- Email: [email protected]
A bacmid approach to the genetic manipulation of granuloviruses
Journal of Virological Methods 152 (2008) 56–62
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A bacmid approach to the genetic manipulation of granuloviruses Sally Hilton ∗ , Elizabeth Kemp, Gary Keane, Doreen Winstanley Warwick HRI, The University of Warwick, Wellesbourne, Warwick CV35 9EF, UK
a r t i c l e
i n f o
Article history: Received 20 February 2008 Received in revised form 8 May 2008 Accepted 14 May 2008 Available online 3 July 2008 Keywords: Baculovirus Granulovirus Bacmid CpGV Cydia pomonella
a b s t r a c t A Cydia pomonella granulovirus (CpGV) bacmid has been constructed, which allows rapid and efficient production of recombinant baculoviruses in Escherichia coli. An 8.6 kbp bacterial DNA cassette derived from the AcMNPV Bac-to-Bac® system was ligated into a unique PacI restriction site within an intergenic region flanking the DNA ligase gene of the CpGV genome. The CpGV bacmids produced in E. coli were transfected into a CpGV-permissive C. pomonella cell line and the transfected cells fed to larvae to amplify the virus. The enhanced green fluorescent protein (EGFP) gene under the constitutive Drosophila heatshock promoter was transposed into the mini-attTn7 transposition site, using a modified pFASTBACTM donor plasmid, to generate a recombinant CpGV bacmid which caused infected larvae to glow under UV light. Targeted homologous recombination was also achieved in a recombinant proficient E. coli strain (BJ5183). A chloramphenicol acetyl transferase (CAT) gene replaced the cathepsin (v-cath) gene in the bacmid to produce a v-cath-deletion mutant. This is the first published report of a granulovirus bacmid, which will allow easy manipulation of the CpGV genome, enabling future studies on granulovirus genes and biology. © 2008 Elsevier B.V. All rights reserved.
1. Introduction The family Baculoviridae includes a large group of circular double-stranded DNA viruses, with genomes ranging from 80 to 180 kbp (Theilmann et al., 2005). They are widely used as bioinsecticides for insect pest control, and as efficient eukaryotic expression vectors in insect cells (Theilmann et al., 2005). Baculoviruses infect invertebrates, mostly insects from the order Lepidoptera. There are two genera: Nucleopolyhedrovirus (NPV) and Granulovirus (GV) which each have distinct characteristics (Theilmann et al., 2005). Phenotypically, GVs have a single nucleocapsid enveloped within each virion and only one virion embedded in the occlusion body, whereas NPVs contain single or multiple nucleocapsids per virion and multiple virions per occlusion body (Theilmann et al., 2005). Other differences exist between the groups including host range, tissue tropism and cytopathology. Cydia pomonella granulovirus (CpGV) is highly pathogenic to the larvae of C. pomonella (codling moth), which is an important economic pest of commercial apple orchards throughout the world (Cross et al., 1999). Formulated products of CpGV are available in many countries worldwide (Cross et al., 1999). The virus is highly virulent against codling moth, particularly neonates, which
∗ Corresponding author. Tel.: +44 24 7657 4455; fax: +44 24 7657 4500. E-mail address: [email protected] (S. Hilton). 0166-0934/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2008.05.015
can be killed after the ingestion of only a single occlusion body (Wormleaton, 2000). There have been extensive molecular studies performed on NPVs, in particular Autographa californica multicapsid NPV (AcMNPV), due to the availability of a variety of NPV-permissive cell lines and the high multiplicity of infections obtained in vitro (Jarvis, 1997). In contrast, relatively few studies have been performed on GVs due to the lack of GV-permissive cell lines and the low virus titres obtained (Winstanley and Crook, 1993). As a result, there are very few gene expression or biochemical characterisation studies of the GV genes or proteins. Granulovirus genomes are a rich source of novel genes; there are currently 44 GV-specific genes which are found in 2 or more GV genomes, of which 22 are present in all sequenced GV genomes (Hilton, 2008). These genes may have important generic functions in Eukaryotes, but studies have been restricted by the lack of an efficient system to manipulate the GV genome. C. pomonella embryonic cell lines permissive for CpGV have been developed (Winstanley and Crook, 1993) and the genome of CpGV has also been sequenced, being 123.5 kbp in size (Luque et al., 2001). These have enabled molecular studies on GVs to progress including the characterisation of the origins of replication of CpGV (Hilton and Winstanley, 2007). Therefore, opportunities exist to study the function of granulovirus genes in granulovirus-permissive cells and larvae, but an efficient system for producing recombinant GVs is required.
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
The TCID50 (tissue culture infective dose) of CpGV in C. pomonella cells is low compared to NPV systems, with 1 × 105 TCID50 /ml being the maximum achievable routinely. Several recombinant CpGV viruses have been made in this laboratory by conventional homologous recombination in vitro, but it has been a laborious and inefficient process requiring the co-transfection of plasmid transfer vectors and supercoiled wild-type viral DNA into insect cells, followed by multiple in vitro cloning dilutions to purify the recombinant from the wild-type virus, and finally amplification of the recombinant baculovirus (Wormleaton, 2000). A more rapid and efficient method to generate recombinant AcMNPV viruses was developed using the site-specific transposition of an expression cassette into a baculovirus shuttle vector (AcMNPV bacmid) that can be propagated in E. coli (Luckow et al., 1993). This bacmid contains a mini-F replicon, a kanamycin resistance marker and a segment of DNA carrying the lacZ˛ gene with an attachment site for the bacterial transposon Tn7. Transposition takes place in E. coli and the recombinant bacmid DNA can be rapidly isolated from small-scale cultures and then used to transfect insect cells. Virus stocks harvested from the transfected cells can be used to infect insects. This has resulted in the commercially available AcMNPV Bacto-Bac® Baculovirus Expression System (Invitrogen). Since then three further NPV bacmids have been produced using the bacterial cassette from the AcMNPV bacmid, Helicoverpa armigera SNPV (Hou et al., 2002; Wang et al., 2003), Spodoptera exigua MNPV (Pijlman et al., 2002) and Bombyx mori MNPV (Motohashi et al., 2005). The production of a CpGV-bacmid that is infectious for a C. pomonella cell line and larvae is described, as well as recombinant CpGV-bacmids generated via two described previously mechanisms. The first uses the transposon Tn7 to insert the target gene into the viral genome at a mini-attTn7 site, as in the Bac-to-Bac® system. A recombinant CpGV expressing the enhanced green fluorescent protein (EGFP) gene under the constitutive Drosophila heat-shock promoter was generated using this method. The second method uses targeted homologous recombination in recombination proficient E. coli cells. The chloramphenicol acetyl transferase (CAT) gene replaced a baculovirus gene, vcath, a cysteine protease homologue responsible for post-mortem melanisation and liquefaction (Ohkawa et al., 1994; Hawtin et al., 1997). The CpGV-bacmid provides a fast and efficient method for the manipulation of the GV genome in E. coli. This will overcome the rate-limiting step associated with the lack of highly permissive GV susceptible cell lines, allowing the study of granuloviruses genes in a granulovirus system for the first time. 2. Materials and methods 2.1. Insects A laboratory stock of C. pomonella was reared at 25 ◦ C with a 16:8 h light:dark cycle on semi-synthetic diet (Guennelon et al., 1981). The culture originated from Dr. Audemard, INRA, Montfavet, France, and has been maintained in the insect rearing unit at Warwick HRI since 1988. Eggs were surface sterilised for 6 h in vapour from 5% formaldehyde (v/v). 2.2. Virus and cells A cloned Mexican isolate (CpGV-M1) was used (Crook et al., 1997). The C. pomonella cell line used (Cp14R) was derived from
57
Cp14 cells (Winstanley and Crook, 1993). The cells were propagated in IZD04 media, supplemented with 10% fetal bovine serum (FBS) (Winstanley and Crook, 1993). The GV occlusion bodies were purified using glycerol gradients, following methods described previously (Crook and Payne, 1980). 2.3. DNA extraction and analysis Viral DNA was extracted and purified from a single infected insect, as described previously (Smith and Crook, 1988). Restriction endonuclease fragment analyses were carried out as described by Crook et al. (1985). In brief, 600 ng purified DNA was digested with 10 U restriction endonuclease for 2 h at 37 ◦ C. The digested DNA was run on a 0.7% agarose gel for 16 h at 15–20 V and viewed using a transilluminator. 2.4. Construction of the CpGV-bacmid The 8.6 kb BAC cassette containing the kanamycin resistance gene, LacZ with mini-attTn7 site and mini-F replicon, in the plasmid pHZB10, was kindly donated by Dr. Zhihong Hu (Wang et al., 2003). This cassette originated from the commercially available Bac-toBac® Baculovirus Expression System (Invitrogen). The plasmid pHZB10 contained the 8.6 kbp cassette cloned into a Bsu36I site. This plasmid was digested with Bsu36I and the 8.6 kbp cassette was gel purified (Qiagen gel extraction kit) and end filled. PacI linkers (New England Biolabs) were ligated to the blunt ends using T4 DNA ligase (Invitrogen) and the cassette was dephosphorylated using Shrimp Alkaline Phosphatase (Roche) to prevent re-ligation. The cassette was then ligated into a modified pBluescript SK+ (pBSK+) containing a PacI site in the multi-cloning site. The cassette was sequenced to check that no mutations had occurred during cloning. The cassette was then cloned into a unique PacI site in CpGV using 500 ng of linearised CpGV and 25 ng of dephosphorylated 8.6 kb cassette DNA. Ligations were transformed into ElectroMAX DH10B cells (Invitrogen) at 200 , 25 kV, 2.5 F. Transformed cells were plated on Luria plates containing 50 g/ml kanamycin, 100 g/ml Bluo-gal, 40 g/ml IPTG. Blue colonies were picked and restreaked to verify the phenotype. They were then picked and grown at 37 ◦ C for 24 h in 2 ml of Luria broth (LB) containing 50 g/ml kanamycin in a snap-cap 15 ml Falcon® 2059 tube. Mini-preps were performed and the DNA pellets gently dissolved in 40 l of 1× TE buffer, pH 8.0. The DNA was left at room temperature for at least 10 min to allow the DNA to redissolve before transfection into C. pomonella cells. 2.5. Transfection of mini-prep DNA DNA was transfected into Cp14R cells as follows: 20 l miniprep DNA was mixed with 20 l Cellfectin using the manufacturer’s recommendations (Invitrogen). The complex was added to the cells for 3 h in a 25-cm2 flask of Cp14R cells containing 1 × 106 viable cells (which had been allowed to attach for 2 days). The transfection mixture was removed and fresh medium added. 2.6. Inoculation of larvae with transfected Cp14R cells The transfected cells were incubated at 27 ◦ C for 12 days, harvested by scraping, and then centrifuged for 2 min at 13,000 rpm. The pellet was taken up in 100 l H2 O and 5 l inoculated onto small plugs of diet (approximately 4 mm3 ) lacking formaldehyde. Each of 20 fifth instar C. pomonella larvae (13 days old) fed on a plug of diet for 16 h and was then fed diet containing formaldehyde. Larvae were collected 7 days later. The occlusion bodies were
58
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
extracted and purified from individual larvae using glycerol gradients. The DNA was extracted from the occlusion bodies and digested with restriction endonucleases to confirm that the virus had the correct restriction profile of the resulting bacmid. 2.7. Injection of larvae with DNA/DEAE–dextran complex The DNA/DEAE–dextran was complexed and injected into larvae, based on methods described previously (Croizier et al., 1988; Skuratovskaya et al., 1977). In brief, bacmid DNA was diluted to 100 g/ml in sterile IZDO4 medium. A final volume of 0.1 mg/ml DEAE–dextran was obtained using a stock of 10 mg/ml DEAE–dextran in sterile TE pH 8.0. The mixture was allowed to complex for 30 min at room temperature. Larvae were anaesthetised with diethyl ether vapour for 2–3 min. 2 l of the DNA complex was injected through a proleg into the haemocoel of fifth instar C. pomonella larvae. The larvae were then reared on diet containing formaldehyde. 2.8. Transposition of the bacmid Components from the Bac-to-Bac® Baculovirus Expression System (Invitrogen) were used for transposition. These included DH10Bac cells which contained the AcMNPV bacmid and the helper plasmid (pMON7124) that expresses the Tn7 proteins necessary for transposition of mini-Tn7. The helper plasmid was separated using selective media and retransformed into DH10B cells containing the CpGV bacmid. The Bac-to-Bac® system also contained the pFastBac donor plasmid for transposition into the polyhedrin region of the AcMNPV bacmid. The multi-cloning site (MCS) is behind the AcMNPV polyhedrin promoter. As this promoter was not required in the granulovirus system, the promoter was excised with SnaBI and BamHI, end filled, religated and named pFastBac polyP. This plasmid was then transformed into electrocompetent DH10B cells containing the CpGV bacmid and helper plasmid (pMON7124). Transformed cells were plated on Luria plates containing 50 g/ml kanamycin, 7 g/ml gentamicin, 10 g/ml tetracycline, 100 g/ml Bluo-gal and 40 g/ml IPTG. White colonies were picked (due to disruption of LacZ in the bacmid) and restreaked to confirm the phenotype. The colonies were then picked and grown for 24 h at 37 ◦ C in 2 ml of LB medium containing 50 g/ml kanamycin, 7 g/ml gentamicin and 10 g/ml tetracycline. Mini-preps were performed and the DNA transfected into Cp14R cells and the cells fed to larvae as described in Sections 2.5 and 2.6. The DNA was extracted from the occlusion bodies and digested with restriction endonucleases to confirm that the virus had the correct restriction profile of the resulting bacmid.
ing bacterial template. It was then re-purified using the Qiagen PCR purification kit. The recombinant proficient, electroporation competent BJ5183 cells (Stratagene) were transformed by electroporation with both 1 g CpGV bacmid and 500 ng purified PCR product. The transformed cells were plated on Luria plates containing 50 g/ml kanamycin, 25 g/ml chloramphenicol, 100 g/ml Bluo-gal and 40 g/ml IPTG. After 24 h at 37 ◦ C blue colonies were picked and grown in 2 ml LB containing 50 g/ml kanamycin and 25 g/ml chloramphenicol. A bacterial mini-prep was performed, and PCR was used to confirm the presence of the insertion. 100 ng of the DNA was transformed into DH10B cells, as DNA is prone to unwanted recombination if left in BJ5183 cells. 20 l of the DNA was transfected into Cp14R cells and the cells subsequently fed to larvae as described in Sections 2.5 and 2.6. The DNA was extracted from the occlusion bodies and digested with restriction endonucleases to confirm that the virus had the correct restriction profile of the resulting bacmid. 2.10. In vivo inoculation of larvae with recombinant viruses Fifth instar larvae were inoculated with an estimated 4× LD95 dose based on CpGV-M1 (132 occlusion bodies). The larvae were maintained separately and the virus was applied to a small plug of semi-synthetic diet lacking formaldehyde
2.9. Recombination in BJ5183 A PCR product containing the CAT gene from pBeloBAC11 (New England Biolabs), with flanking CpGV homologous sequences of approximately 50 bp was amplified using the following primers: • Cp v-cath CAT FOR (8936–8985 in CpGV, 1525–1507 in pBelobac11) TAACACTTACTAATTGTCATACTACACTTACTACTACAACAAAAGTTCTCATCGGCACGTAAGAGGTT. • Cp v-cath CAT REV (7885–7934 in CpGV, 785–766 in pBelobac11) TGTTCCATAAAATATATCTATCAATCTATCTATAAGAAAAATTGACGACATTACGCCCCGCCCTGCCAC. The PCR product was purified using the Qiagen PCR purification kit and digested with 2 l DpnI for 2 h to digest any remain-
Fig. 1. (a) Position of the insertion site (PacI) of the 8.6 kb bacmid cassette and (b) schematic of the cloning steps during production of the CpGV-Bacmid.
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
which was consumed within 24 h. Further diet was then added containing formaldehyde and the larvae were monitored daily.
59
out. The dissecting dish was then flooded with buffer (PBS pH 7.0). 2.13. Visualisation of CpGV-EGFP using fluorescence microscopy
2.11. In vitro inoculation of Cp14R cells with recombinant viruses Fifth instar larvae were inoculated as described in Section 2.10. At 4 days post-inoculation (d.p.i.) larvae were bled from a proleg and the haemolymph was collected and diluted 1:10 in cell culture medium. 1 ml of diluted haemolymph was added to Cp14R cells seeded at 1 × 106 cells in a 25-cm2 flask and left for 4 h at 27 ◦ C. The haemolymph was then replaced with cell culture medium. Passage 1 medium was removed at 9 d.p.i. and 1 ml of passage 1 medium was used to inoculate 1 × 106 Cp14R cells in a 25-cm2 flask. Cells were observed daily for signs of infection. 2.12. Dissection of larvae Larvae were anaesthetised with diethyl ether vapour for 2–3 min. The larvae were then pinned dorsal side up onto wax blocks in dissecting dishes. A longitudinal incision was made along the length of the body. The cuticle was pulled aside and pinned
Larvae were visualised under a Leica MZ12 fluorescence stereomicroscope using the GFP plus filter set. Fluorescent cells were observed using an Olympus IX70 inverted microscope. 2.14. Cysteine protease assay C. pomonella larvae were infected with either CpGV-bacmid or CpGV-bacmid v-cath− as described in Section 2.10. 5 days later the fat body tissue was collected and macerated in 0.1 M phosphate buffer (pH 6.0) and briefly centrifuged briefly to pellet insoluble material. The protein content of the fat body extracts was determined using the Bradford assay (Sigma) according to the manufacturer’s recommendations. BSA (Sigma) was used to prepare a standard curve. Assays of protease activity were carried out using Azocoll (Sigma) as a substrate (Chavira et al., 1984), in the presence or absence of the cysteine protease inhibitor E-64 (trans-epoxysuccinyl-l-leucylamido-(4-guanido)butane) at a concentration of 10 M. Assays were carried out in triplicate.
Fig. 2. (a) Restriction endonuclease profiles (across two gels: 1 and 2) of 31 putative CpGV bacmids using the restriction endonuclease BglII. The arrowed clones have the correct restriction profile. (b) Restriction endonuclease profiles of 8 putative bacmids using the restriction endonucleases shown. Clone 1 has a large deletion. Clone 2 is correct for the forward orientation and the remaining clones correct for the reverse orientation. M1 = CpGV-M1 wild-type virus. = HindIII ladder. Kb = 1 kb Plus DNA Ladder (Invitrogen).
60
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
3. Results
3.2. Production of GFP bacmid by transposition
3.1. Production of the CpGV-bacmid
The specialised donor plasmid (pFastBac PolyP) carrying a mini-T7, gentamicin resistance gene and the EGFP gene under the Drosophila heat-shock promoter (hsp) was constructed. The plasmid was transformed into DH10B E. coli cells containing both the CpGV bacmid and a helper plasmid, pMON7124, to generate a recombinant bacmid. This resulted in white colonies, as the lacZ˛ peptide had been disrupted. The bacmid DNA was prepared and transfected into insect cells, which were then fed to larvae to bulk up the recombinant virus. The resulting recombinant CpGV virus caused larvae and cells to glow green under UV light within 4 d.p.i. Larvae were dissected at 5 d.p.i. to observe the tissue tropism of the virus (Fig. 3.).
The CpGV genome was examined for restriction endonuclease sites that would linearise the genome (cut only once). PacI was the only restriction endonuclease to cut in an intergenic region and was therefore selected as the site for insertion of the cassette. The PacI site in CpGV is in an intergenic region at position 101,956 bp between ORF119 and 120 (DNA ligase) in the 3 trailer sequences (Fig. 1a). The 8.6 kbp bacterial cassette was cloned into the PacI site of CpGV as described in Section 2.4 (Fig. 1b). The ligation mixture was transformed into electrocompetent DH10B E. coli cells (Invitrogen). The transformation gave rise to 109 blue colonies on Luria plates containing 50 g/ml kanamycin, 100 g/ml Bluo-gal and 40 g/ml IPTG. These were all picked, grown and stored under glycerol at −80 ◦ C. 31 bacmids were purified and checked by restriction profile using the restriction endonuclease BglII and 8 appeared correct (Fig. 2a). The others had various deletions. The restriction profiles of the eight were confirmed using a further four enzymes (BamHI, EcoRI, SacI and SalI) (Fig. 2b). 7 gave the expected profiles and both orientations of the cassette were represented. Bacmid-2 was in the forward orientation and bacmids 5 and 7 were in the reverse orientation, in regard to the direction of transcription of the Kanamycin resistance gene relative to the granulin gene. The DNA from bacmids 2, 5 and 7 were transfected into Cp14R cells and 12 days later fed to larvae. DNA from bacmid 7 was also injected into fifth instar larvae using a DEAE–dextran complex, as described in Section 2.7. In the larvae fed with transfected cells, all larvae (20/20) died of granulovirus infection. In the injected larvae, only 2/14 larvae (14%) died of granulovirus infection. The amplification of the virus was therefore possible via either of these routes, but the success of infection was much higher in larvae fed with transfected cells and the bacmids were produced via the cell culture route. The restriction profiles were correct for the production of forward and reverse orientation bacmids.
3.3. Production of site-specific recombinants using BJ5183 cells BJ5183 cells are a recombination proficient E. coli strain. The cells contain the components necessary to execute the recombination event between a transfer vector containing the gene of interest and a vector containing the baculovirus genome, provided that appropriate regions of homology are shared between the two vectors (Hanahan, 1983). A bacmid was produced by amplifying the CAT gene (which confers chloramphenicol resistance) flanked by arms homologous to the v-cath gene. The extended primers used for the PCR reaction typically consist of a region of 42 or more nucleotides homologous to the region in which the replacement is intended, followed by an 18–30 nucleotide region homologous to the marker cassette, for amplification of this cassette (Zhang et al., 1998). Larvae infected with the bacmid v-cath− melanised after death, as in CpGV bacmid or wild-type CpGV, but liquefaction did not occur. Cadavers were ‘floppy’ but the integrity of the integument was preserved (Fig. 4). This is in contrast to CpGV bacmid or wildtype CpGV in which liquefaction occurs shortly after death.
Fig. 3. A fifth instar C. pomonella larva infected with the HSP-EGFP bacmid 5 d.p.i. illuminated under white light (left) and UV light (right). The upper panel shows a whole larva and the lower panel shows a dissected larva with internal organs labelled.
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
Fig. 4. Fifth instar C. pomonella larvae infected with the CpGV-bacmid (left) and the CpGV-bacmid with v-cath deletion (right), 16 h post-death.
3.4. Cysteine protease assay In the CpGV-bacmid infected fat bodies, protease activity was reduced in the presence of the cysteine protease inhibitor E-64, confirming the presence of cysteine protease activity in CpGV-infected insects (Fig. 5). However, in the CpGV bacmid v-cath− larvae, protease activity was lower and not affected by the presence of E-64, indicating no viral cysteine protease activity in bacmid v-cathinfected larvae, consistent with the deletion of the v-cath gene. 4. Discussion The AcMNPV Bac-to-Bac® system provides a rapid and efficient method of generating recombinant AcMNPV (Luckow et al., 1993). We have constructed a parallel system to study GV genes, using a CpGV bacmid in C. pomonella cells. A bacmid has been produced using a unique restriction site within an intergenic region in CpGV, which is able to be genetically manipulated in E. coli. Any gene of interest can be transposed into the mini-attT site of the CpGV bacmid. This is a quick and efficient method of introducing genes into the genome. We have tested this method by inserting the hsp-EGFP cassette. This resulted in infected larvae glowing green under UV light. This recombinant virus will be valuable in determining the course of infection and tissue tropism of CpGV. However, this method is somewhat limited in that genes can only be inserted into one position in the genome. Also, the region
61
or gene of interest needs to be cloned into a specialised transfer vector before recombination. The other method of manipulating the genome overcomes these issues by bypassing the transfer vector cloning step and instead directly transfecting PCR amplified DNA. It also uses targeted recombination using BJ5183 cells, which means that the gene or region of DNA can be deleted (by recombination with a selectable marker), and any gene or region of DNA can be inserted into a specific place, anywhere in the genome. This method was tested by inserting the CAT gene into an intergenic region and also by replacing the v-cath gene with the CAT gene. The v-cath gene was removed successfully and cysteine protease activity lost. Revertants can be made where required, by re-inserting the deleted gene into the transposition site. This method has been utilised for AcMNPV bacmids generating gene knock-outs and insertions (Bideshi and Federici, 2000; Lung et al., 2002; Lin and Blissard, 2002). Recombinant bacmids have also been produced using ET recombination (Pijlman et al., 2002) and the Phage lambda red recombinase system (Hou et al., 2002; Vanarsdall et al., 2004). An alternative method, using Rec-A mediated homologous recombination, could also be used for direct gene replacement, which allows a gene to be substitued for another gene without the insertion of a selectable marker gene (Wu et al., 2003). There is now a huge potential for determining the contribution of specific GV genes to virogenesis, infectivity, pathogenesis and tissue tropism by the deletion of genes and observation of phenotypic changes. Recombinant viruses containing reporter gene fusion proteins can be produced as a visual marker to follow protein expression, transport and intracellular localisation during infection. It may be possible to produce bacmids of other GVs, for which there is no permissive cell line, since the bacmid can also be amplified in insects using in vivo transfection via intrahaemocoelic injection. In addition, the recent development of the siRNA-mediated gene silencing technique will complement the CpGV-bacmid and allow future studies of the function of granulovirus genes (Means et al., 2003; Agrawal et al., 2004). The CpGV-bacmid will provide the tool to knock-out and insert specific genes and DNA sequences such as oris, to look at the effect on host range, pathogenicity and DNA replication. The CpGV-bacmid will facilitate studies on the function of the GV genes, e.g., genes involved in host range determination, GV-specific cytopathology and GV-specific genes, which are likely to encode the genes involved in the distinct differences between the GVs and NPVs. Acknowledgements We thank Dr. Zhihong Hu (Wuhan Institute of Virology) for kindly providing the plasmid pHZB10. This work was supported by grants from the Biotechnology and Biological Sciences Research Council (BBSRC). References
Fig. 5. Cysteine protease assay. Protease activity in the presence and absence of the cysteine protease inhibitor E-64 using the wild-type CpGV-bacmid and the v-cathdeletion mutant.
Agrawal, N., Malhotra, P., Bhatnagar, R.K., 2004. siRNA-directed silencing of transgene expressed in cultured insect cells. Biochem. Biophys. Res. Commun. 320, 428–434. Bideshi, D.K., Federici, B.A., 2000. The Trichoplusia ni granulovirus helicase is unable to support replication of Autographa californica multicapsid nucleopolyhedrovirus in cells and larvae of T. ni. J. Gen. Virol. 81, 1593–1599. Chavira, R., Burnett, T.J., Hageman, J.H., 1984. Assaying proteinases with Azocoll. Anal. Biochem. 136, 446–450. Croizier, G., Croizier, L., Quiot, J.M., Lereclus, D., 1988. Recombination of Autographa californica and Rachiplusia ou nuclear polyhedrosis viruses in Galleria mellonella L. J. Gen. Virol. 69, 177–185. Crook, N.E., Payne, C.C., 1980. Comparison of three methods of ELISA for baculoviruses. J. Gen. Virol. 46, 26–37.
62
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
Crook, N.E., Spencer, R.A., Payne, C.C., Leisy, D.J., 1985. Variation in Cydia pomonella granulosis virus isolates and physical maps of the DNA from 3 variants. J. Gen. Virol. 66, 2423–2430. Crook, N.E., James, J.D., Smith, I.R.L., Winstanley, D., 1997. Comprehensive physical map of the Cydia pomonella granulovirus genome and sequence analysis of the granulin gene region. J. Gen. Virol. 78, 965–974. Cross, J.V., Solomon, M.G., Chandler, D., Jarrett, P., Richardson, P.N., Winstanley, D., Bathon, H., Huber, J., Keller, B., Langenbruch, G.A., Zimmerman, G., 1999. Biocontrol of pests of apples and pears in northern and central Europe: 1. Microbial agents and nematodes. Biosci. Biotechnol. Biochem. 9, 125–149. ` Guennelon, G., Audemard, H., Fremond, J.C., El Idrissi Ammari, M.A., 1981. Progres ´ ´ dans l’elevage permanent du Carpocapse Laspeyresia pomonella L. sur realis es milieu artificiel. Agronomie 1, 59–64. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., Gooday, G.W., King, L.A., Kuzio, J.A., Possee, R.D., 1997. Liquefaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virusencoded chitinase and cathepsin genes. Virology 238, 243–253. Hilton, S., Winstanley, D., 2007. Identification and functional analysis of the origins of DNA replication in the Cydia pomonella granulovirus genome. J. Gen. Virol. 88, 1496–1504. Hilton, S., 2008. Baculoviridae: granulovirus, molecular biology, in: Mahy, B.W.J., van Regenmortel, M. (Eds.), Encyclopedia of Virology, 3rd ed., Academic Press. Hou, S., Chen, X., Wang, H., Tao, M., Hu, Z., 2002. Efficient method to generate homologous recombinant baculovirus genomes in E-coli. Biotechniques 32, 783–788. Jarvis, D.L., 1997. Baculovirus expression vectors. In: Miller, L.K. (Ed.), The Baculoviruses. Plenum Publishing Corporation, New York, pp. 389–431. Lin, G.Y., Blissard, G.W., 2002. Analysis of an Autographa californica nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA replication. J. Virol. 76, 2770–2779. Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67, 4566–4579. Lung, O., Westenberg, M., Vlak, J.M., Zuidema, D., Blissard, G.W., 2002. Pseudotyping Autographa californica multicapsid nucleopolyhedrovirus, AcMNPV: F proteins from group II NPVs are functionally analogous to AcMNPV GP64. J. Virol. 76, 5729–5736.
Luque, T., Finch, R., Crook, N., O’Reilly, D.R., Winstanley, D., 2001. The complete sequence of Cydia pomonella granulovirus genome. J. Gen. Virol. 82, 2531–2547. Means, J.C., Muro, I., Clem, R.J., 2003. Silencing of the baculovirus Op-iap3 gene by RNA interference reveals that it is required for prevention of apoptosis during Orgyia pseudotsugata M Nucleopolyhedrovirus Infection of Ld652Y Cells. J. Virol. 77, 4481–4488. Motohashi, T., Shimojima, T., Fukagawa, T., Maenaka, K., Park, E.Y., 2005. Efficient large-scale protein production of larvae and pupae of silkworm by Bombyx mori nuclear polyhedrosis virus bacmid system. Biochem. Biophys. Res. Commun. 326, 564–569. Ohkawa, T., Majima, K., Maeda, S., 1994. A cysteine proteinase encoded by the Baculovirus Bombyx mori nuclear polyhedrosis virus. J. Virol. 68, 6619–6625. Pijlman, G.P., Dortmans, J.C.F.M., Vermeesch, A.M.G., Yang, K., Martens, D.E., Goldbach, R.W., Vlak, J.M., 2002. Pivotal role of the non-hr origin of DNA replication in the genesis of defective interfering baculoviruses. J. Virol. 76, 5605–5611. Skuratovskaya, I.N., Strokovskaya, L.I., Zherebtsova, E.N., Gudz-Gorban, A.P., 1977. Supercoiled DNA of nuclear polyhedrosis virus of Galleria mellonella L. Arch. Virol. 53, 79–86. Smith, I.R.L., Crook, N.E., 1988. In vivo isolation of baculovirus genotypes. Virology 166, 240–244. Theilmann, D.A., Blissard, G.W., Bonning, B., Jehle, J., O’Reilly, D.R., Rohrmann, G.F., Theim, S., Vlak, J.M., 2005. Baculoviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), Virus Taxonomy—Eighth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, London, pp. 177–185. Vanarsdall, A.L., Okano, K., Rohrmann, G.F., 2004. Characterization of a baculovirus with a deletion of vlf-1. Virology 326 (1), 191–201. Wang, H.Z., Deng, F., Pijlman, G.P., Chen, X.W., Sun, X.L., Vlak, J.M., Hu, Z.H., 2003. Cloning of biologically active genomes from a Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus isolate by using a bacterial artificial chromosome. Virus Res. 97, 57–63. Winstanley, D., Crook, N.E., 1993. Replication of Cydia pomonella granulosis virus in cell cultures. J. Gen. Virol. 74, 1599–1609. Wormleaton, S. L., 2000. Molecular and biological studies of fast and slow killing granuloviruses. Ph.D. Thesis. University of Warwick. Wu, W.W., Wang, J.W., Deng, R.Q., Wang, X.Z., He, X.L., Long, Q.X., 2003. An efficient method for precise gene substitution in the AcMNPV genome by homologous recombination in E. coli. J. Virol. Methods 113, 95–101. Zhang, Y.M., Buchholz, F., Muyrers, J.P.P., Stewart, A.F., 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123–128.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A bacmid approach to the genetic manipulation of granuloviruses Sally Hilton ∗ , Elizabeth Kemp, Gary Keane, Doreen Winstanley Warwick HRI, The University of Warwick, Wellesbourne, Warwick CV35 9EF, UK
a r t i c l e
i n f o
Article history: Received 20 February 2008 Received in revised form 8 May 2008 Accepted 14 May 2008 Available online 3 July 2008 Keywords: Baculovirus Granulovirus Bacmid CpGV Cydia pomonella
a b s t r a c t A Cydia pomonella granulovirus (CpGV) bacmid has been constructed, which allows rapid and efficient production of recombinant baculoviruses in Escherichia coli. An 8.6 kbp bacterial DNA cassette derived from the AcMNPV Bac-to-Bac® system was ligated into a unique PacI restriction site within an intergenic region flanking the DNA ligase gene of the CpGV genome. The CpGV bacmids produced in E. coli were transfected into a CpGV-permissive C. pomonella cell line and the transfected cells fed to larvae to amplify the virus. The enhanced green fluorescent protein (EGFP) gene under the constitutive Drosophila heatshock promoter was transposed into the mini-attTn7 transposition site, using a modified pFASTBACTM donor plasmid, to generate a recombinant CpGV bacmid which caused infected larvae to glow under UV light. Targeted homologous recombination was also achieved in a recombinant proficient E. coli strain (BJ5183). A chloramphenicol acetyl transferase (CAT) gene replaced the cathepsin (v-cath) gene in the bacmid to produce a v-cath-deletion mutant. This is the first published report of a granulovirus bacmid, which will allow easy manipulation of the CpGV genome, enabling future studies on granulovirus genes and biology. © 2008 Elsevier B.V. All rights reserved.
1. Introduction The family Baculoviridae includes a large group of circular double-stranded DNA viruses, with genomes ranging from 80 to 180 kbp (Theilmann et al., 2005). They are widely used as bioinsecticides for insect pest control, and as efficient eukaryotic expression vectors in insect cells (Theilmann et al., 2005). Baculoviruses infect invertebrates, mostly insects from the order Lepidoptera. There are two genera: Nucleopolyhedrovirus (NPV) and Granulovirus (GV) which each have distinct characteristics (Theilmann et al., 2005). Phenotypically, GVs have a single nucleocapsid enveloped within each virion and only one virion embedded in the occlusion body, whereas NPVs contain single or multiple nucleocapsids per virion and multiple virions per occlusion body (Theilmann et al., 2005). Other differences exist between the groups including host range, tissue tropism and cytopathology. Cydia pomonella granulovirus (CpGV) is highly pathogenic to the larvae of C. pomonella (codling moth), which is an important economic pest of commercial apple orchards throughout the world (Cross et al., 1999). Formulated products of CpGV are available in many countries worldwide (Cross et al., 1999). The virus is highly virulent against codling moth, particularly neonates, which
∗ Corresponding author. Tel.: +44 24 7657 4455; fax: +44 24 7657 4500. E-mail address: [email protected] (S. Hilton). 0166-0934/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2008.05.015
can be killed after the ingestion of only a single occlusion body (Wormleaton, 2000). There have been extensive molecular studies performed on NPVs, in particular Autographa californica multicapsid NPV (AcMNPV), due to the availability of a variety of NPV-permissive cell lines and the high multiplicity of infections obtained in vitro (Jarvis, 1997). In contrast, relatively few studies have been performed on GVs due to the lack of GV-permissive cell lines and the low virus titres obtained (Winstanley and Crook, 1993). As a result, there are very few gene expression or biochemical characterisation studies of the GV genes or proteins. Granulovirus genomes are a rich source of novel genes; there are currently 44 GV-specific genes which are found in 2 or more GV genomes, of which 22 are present in all sequenced GV genomes (Hilton, 2008). These genes may have important generic functions in Eukaryotes, but studies have been restricted by the lack of an efficient system to manipulate the GV genome. C. pomonella embryonic cell lines permissive for CpGV have been developed (Winstanley and Crook, 1993) and the genome of CpGV has also been sequenced, being 123.5 kbp in size (Luque et al., 2001). These have enabled molecular studies on GVs to progress including the characterisation of the origins of replication of CpGV (Hilton and Winstanley, 2007). Therefore, opportunities exist to study the function of granulovirus genes in granulovirus-permissive cells and larvae, but an efficient system for producing recombinant GVs is required.
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
The TCID50 (tissue culture infective dose) of CpGV in C. pomonella cells is low compared to NPV systems, with 1 × 105 TCID50 /ml being the maximum achievable routinely. Several recombinant CpGV viruses have been made in this laboratory by conventional homologous recombination in vitro, but it has been a laborious and inefficient process requiring the co-transfection of plasmid transfer vectors and supercoiled wild-type viral DNA into insect cells, followed by multiple in vitro cloning dilutions to purify the recombinant from the wild-type virus, and finally amplification of the recombinant baculovirus (Wormleaton, 2000). A more rapid and efficient method to generate recombinant AcMNPV viruses was developed using the site-specific transposition of an expression cassette into a baculovirus shuttle vector (AcMNPV bacmid) that can be propagated in E. coli (Luckow et al., 1993). This bacmid contains a mini-F replicon, a kanamycin resistance marker and a segment of DNA carrying the lacZ˛ gene with an attachment site for the bacterial transposon Tn7. Transposition takes place in E. coli and the recombinant bacmid DNA can be rapidly isolated from small-scale cultures and then used to transfect insect cells. Virus stocks harvested from the transfected cells can be used to infect insects. This has resulted in the commercially available AcMNPV Bacto-Bac® Baculovirus Expression System (Invitrogen). Since then three further NPV bacmids have been produced using the bacterial cassette from the AcMNPV bacmid, Helicoverpa armigera SNPV (Hou et al., 2002; Wang et al., 2003), Spodoptera exigua MNPV (Pijlman et al., 2002) and Bombyx mori MNPV (Motohashi et al., 2005). The production of a CpGV-bacmid that is infectious for a C. pomonella cell line and larvae is described, as well as recombinant CpGV-bacmids generated via two described previously mechanisms. The first uses the transposon Tn7 to insert the target gene into the viral genome at a mini-attTn7 site, as in the Bac-to-Bac® system. A recombinant CpGV expressing the enhanced green fluorescent protein (EGFP) gene under the constitutive Drosophila heat-shock promoter was generated using this method. The second method uses targeted homologous recombination in recombination proficient E. coli cells. The chloramphenicol acetyl transferase (CAT) gene replaced a baculovirus gene, vcath, a cysteine protease homologue responsible for post-mortem melanisation and liquefaction (Ohkawa et al., 1994; Hawtin et al., 1997). The CpGV-bacmid provides a fast and efficient method for the manipulation of the GV genome in E. coli. This will overcome the rate-limiting step associated with the lack of highly permissive GV susceptible cell lines, allowing the study of granuloviruses genes in a granulovirus system for the first time. 2. Materials and methods 2.1. Insects A laboratory stock of C. pomonella was reared at 25 ◦ C with a 16:8 h light:dark cycle on semi-synthetic diet (Guennelon et al., 1981). The culture originated from Dr. Audemard, INRA, Montfavet, France, and has been maintained in the insect rearing unit at Warwick HRI since 1988. Eggs were surface sterilised for 6 h in vapour from 5% formaldehyde (v/v). 2.2. Virus and cells A cloned Mexican isolate (CpGV-M1) was used (Crook et al., 1997). The C. pomonella cell line used (Cp14R) was derived from
57
Cp14 cells (Winstanley and Crook, 1993). The cells were propagated in IZD04 media, supplemented with 10% fetal bovine serum (FBS) (Winstanley and Crook, 1993). The GV occlusion bodies were purified using glycerol gradients, following methods described previously (Crook and Payne, 1980). 2.3. DNA extraction and analysis Viral DNA was extracted and purified from a single infected insect, as described previously (Smith and Crook, 1988). Restriction endonuclease fragment analyses were carried out as described by Crook et al. (1985). In brief, 600 ng purified DNA was digested with 10 U restriction endonuclease for 2 h at 37 ◦ C. The digested DNA was run on a 0.7% agarose gel for 16 h at 15–20 V and viewed using a transilluminator. 2.4. Construction of the CpGV-bacmid The 8.6 kb BAC cassette containing the kanamycin resistance gene, LacZ with mini-attTn7 site and mini-F replicon, in the plasmid pHZB10, was kindly donated by Dr. Zhihong Hu (Wang et al., 2003). This cassette originated from the commercially available Bac-toBac® Baculovirus Expression System (Invitrogen). The plasmid pHZB10 contained the 8.6 kbp cassette cloned into a Bsu36I site. This plasmid was digested with Bsu36I and the 8.6 kbp cassette was gel purified (Qiagen gel extraction kit) and end filled. PacI linkers (New England Biolabs) were ligated to the blunt ends using T4 DNA ligase (Invitrogen) and the cassette was dephosphorylated using Shrimp Alkaline Phosphatase (Roche) to prevent re-ligation. The cassette was then ligated into a modified pBluescript SK+ (pBSK+) containing a PacI site in the multi-cloning site. The cassette was sequenced to check that no mutations had occurred during cloning. The cassette was then cloned into a unique PacI site in CpGV using 500 ng of linearised CpGV and 25 ng of dephosphorylated 8.6 kb cassette DNA. Ligations were transformed into ElectroMAX DH10B cells (Invitrogen) at 200 , 25 kV, 2.5 F. Transformed cells were plated on Luria plates containing 50 g/ml kanamycin, 100 g/ml Bluo-gal, 40 g/ml IPTG. Blue colonies were picked and restreaked to verify the phenotype. They were then picked and grown at 37 ◦ C for 24 h in 2 ml of Luria broth (LB) containing 50 g/ml kanamycin in a snap-cap 15 ml Falcon® 2059 tube. Mini-preps were performed and the DNA pellets gently dissolved in 40 l of 1× TE buffer, pH 8.0. The DNA was left at room temperature for at least 10 min to allow the DNA to redissolve before transfection into C. pomonella cells. 2.5. Transfection of mini-prep DNA DNA was transfected into Cp14R cells as follows: 20 l miniprep DNA was mixed with 20 l Cellfectin using the manufacturer’s recommendations (Invitrogen). The complex was added to the cells for 3 h in a 25-cm2 flask of Cp14R cells containing 1 × 106 viable cells (which had been allowed to attach for 2 days). The transfection mixture was removed and fresh medium added. 2.6. Inoculation of larvae with transfected Cp14R cells The transfected cells were incubated at 27 ◦ C for 12 days, harvested by scraping, and then centrifuged for 2 min at 13,000 rpm. The pellet was taken up in 100 l H2 O and 5 l inoculated onto small plugs of diet (approximately 4 mm3 ) lacking formaldehyde. Each of 20 fifth instar C. pomonella larvae (13 days old) fed on a plug of diet for 16 h and was then fed diet containing formaldehyde. Larvae were collected 7 days later. The occlusion bodies were
58
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
extracted and purified from individual larvae using glycerol gradients. The DNA was extracted from the occlusion bodies and digested with restriction endonucleases to confirm that the virus had the correct restriction profile of the resulting bacmid. 2.7. Injection of larvae with DNA/DEAE–dextran complex The DNA/DEAE–dextran was complexed and injected into larvae, based on methods described previously (Croizier et al., 1988; Skuratovskaya et al., 1977). In brief, bacmid DNA was diluted to 100 g/ml in sterile IZDO4 medium. A final volume of 0.1 mg/ml DEAE–dextran was obtained using a stock of 10 mg/ml DEAE–dextran in sterile TE pH 8.0. The mixture was allowed to complex for 30 min at room temperature. Larvae were anaesthetised with diethyl ether vapour for 2–3 min. 2 l of the DNA complex was injected through a proleg into the haemocoel of fifth instar C. pomonella larvae. The larvae were then reared on diet containing formaldehyde. 2.8. Transposition of the bacmid Components from the Bac-to-Bac® Baculovirus Expression System (Invitrogen) were used for transposition. These included DH10Bac cells which contained the AcMNPV bacmid and the helper plasmid (pMON7124) that expresses the Tn7 proteins necessary for transposition of mini-Tn7. The helper plasmid was separated using selective media and retransformed into DH10B cells containing the CpGV bacmid. The Bac-to-Bac® system also contained the pFastBac donor plasmid for transposition into the polyhedrin region of the AcMNPV bacmid. The multi-cloning site (MCS) is behind the AcMNPV polyhedrin promoter. As this promoter was not required in the granulovirus system, the promoter was excised with SnaBI and BamHI, end filled, religated and named pFastBac polyP. This plasmid was then transformed into electrocompetent DH10B cells containing the CpGV bacmid and helper plasmid (pMON7124). Transformed cells were plated on Luria plates containing 50 g/ml kanamycin, 7 g/ml gentamicin, 10 g/ml tetracycline, 100 g/ml Bluo-gal and 40 g/ml IPTG. White colonies were picked (due to disruption of LacZ in the bacmid) and restreaked to confirm the phenotype. The colonies were then picked and grown for 24 h at 37 ◦ C in 2 ml of LB medium containing 50 g/ml kanamycin, 7 g/ml gentamicin and 10 g/ml tetracycline. Mini-preps were performed and the DNA transfected into Cp14R cells and the cells fed to larvae as described in Sections 2.5 and 2.6. The DNA was extracted from the occlusion bodies and digested with restriction endonucleases to confirm that the virus had the correct restriction profile of the resulting bacmid.
ing bacterial template. It was then re-purified using the Qiagen PCR purification kit. The recombinant proficient, electroporation competent BJ5183 cells (Stratagene) were transformed by electroporation with both 1 g CpGV bacmid and 500 ng purified PCR product. The transformed cells were plated on Luria plates containing 50 g/ml kanamycin, 25 g/ml chloramphenicol, 100 g/ml Bluo-gal and 40 g/ml IPTG. After 24 h at 37 ◦ C blue colonies were picked and grown in 2 ml LB containing 50 g/ml kanamycin and 25 g/ml chloramphenicol. A bacterial mini-prep was performed, and PCR was used to confirm the presence of the insertion. 100 ng of the DNA was transformed into DH10B cells, as DNA is prone to unwanted recombination if left in BJ5183 cells. 20 l of the DNA was transfected into Cp14R cells and the cells subsequently fed to larvae as described in Sections 2.5 and 2.6. The DNA was extracted from the occlusion bodies and digested with restriction endonucleases to confirm that the virus had the correct restriction profile of the resulting bacmid. 2.10. In vivo inoculation of larvae with recombinant viruses Fifth instar larvae were inoculated with an estimated 4× LD95 dose based on CpGV-M1 (132 occlusion bodies). The larvae were maintained separately and the virus was applied to a small plug of semi-synthetic diet lacking formaldehyde
2.9. Recombination in BJ5183 A PCR product containing the CAT gene from pBeloBAC11 (New England Biolabs), with flanking CpGV homologous sequences of approximately 50 bp was amplified using the following primers: • Cp v-cath CAT FOR (8936–8985 in CpGV, 1525–1507 in pBelobac11) TAACACTTACTAATTGTCATACTACACTTACTACTACAACAAAAGTTCTCATCGGCACGTAAGAGGTT. • Cp v-cath CAT REV (7885–7934 in CpGV, 785–766 in pBelobac11) TGTTCCATAAAATATATCTATCAATCTATCTATAAGAAAAATTGACGACATTACGCCCCGCCCTGCCAC. The PCR product was purified using the Qiagen PCR purification kit and digested with 2 l DpnI for 2 h to digest any remain-
Fig. 1. (a) Position of the insertion site (PacI) of the 8.6 kb bacmid cassette and (b) schematic of the cloning steps during production of the CpGV-Bacmid.
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
which was consumed within 24 h. Further diet was then added containing formaldehyde and the larvae were monitored daily.
59
out. The dissecting dish was then flooded with buffer (PBS pH 7.0). 2.13. Visualisation of CpGV-EGFP using fluorescence microscopy
2.11. In vitro inoculation of Cp14R cells with recombinant viruses Fifth instar larvae were inoculated as described in Section 2.10. At 4 days post-inoculation (d.p.i.) larvae were bled from a proleg and the haemolymph was collected and diluted 1:10 in cell culture medium. 1 ml of diluted haemolymph was added to Cp14R cells seeded at 1 × 106 cells in a 25-cm2 flask and left for 4 h at 27 ◦ C. The haemolymph was then replaced with cell culture medium. Passage 1 medium was removed at 9 d.p.i. and 1 ml of passage 1 medium was used to inoculate 1 × 106 Cp14R cells in a 25-cm2 flask. Cells were observed daily for signs of infection. 2.12. Dissection of larvae Larvae were anaesthetised with diethyl ether vapour for 2–3 min. The larvae were then pinned dorsal side up onto wax blocks in dissecting dishes. A longitudinal incision was made along the length of the body. The cuticle was pulled aside and pinned
Larvae were visualised under a Leica MZ12 fluorescence stereomicroscope using the GFP plus filter set. Fluorescent cells were observed using an Olympus IX70 inverted microscope. 2.14. Cysteine protease assay C. pomonella larvae were infected with either CpGV-bacmid or CpGV-bacmid v-cath− as described in Section 2.10. 5 days later the fat body tissue was collected and macerated in 0.1 M phosphate buffer (pH 6.0) and briefly centrifuged briefly to pellet insoluble material. The protein content of the fat body extracts was determined using the Bradford assay (Sigma) according to the manufacturer’s recommendations. BSA (Sigma) was used to prepare a standard curve. Assays of protease activity were carried out using Azocoll (Sigma) as a substrate (Chavira et al., 1984), in the presence or absence of the cysteine protease inhibitor E-64 (trans-epoxysuccinyl-l-leucylamido-(4-guanido)butane) at a concentration of 10 M. Assays were carried out in triplicate.
Fig. 2. (a) Restriction endonuclease profiles (across two gels: 1 and 2) of 31 putative CpGV bacmids using the restriction endonuclease BglII. The arrowed clones have the correct restriction profile. (b) Restriction endonuclease profiles of 8 putative bacmids using the restriction endonucleases shown. Clone 1 has a large deletion. Clone 2 is correct for the forward orientation and the remaining clones correct for the reverse orientation. M1 = CpGV-M1 wild-type virus. = HindIII ladder. Kb = 1 kb Plus DNA Ladder (Invitrogen).
60
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
3. Results
3.2. Production of GFP bacmid by transposition
3.1. Production of the CpGV-bacmid
The specialised donor plasmid (pFastBac PolyP) carrying a mini-T7, gentamicin resistance gene and the EGFP gene under the Drosophila heat-shock promoter (hsp) was constructed. The plasmid was transformed into DH10B E. coli cells containing both the CpGV bacmid and a helper plasmid, pMON7124, to generate a recombinant bacmid. This resulted in white colonies, as the lacZ˛ peptide had been disrupted. The bacmid DNA was prepared and transfected into insect cells, which were then fed to larvae to bulk up the recombinant virus. The resulting recombinant CpGV virus caused larvae and cells to glow green under UV light within 4 d.p.i. Larvae were dissected at 5 d.p.i. to observe the tissue tropism of the virus (Fig. 3.).
The CpGV genome was examined for restriction endonuclease sites that would linearise the genome (cut only once). PacI was the only restriction endonuclease to cut in an intergenic region and was therefore selected as the site for insertion of the cassette. The PacI site in CpGV is in an intergenic region at position 101,956 bp between ORF119 and 120 (DNA ligase) in the 3 trailer sequences (Fig. 1a). The 8.6 kbp bacterial cassette was cloned into the PacI site of CpGV as described in Section 2.4 (Fig. 1b). The ligation mixture was transformed into electrocompetent DH10B E. coli cells (Invitrogen). The transformation gave rise to 109 blue colonies on Luria plates containing 50 g/ml kanamycin, 100 g/ml Bluo-gal and 40 g/ml IPTG. These were all picked, grown and stored under glycerol at −80 ◦ C. 31 bacmids were purified and checked by restriction profile using the restriction endonuclease BglII and 8 appeared correct (Fig. 2a). The others had various deletions. The restriction profiles of the eight were confirmed using a further four enzymes (BamHI, EcoRI, SacI and SalI) (Fig. 2b). 7 gave the expected profiles and both orientations of the cassette were represented. Bacmid-2 was in the forward orientation and bacmids 5 and 7 were in the reverse orientation, in regard to the direction of transcription of the Kanamycin resistance gene relative to the granulin gene. The DNA from bacmids 2, 5 and 7 were transfected into Cp14R cells and 12 days later fed to larvae. DNA from bacmid 7 was also injected into fifth instar larvae using a DEAE–dextran complex, as described in Section 2.7. In the larvae fed with transfected cells, all larvae (20/20) died of granulovirus infection. In the injected larvae, only 2/14 larvae (14%) died of granulovirus infection. The amplification of the virus was therefore possible via either of these routes, but the success of infection was much higher in larvae fed with transfected cells and the bacmids were produced via the cell culture route. The restriction profiles were correct for the production of forward and reverse orientation bacmids.
3.3. Production of site-specific recombinants using BJ5183 cells BJ5183 cells are a recombination proficient E. coli strain. The cells contain the components necessary to execute the recombination event between a transfer vector containing the gene of interest and a vector containing the baculovirus genome, provided that appropriate regions of homology are shared between the two vectors (Hanahan, 1983). A bacmid was produced by amplifying the CAT gene (which confers chloramphenicol resistance) flanked by arms homologous to the v-cath gene. The extended primers used for the PCR reaction typically consist of a region of 42 or more nucleotides homologous to the region in which the replacement is intended, followed by an 18–30 nucleotide region homologous to the marker cassette, for amplification of this cassette (Zhang et al., 1998). Larvae infected with the bacmid v-cath− melanised after death, as in CpGV bacmid or wild-type CpGV, but liquefaction did not occur. Cadavers were ‘floppy’ but the integrity of the integument was preserved (Fig. 4). This is in contrast to CpGV bacmid or wildtype CpGV in which liquefaction occurs shortly after death.
Fig. 3. A fifth instar C. pomonella larva infected with the HSP-EGFP bacmid 5 d.p.i. illuminated under white light (left) and UV light (right). The upper panel shows a whole larva and the lower panel shows a dissected larva with internal organs labelled.
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
Fig. 4. Fifth instar C. pomonella larvae infected with the CpGV-bacmid (left) and the CpGV-bacmid with v-cath deletion (right), 16 h post-death.
3.4. Cysteine protease assay In the CpGV-bacmid infected fat bodies, protease activity was reduced in the presence of the cysteine protease inhibitor E-64, confirming the presence of cysteine protease activity in CpGV-infected insects (Fig. 5). However, in the CpGV bacmid v-cath− larvae, protease activity was lower and not affected by the presence of E-64, indicating no viral cysteine protease activity in bacmid v-cathinfected larvae, consistent with the deletion of the v-cath gene. 4. Discussion The AcMNPV Bac-to-Bac® system provides a rapid and efficient method of generating recombinant AcMNPV (Luckow et al., 1993). We have constructed a parallel system to study GV genes, using a CpGV bacmid in C. pomonella cells. A bacmid has been produced using a unique restriction site within an intergenic region in CpGV, which is able to be genetically manipulated in E. coli. Any gene of interest can be transposed into the mini-attT site of the CpGV bacmid. This is a quick and efficient method of introducing genes into the genome. We have tested this method by inserting the hsp-EGFP cassette. This resulted in infected larvae glowing green under UV light. This recombinant virus will be valuable in determining the course of infection and tissue tropism of CpGV. However, this method is somewhat limited in that genes can only be inserted into one position in the genome. Also, the region
61
or gene of interest needs to be cloned into a specialised transfer vector before recombination. The other method of manipulating the genome overcomes these issues by bypassing the transfer vector cloning step and instead directly transfecting PCR amplified DNA. It also uses targeted recombination using BJ5183 cells, which means that the gene or region of DNA can be deleted (by recombination with a selectable marker), and any gene or region of DNA can be inserted into a specific place, anywhere in the genome. This method was tested by inserting the CAT gene into an intergenic region and also by replacing the v-cath gene with the CAT gene. The v-cath gene was removed successfully and cysteine protease activity lost. Revertants can be made where required, by re-inserting the deleted gene into the transposition site. This method has been utilised for AcMNPV bacmids generating gene knock-outs and insertions (Bideshi and Federici, 2000; Lung et al., 2002; Lin and Blissard, 2002). Recombinant bacmids have also been produced using ET recombination (Pijlman et al., 2002) and the Phage lambda red recombinase system (Hou et al., 2002; Vanarsdall et al., 2004). An alternative method, using Rec-A mediated homologous recombination, could also be used for direct gene replacement, which allows a gene to be substitued for another gene without the insertion of a selectable marker gene (Wu et al., 2003). There is now a huge potential for determining the contribution of specific GV genes to virogenesis, infectivity, pathogenesis and tissue tropism by the deletion of genes and observation of phenotypic changes. Recombinant viruses containing reporter gene fusion proteins can be produced as a visual marker to follow protein expression, transport and intracellular localisation during infection. It may be possible to produce bacmids of other GVs, for which there is no permissive cell line, since the bacmid can also be amplified in insects using in vivo transfection via intrahaemocoelic injection. In addition, the recent development of the siRNA-mediated gene silencing technique will complement the CpGV-bacmid and allow future studies of the function of granulovirus genes (Means et al., 2003; Agrawal et al., 2004). The CpGV-bacmid will provide the tool to knock-out and insert specific genes and DNA sequences such as oris, to look at the effect on host range, pathogenicity and DNA replication. The CpGV-bacmid will facilitate studies on the function of the GV genes, e.g., genes involved in host range determination, GV-specific cytopathology and GV-specific genes, which are likely to encode the genes involved in the distinct differences between the GVs and NPVs. Acknowledgements We thank Dr. Zhihong Hu (Wuhan Institute of Virology) for kindly providing the plasmid pHZB10. This work was supported by grants from the Biotechnology and Biological Sciences Research Council (BBSRC). References
Fig. 5. Cysteine protease assay. Protease activity in the presence and absence of the cysteine protease inhibitor E-64 using the wild-type CpGV-bacmid and the v-cathdeletion mutant.
Agrawal, N., Malhotra, P., Bhatnagar, R.K., 2004. siRNA-directed silencing of transgene expressed in cultured insect cells. Biochem. Biophys. Res. Commun. 320, 428–434. Bideshi, D.K., Federici, B.A., 2000. The Trichoplusia ni granulovirus helicase is unable to support replication of Autographa californica multicapsid nucleopolyhedrovirus in cells and larvae of T. ni. J. Gen. Virol. 81, 1593–1599. Chavira, R., Burnett, T.J., Hageman, J.H., 1984. Assaying proteinases with Azocoll. Anal. Biochem. 136, 446–450. Croizier, G., Croizier, L., Quiot, J.M., Lereclus, D., 1988. Recombination of Autographa californica and Rachiplusia ou nuclear polyhedrosis viruses in Galleria mellonella L. J. Gen. Virol. 69, 177–185. Crook, N.E., Payne, C.C., 1980. Comparison of three methods of ELISA for baculoviruses. J. Gen. Virol. 46, 26–37.
62
S. Hilton et al. / Journal of Virological Methods 152 (2008) 56–62
Crook, N.E., Spencer, R.A., Payne, C.C., Leisy, D.J., 1985. Variation in Cydia pomonella granulosis virus isolates and physical maps of the DNA from 3 variants. J. Gen. Virol. 66, 2423–2430. Crook, N.E., James, J.D., Smith, I.R.L., Winstanley, D., 1997. Comprehensive physical map of the Cydia pomonella granulovirus genome and sequence analysis of the granulin gene region. J. Gen. Virol. 78, 965–974. Cross, J.V., Solomon, M.G., Chandler, D., Jarrett, P., Richardson, P.N., Winstanley, D., Bathon, H., Huber, J., Keller, B., Langenbruch, G.A., Zimmerman, G., 1999. Biocontrol of pests of apples and pears in northern and central Europe: 1. Microbial agents and nematodes. Biosci. Biotechnol. Biochem. 9, 125–149. ` Guennelon, G., Audemard, H., Fremond, J.C., El Idrissi Ammari, M.A., 1981. Progres ´ ´ dans l’elevage permanent du Carpocapse Laspeyresia pomonella L. sur realis es milieu artificiel. Agronomie 1, 59–64. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., Gooday, G.W., King, L.A., Kuzio, J.A., Possee, R.D., 1997. Liquefaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virusencoded chitinase and cathepsin genes. Virology 238, 243–253. Hilton, S., Winstanley, D., 2007. Identification and functional analysis of the origins of DNA replication in the Cydia pomonella granulovirus genome. J. Gen. Virol. 88, 1496–1504. Hilton, S., 2008. Baculoviridae: granulovirus, molecular biology, in: Mahy, B.W.J., van Regenmortel, M. (Eds.), Encyclopedia of Virology, 3rd ed., Academic Press. Hou, S., Chen, X., Wang, H., Tao, M., Hu, Z., 2002. Efficient method to generate homologous recombinant baculovirus genomes in E-coli. Biotechniques 32, 783–788. Jarvis, D.L., 1997. Baculovirus expression vectors. In: Miller, L.K. (Ed.), The Baculoviruses. Plenum Publishing Corporation, New York, pp. 389–431. Lin, G.Y., Blissard, G.W., 2002. Analysis of an Autographa californica nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA replication. J. Virol. 76, 2770–2779. Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67, 4566–4579. Lung, O., Westenberg, M., Vlak, J.M., Zuidema, D., Blissard, G.W., 2002. Pseudotyping Autographa californica multicapsid nucleopolyhedrovirus, AcMNPV: F proteins from group II NPVs are functionally analogous to AcMNPV GP64. J. Virol. 76, 5729–5736.
Luque, T., Finch, R., Crook, N., O’Reilly, D.R., Winstanley, D., 2001. The complete sequence of Cydia pomonella granulovirus genome. J. Gen. Virol. 82, 2531–2547. Means, J.C., Muro, I., Clem, R.J., 2003. Silencing of the baculovirus Op-iap3 gene by RNA interference reveals that it is required for prevention of apoptosis during Orgyia pseudotsugata M Nucleopolyhedrovirus Infection of Ld652Y Cells. J. Virol. 77, 4481–4488. Motohashi, T., Shimojima, T., Fukagawa, T., Maenaka, K., Park, E.Y., 2005. Efficient large-scale protein production of larvae and pupae of silkworm by Bombyx mori nuclear polyhedrosis virus bacmid system. Biochem. Biophys. Res. Commun. 326, 564–569. Ohkawa, T., Majima, K., Maeda, S., 1994. A cysteine proteinase encoded by the Baculovirus Bombyx mori nuclear polyhedrosis virus. J. Virol. 68, 6619–6625. Pijlman, G.P., Dortmans, J.C.F.M., Vermeesch, A.M.G., Yang, K., Martens, D.E., Goldbach, R.W., Vlak, J.M., 2002. Pivotal role of the non-hr origin of DNA replication in the genesis of defective interfering baculoviruses. J. Virol. 76, 5605–5611. Skuratovskaya, I.N., Strokovskaya, L.I., Zherebtsova, E.N., Gudz-Gorban, A.P., 1977. Supercoiled DNA of nuclear polyhedrosis virus of Galleria mellonella L. Arch. Virol. 53, 79–86. Smith, I.R.L., Crook, N.E., 1988. In vivo isolation of baculovirus genotypes. Virology 166, 240–244. Theilmann, D.A., Blissard, G.W., Bonning, B., Jehle, J., O’Reilly, D.R., Rohrmann, G.F., Theim, S., Vlak, J.M., 2005. Baculoviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), Virus Taxonomy—Eighth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, London, pp. 177–185. Vanarsdall, A.L., Okano, K., Rohrmann, G.F., 2004. Characterization of a baculovirus with a deletion of vlf-1. Virology 326 (1), 191–201. Wang, H.Z., Deng, F., Pijlman, G.P., Chen, X.W., Sun, X.L., Vlak, J.M., Hu, Z.H., 2003. Cloning of biologically active genomes from a Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus isolate by using a bacterial artificial chromosome. Virus Res. 97, 57–63. Winstanley, D., Crook, N.E., 1993. Replication of Cydia pomonella granulosis virus in cell cultures. J. Gen. Virol. 74, 1599–1609. Wormleaton, S. L., 2000. Molecular and biological studies of fast and slow killing granuloviruses. Ph.D. Thesis. University of Warwick. Wu, W.W., Wang, J.W., Deng, R.Q., Wang, X.Z., He, X.L., Long, Q.X., 2003. An efficient method for precise gene substitution in the AcMNPV genome by homologous recombination in E. coli. J. Virol. Methods 113, 95–101. Zhang, Y.M., Buchholz, F., Muyrers, J.P.P., Stewart, A.F., 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123–128.