiology Review 47: 1-45. Kubota M, Moseley JM, Rodda CP, Heath J, Caple IW & Martin TJ (1987) In Cohn, DV, Martin TJ & Meunier PJ (eds) Calcium Regulation and Bone Metabolism: Basic and Clinical Aspects, p 718. Amsterdam: Exeerpta Medica. Kukreja SC, Shemerdiak WP, Lad TE & Johnson PA (1980) Elevated nephrogenous cyclic AMP with normal serum parathyroid hormone levels in patients with lung cancer. Journal of Clinical Endocrinology and Metabolism 51: 167-169. Kukreja SC, Shavin DH, Wimbiscus S, Ebeling PR, Wood WI & Martin TJ (1988) Antibodies to parathyroid hormone-related protein lower serum calcium in athymic mouse models of malignancy associated hypercalcemia due to human tumors. Journal of Clinical Investigation 82: 1798-1802. Lafferty FW (1966) Pseudohypoparathyroidism. Medicine 45: 247-260. Left SE, Rosenfeld MG & Evans RM (1986) Complex transcriptional units: Diversity in gene expression by alternative RNA processing. Annual Review of Biochemistry 55: 1091-1117. Lorenzo J, Sousa S, Kemp B & Martin TJ (1988) Comparison of parathyroid hormone related peptide (1-34) of malignancy and bovine parathyroid hormone (1-34) on bone resorption and the release of interleukin-l-like activity in 4-5 day newborn mouse calvaria cultures. Journal of Bone and Mineral Research 3(supplement 1): 618 (abstract). Loveridge N, Caple IW, Rodda C, Martin TJ & Care AD (1988) Further evidence for a parathyroid hormone-related protein in fetal parathyroid glands of sheep. Quarterly Journal of Experimental Physiology 73: 781-784. Majeska RJ, Rodan SB & Rodan GA (1980) Parathyroid hormone-responsive clonal cell lines from rat osteosarcoma. Endocrinology 107: 1494-1503. Mangin M, Webb AC, Dreyer BE et al (1988) Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy. Proceedings of the National Academy of Sciences USA 85: 597-601.

PARATHYROID HORMONE-RELATED PROTEIN

1027

Maniatis T, Goodbourn S & Fischer JA (1987) Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1244. Martin TJ & Atkins D (1979) Biochemical regulators of bone resorption and their significance in cancer. Essays in Medical Biochemistry 4: 49-82. Martin TJ & Mundy GR (1987) In Martin TJ & Raisz LG (eds) Clinical Endocrinology of Calcium Metabolism, pp 171-199. New York: Marcel Dekker. Martin TJ, Vakakis N, Eisman JA, Livesey SA & Tregear GW (1974) Chick kidney adenylate cyclase: Sensitivity to parathyroid hormone and synthetic human and bovine peptides. Journal of Endocrinology 63: 369-375. Martin TJ, Ingleton PM, Underwood JCE, Melick RA, Michelangeli VP & Hunt NH (1976) Parathyroid hormone responsive adenylate cyclase in an induced transplantable osteogenic sarcoma in the rat. Nature 260: 436-438. Martin TJ, Moseley JM, Findlay DM & Michelangeli VP (1981) In Fotherby K & Pal S (eds) Hormones in Normal and Abnormal Tissues, pp 429--457. New York: Walter de Gruyter. Martin TJ, Ng KW, Partridge NC & Livesey SA (1987) Hormonal influences on bone cells. Methods in Enzymology 145: 324-336. Mayes LC, Kasselberg AG, Roloff JS & Leukens JN (1984) Hypercalcemia associated with immunoreactive parathyroid hormone in a malignant rhabdoid tumor of the kidney (Rhabdoid Wilm's Tumor). Cancer 54: 882-884. McKee RL, Goldman ME, Caulfield MP, De Haven PA, Levy TJ, Nutt RF & Rosenblatt M (1988) The 7-34 fragment of human hypercalcemia factor is a partial agonist/antagonist for parathyroid stimulated cAMP production. Endocrinology 122: 3008-3010. Melick RA, Martin TJ & Hicks RA (1972) Parathyroid hormone production and malignancy. British Medical Journal 1" 204-206. Merendino TJ, Insogna KL, Milstone LM, Broadus AE & Stewart AF (1986) A parathyroid hormone-like protein from cultured human keratinocytes. Science 231: 388-390. Miyata T, Yasunoga T & Nishida T (1980) Nucleotide sequence divergence and functional constraint in mRNA evolution. Proceedings of the NationaI Academy of Sciences USA 77: 7328-7332. Moseley JM, Kubota M, Diefenbach-Jagger H et al (1987) Parathyroid hormone-related proteins purified from a human lung cancer cell line. Proceedings of the NationalAcademy of Sciences USA 84: 5048-5052. Motokura T, Fukumoto S, Takahashi S, Watanabe T, Matsumoto T, Igarashi T & Ogata E (1988) Expression of parathyroid hormone-related protein in a human T cell lymphotrophic virus type Z-infected T cell line. Biochemical and Biophysical Research Communication 154: 1182-1188. Mueller PP & Hinnebusch AG (1986) Multiple upstream AUG codons mediate translational control of GCN4. Cell 45: 201-207. Mundy GR & Martin TJ (1982) The hypercalcemia of malignancy: pathogenesis and treatment. Metabolism 31: 1247-1277. Mundy GR, Ibbotson KJ, D'Souza SM, Simpson EL, Jacobs JW & Martin TJ (1984) Tumor products and the hypercalcemia of malignancy. New England Journal of Medicine 310: 1718-1727. Mundy GR, Ibbotson KJ & D'Souza SM (1985) Tumour products and the hypercalcemia of malignancy. Journal of Clinical Investigation 76: 391-394. Myers RM, Tilly K & Maniatis T (1986) Fine structure and analysis of a 13-globinpromoter. Science 232: 613-618. Nagamine Y & Reich E (1985) Gene expression and cAMP. Proceedings of the National Academy of Sciences USA 82: 4606-4610. Negrini M, Silini E, Zozak C, Tsujimoto Y & Croce KM (1987) Molecular analysis of mbcl-2: Structure and expression of the murine gene homologous to the human gene involved in follicular lymphoma. Cell 49: 455-463. Palmieri GMA, Nordquist RE & Omenn GS (1974) Immunochemical localization of parathyroid hormone in cancer tissue from patients with ectopic hyperparathyroidism. Journal of Clinical Investigation 53: 1726-1735. Partridge NC, Alcorn D, Michelangeli VP, Ryan G & Martin TJ (1983) Morphological and biochemical characterization of four clonal osteogenic sarcoma cell lines of rat origin. Cancer Research 43: 4308-4314. Partridge NC, Frampton RJ, Eisman JA, Michelangeli VP, Elms E, Bradley TR & Martin TJ

1028

T.J. MARTINAND L. J. SUVA

(1980) Receptors for 1,25(OH)2-vitamin D3 in cloned osteoblast-like rat osteogenic sarcoma cells. FEBS Letters 115: 13%142. Powell D, Singer FR, Murray TM, Minkin C & Potts JT Jr (1973) Non-parathyroid humoral hypercalcemia in patients with neoplastic disease, New England Journal of Medicine 289: 176-181. Rees LH & Ratcliffe JG (1974) Ectopic hormone production by non-endocrine turnouts. Clinical Endocrinology 3: 263-275. Riggs BL, Arnaud CD, Reynolds JC & Smith LH (1971) Immunological differentiation of primary hyperparathyroidism from hyperthyroidism due to non-parathyroid cancer. Journal of Clinical Investigation 50: 207%2083. Rodan SB, Insogna KL, Vignery AMC et al (1983) Factors associated with humoral hypercalcemia of malignancy stimulate adenylate cyclasein osteoblastic cells. Journal of Clinical Investigation 72: 1511-1515. Rodda CP, Kubota M, Heath JA et al (1988) Evidence for a novel parathyroid hormonerelated protein in fetal lamb parathyroid glands and sheep placenta: Comparisons with a similar protein implicated in humoral hypercalcemia of malignancy. Journal of Endocrinology 117: 261-271. Roof BS, Carpenter B, Fink DJ & Gordan GS (1971) Some thoughts on the nature of ectopic parathyroid hormones. American Journal of Medicine 50: 686-691. Rude RK, Sharp CF Jr, Fredericks RS et al (1981) Urinary and nephrogenous adenosine 3',5'-monophosphate in the hypercalcaemia of malignancy. Journal of Clinical Investigation 52: 765-771. Sanger F, Coulson PR, Barrel BG, Smith AJH & Roc BA (1980) Cloning in single stranded bacteriophage as an aid to rapid DNA sequencing. Journal of Molecular Biology 143: 161-168. Setzer DR, McGrogan M & Schimke RT (1982) Nucleotide sequences surrounding multiple polyadenylation sites in the mouse dihydrofolate reductase gene. Journal of Biological Chemistry 257: 5143-5147. Sherwood LM, O'Riordan JLH, Aurbach GD & Potts JT Jr (1967) Production of parathyroid hormone by non-parathyroid tumors. Journal of Clinical Endocrinology and Metabolism 27: 140-146. Sternberger LA, Hardy PH, Cuculis JJ & Meyer HG (1970) The unlabelled antibody enzyme method of immunohistochemistry. Preparation and properties of soluble antigen-antibody complex (horseradish peroxidase-antihorseradish peroxidase) and its use in identification of spirochaetes. Journal of Histochemistry and Cytochemistry 18: 315-333. Stewart AF, Horst R, Deftos LJ, Cadman EC, Lang R & Broadus AE (1980) Biochemical evaluation of patients with cancer-associated hypercalcemia. New England Journal of Medicine 303: 1377-1381. Stewart AF, Insogna KL, Goltzman D & Broadus AE (1983) Identification of adenylatecyclase-stimulating activity and cytochemical glucose-6-phosphate dehydrogenasestimulating activity in extracts of tumors from patients with humoral hypercalcemia of malignancy. Proceedingsof the National Academy of Sciences 80: 1454-1458. Strewler GJ, Williams RD & Nissenson RA (1983) Human renal carcinoma cells produce hypercalcemia in the nude mouse and a novel protein recognised by parathyroid hormone receptors. Journal of Clinical Investigation 71: 769-774. Suva LJ, Winslow GA, Wettenhall REH et al (1987) A Parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and expression. Science 237: 893-896. Suva LJ, Mather KA, Gillespie MT et al (1989) Structure of the 5' flanking region of the gene encoding human parathyroid hormone-related protein (hPTHrP). Gene 77: 95-105. Theide MA, Strewler GJ, Nissenson RA, Rosenblatt M & Rodan GA (1988) Human renal carcinoma expresses two messages encoding a parathyroid hormone-like peptide: Evidence for the alternative splicing of a single-copy gene. Proceedingsof the National Academy of Sciences USA 85: 4605-4609. Tregear GW, Van Rietschoten J, Greene E et al (1973) Bovine parathyroid hormone: minimumchain length of synthetic peptide required for biological activity. Endocrinology 93: 1349-1357. Vasicek TJ, McDevitt BE, Freeman MW et al (1983) Nucleotide sequence of the human parathyroid hormone gene. Proceedings of the National Academy of Sciences USA 80: 2127-2131.

PARATHYROID HORMONE-RELATED PROTEIN

1029

Welling GW, Wejser WJ, Van der Zee R & Welling-Webster S (1985) Production of sequential antigenic regions in proteins. FEBS Letters 188" 215-219. Wood WJ, Hammonds RG, Diefenbach-Jagger H, Allan EH, Glatz J, Rodda CP & Martin TJ (1989) Recombinant human parathyroid hormone-related protein: biological and immunological properties (submitted). Yaffe D, Nudel V, Mayer Y & Neuman V (1985) Highly conserved sequences in the 3' untranslated regions of mRNAs coding for homologous proteins in distantly related species. Nucleic Acids Research 13: 3723-3737. Yates AJP, Gutierrez GE, Smolens D et al (1988) Effects of a synthetic peptide of a parathyroid hormone-related protein on calcium homeostasis, renal tubular calcium reabsorption and bone metabolism in vivo and in vitro in rodents. Journal of Clinical Investigation 81: 932-938. Young RA, Hagenbuchle O & Schibler VA (1981) A single mouse c~-amylasegene specifiestwo different tissue-specific mRNAs. Cell 23: 451-458. Zajac JD, Martin TJ, Hudson P, Niall HD & Jacobs JW (1985) Biosynthesis of calcitonin by human lung cancer cells. Endocrinology 116: 749-755. Zernick J, Stover ML, Thiede MA, Rodan GA & Rowe DW (1988) Isolation and characterisation of a genomic clone corresponding to the promoter of the gene for rat bone alkaline phosphatase. Journal of Bone and Mineral Research 3(supplement 1): 555 (abstract).