A bacterial homologue of the human iron exporter ferroportin

FEBS Letters 589 (2015) 3829–3835

journal homepage: www.FEBSLetters.org

A bacterial homologue of the human iron exporter ferroportin Maria Carmela Bonaccorsi di Patti a, Fabio Polticelli b,c,⇑, Valentina Tortosa b, Pier Antonio Furbetta a, Giovanni Musci d,⇑ a

Department of Biochemical Sciences, Sapienza University of Rome, Rome, Italy Department of Sciences, Roma Tre University, Rome, Italy c National Institute of Nuclear Physics, Roma Tre Section, Rome, Italy d Department of Biosciences and Territory, University of Molise, Pesche, Italy b

a r t i c l e

i n f o

Article history: Received 22 October 2015 Revised 13 November 2015 Accepted 16 November 2015 Available online 19 November 2015 Edited by Stuart Ferguson Keywords: Ferroportin Iron Major facilitator superfamily Bdellovibrio bacteriovorus

a b s t r a c t A bacterial homologue of the human iron exporter ferroportin found in the predatory Gram-negative bacterium Bdellovibrio bacteriovorus has been investigated. Molecular modelling, expression in recombinant form and iron binding and transport assays demonstrate that B. bacteriovorus ferroportin (bdFpn) is indeed an orthologue of human ferroportin. Key residues corresponding to those essential for iron binding and transport in human ferroportin are conserved in the bacterial homologue and are predicted to be correctly clustered in the central cavity of the protein. Mutation of these residues grossly affects the iron binding and transport ability of bdFpn. Ó 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction Ferroportin (Fpn) is a key player in maintenance of iron homeostasis because it is the sole iron exporter so far identified in vertebrates. Missense mutations of Fpn lead to ‘‘ferroportin disease”, or type 4 hemochromatosis, characterized by dominant inheritance and by two distinct phenotypes in terms of iron accumulation depending on whether the mutation affects the activity or the degradation pathway of Fpn ([1] and Refs. therein). Binding of the peptide hepcidin induces internalization and degradation of Fpn [2], thus limiting iron export from cells. Recently, structural models of human Fpn (hFpn) have been obtained by independent groups [3–5]. The first model of hFpn revealed that the protein belongs to the major facilitator superfamily (MFS) [3], whose members display a hexameric packing scheme

Abbreviations: Fpn, ferroportin; MFS, major facilitator superfamily Author contributions: GM, FP, MCB, planned experiments; FP, MCB, VT, PAF performed experiments; GM, FP MCB, analyzed data; GM, FP, MCB wrote the paper. ⇑ Corresponding authors at: Department of Sciences, Roma Tre University, V.le Marconi 446, 00146 Rome, Italy (F. Polticelli). Department of Biosciences and Territory, University of Molise, C.da Fonte Lappone, 86090 Pesche (IS), Italy (G. Musci). E-mail addresses: [email protected] (F. Polticelli), [email protected] (G. Musci).

of a 12-cylinder ensemble [6]. The model displayed an inwardopen conformation and clustering of gain-of-function variants in a solvent accessible channel, with loss-of-function variants conversely located at the membrane/cytoplasm interface [3]. Later, an homology model of hFpn in the ‘‘occluded” state was built, based on another member of the MFS [4], which proved the role of Trp42 in both iron transport and hepcidin binding. Most recently, molecular models of hFpn in both inward-open and outward-open conformations were built using two Escherichia coli MFS proteins [5]. This study identified a potential iron binding site, centered around aspartates 39 and 181, whose relevance was experimentally confirmed through mutational studies and measurement of iron export ability of wild type and mutant proteins [5]. Important features of Fpn remain to be clarified. It is in fact still unknown how Fpn drives iron transport, i.e. whether it is a uniporter, an antiporter or a symporter. This is mainly due to the fact that the human protein appears to be refractory to crystallization, likely because of the long flexible surface loops which characterize it [3–5]. In this framework, we have carried out a search for hFpn homologues that display a simpler structure, to be used as model proteins to study the hFpn iron transport mechanism. This search led to the retrieval of a single putative bacterial homologue of hFpn, from the predatory Gram-negative bacterium Bdellovibrio bacteriovorus.

http://dx.doi.org/10.1016/j.febslet.2015.11.025 0014-5793/Ó 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

3830

M.C. Bonaccorsi di Patti et al. / FEBS Letters 589 (2015) 3829–3835

While our manuscript was under review, a paper appeared reporting the successful crystallization of the B. bacteriovorus Fpn homologue, and some properties related to its metal transport ability [7]. 2. Results and discussion 2.1. Molecular modelling of B. bacteriovorus Fpn (bdFpn) In order to find proteins with a general topology consistent with that of hFpn and with shorter surface loops, the amino acid sequence of hFpn (Accession number: NP_055400.1) was used as a bait in BLAST [8] searches restricted to invertebrates and bacteria. Conservation of key residues for iron binding and transport in hFpn [5], as well as of structural motifs characteristic of the MFS such as the so-called motif A [9], was used as a condition for positive identification of a bona fide hFpn homologue. This procedure led to retrieve a single bacterial protein from the predatory bacterium B. bacteriovorus (Accession number: WP_011164469.1 formerly NP_968874.1), providing support to the function of this previously annotated bacterial Fpn family member, which will be referred from now on as bdFpn. Fig. 1 shows the amino acid sequence alignment between hFpn and other representative Fpns and bdFpn. A phylogenetic tree derived from this alignment is reported in Fig. 1 inset. The bacterial Fpn is much shorter than the human counterpart (440 vs 571 amino acids), and the two proteins share approximately 24% sequence identity and 40% sequence similarity. These values indicate an overall poor sequence homology, however it should be reminded that there are many examples of protein pairs displaying even lower sequence similarity while retaining similar structure and the same function [10]. More important, the sequence alignment indicates that the residues previously shown to be involved in iron transport in the human protein [5] are all but one conserved in the bacterial counterpart: Asp24 (Asp39 in hFpn), Asp162 (Asp181 in hFpn), Arg348 (Arg466 in hFpn) (Fig. 1). The only difference is His261, which substitutes an aspartate (Asp325 in hFpn) in the orthologous position of other Fpns. The bacterial protein displays also the conservation of the motif A sequence signature GX3DX3R, formed by residues Gly 65 (Gly80 in hFpn), Asp69 (Asp84 in hFpn) and Arg73 (Arg88 in hFpn). As expected, residues required for hepcidin binding and hepcidin-dependent internalization are not conserved. Next, a structural model of bdFpn was built based on the threading/ab initio modelling approach implemented in I-TASSER [11]. The bdFpn model displays the typical bell-shaped form of transporters of the MFS superfamily in their inward-open conformation (Fig. 2). As predicted, the model appears to be more regular than those reported for hFpn with much shorter surface loops and no additional secondary structure elements other than the twelve transmembrane helices. 2.2. The bacterial Fpn is an iron exporter To verify whether bdFpn can export iron as a true ferroportin, measurements of intracellular iron content were carried out in E. coli expressing recombinant bdFpn. This technique has been widely employed to evaluate the functionality of human Fpn variants [3,5,12,13]. Therefore, we assumed that the assay could be used as a measure of the iron export ability of wild type and mutant bdFpns; in particular, 55FeCl3 was added to cells together with IPTG to induce bdFpn synthesis, cells were incubated at 37 °C for 1 and 2 h and residual 55Fe content in the cells was measured. As can be seen from Fig. 3A, cells expressing wild type bdFpn contain about half the amount of radioactive iron compared to cells

transformed with the empty vector. This result is suggestive that bdFpn can function as an iron exporter. Further evidence in support of this assumption stems from the finding that expression of the recombinant protein causes an iron deprivation phenotype in E. coli. As shown in Fig. 3B, sodA and entE, two genes well-known to be derepressed in conditions of iron-deficiency [14], are highly expressed after 1 h of IPTG induction of bdFpn compared to cells transformed with the empty vector. The model of bdFpn shows that residues orthologous to those essential for iron binding and transport in hFpn are correctly clustered in the cavity located approximately halfway between the intra- and extracellular extremities of the protein (Fig. 2). The amino acids predicted to be involved in iron binding/trafficking were substituted with alanine (D24A and D162A) or methionine (R348M) to remove the charge. The histidine residue at position 261 was instead replaced with aspartate (H261D), which is found in this position in the human protein, to check whether the two residues were interchangeable. Additionally, two other residues, namely Asp28 and Glu166, were replaced with alanine (D28A and E166A) because at variance with the sequence-based alignment, the model-based alignment suggested they might be better positioned to form the iron-binding site. Iron export measurements on the mutants (Fig. 3A) showed that replacement of Asp24 and Glu166 generated a protein with less efficient iron export (after 1 h of incubation, intracellular iron levels were very high, but they decreased in a fashion similar to the wild type protein after 2 h). Mutation of Asp28 or Asp162 was ineffective as the mutants retained wild type iron export capacity. Instead, substitution of His261 or Arg348 completely abolished the transport ability of bdFpn. Western blot analysis indicated that expression levels of recombinant wild type and mutant bdFpns were similar (Fig. 3C). The results confirm an important role in efficient iron transfer for two negatively-charged amino acids in the substrate binding site. On the other hand, they also corroborate the finding that an Arg residue, apparently unfit to bind iron (on the basis of both its chemical nature and spatial position), is nevertheless necessary for metal transport both in hFpn and bdFpn, possibly by locally favouring the inward-outward transition or by regulating the protonation state of the iron ligands (see below). As far as the H261D mutant is concerned, it is of note that, while the position of Asp325 in the human protein is taken up by a histidine in the bacterial homologue, the two amino acids do not appear to be interchangeable, suggesting that this position contributes to iron translocation through a mechanism more complex than simple electrostatic interactions, as proposed instead for hFpn [5]. An impaired iron transport can be due both to loss of iron binding or to other conformational constraints imposed by residue mutation. Therefore, a filter iron-binding assay was carried out. To this end, wild type and mutant bdFpns were purified. Yields of bdFpn were about 0.5 mg per liter of culture and purity was estimated to be 75–85% by densitometry analysis of the gel (Fig. 4A). Far UV CD spectra showed that wild type and mutant bdFpn were all folded with a predominantly a-helical secondary structure (Fig. 4B). Secondary structure predictions with DichroWeb [15] indicated an average content of 45–50% a-helix, 13–14% b-strand, 10% turn and 27–30% unordered structure. As shown in Fig. 4C, mutants D24A, D28A, D162V and E166A could bind iron equally well as wild type bdFpn; on the other hand, the inactive mutants H261D and R348M did not bind iron. Given the wellknown role that histidine plays in iron coordination chemistry, our results overall indicate that His261 is a likely candidate for iron binding, while Arg348 could act as a regulator. To probe the hypothesis that the pKa of His261 is modulated by Arg348, binding assays were run with R348M bdFpn at different pH values. The results, shown in Fig. 4D, indicate that mutant R348M bdFpn is less

M.C. Bonaccorsi di Patti et al. / FEBS Letters 589 (2015) 3829–3835

3831

Fig. 1. Amino acid sequence alignment between hFpn and other representative Fpns and bdFpn. The position of the transmembrane helices in the bdFpn model is indicated by the purple bars on top of the alignment. Alignment positions are coloured in blue shades according to BLOSUM62 score. Residues involved in iron binding and transport in hFpn [5] are highlighted by red stars. Green stars highlight the motif A characteristic sequence signature GX3DX3R, conserved in most of the MFS members. Residues involved in hepcidin binding are highlighted by blue stars. Accession numbers: hFpn, NP_055400.1; bdFpn WP_011164469.1; Bos taurus NP_001071438.1; Rattus norvegicus NP_579849.2; Mus musculus AAF36696.1; Anas platyrhynchos EOB07270.1; Gallus gallus NP_001012931.1; Chelonia mydas EMP26252.1; Danio rerio AAF36695.1; Tetraodon nigroviridis CAG12022.1; Branchiostoma floridae EEN64838.1; Caenorhabditis elegans CCD68880.1; Ciona intestinalis XP_002131310.1. Inset: phylogenetic tree of selected eukaryotic Fpns and bdFpn. The evolutionary history was inferred using the Neighbor-Joining method [23]. The percentage of replicate trees in which the associated proteins clustered together in the bootstrap test (1000 replicates) are shown next to the branches [24]. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the number of differences method [25] and are in the units of the number of amino acid differences per sequence. Evolutionary analyses were conducted in MEGA6 [26].

3832

M.C. Bonaccorsi di Patti et al. / FEBS Letters 589 (2015) 3829–3835

Fig. 2. Schematic representation of the structural models of human Fpn (left panel) and bacterial Fpn (right panel). Residues essential for iron binding and transport (Asp39, Asp181, Asp325, Arg466 in hFpn; Asp24, Asp162, His261, Arg348 in bdFpn) are highlighted with colors corresponding to the orthologous positions. Also shown in bdFpn is Glu166 (light red, see text for details). The figure has been generated with Chimera [27].

Fig. 3. Iron export by bdFpn wild type and mutants. (A) Iron accumulation assay. Empty vector (pET) samples taken as 100% values generally achieved ca. 35– 40 000 cpm. Data shown represent the mean ± S.E. of at least three independent experiments for each mutant. (B) RT-PCR analysis of expression of sodA and entE in cells transfected with empty vector or wild type bdFpn induced for 1 h with IPTG. The glyceraldheyde-3P dehydrogenase gene gapA was chosen as a reference gene. (C) Western blot analysis of recombinant bdFpn expression at 1 and 2 h after IPTG induction. A representative Western blot is shown.

active than wild type in iron binding at acidic and neutral pH but more active at pH 8, suggesting that Arg348 could exert a regulatory role on the protonation state of His261. The involvement of a histidine in iron binding and transport, and the pH-dependence

of iron handling opens up the possibility that ferroportins work by coupling proton translocation to iron export. While our data do not exclude this hypothesis, the recent crystallographic data [7] suggest that bdFpn acts as a simple uniporter. The specificity of bdFpn for iron was tested through measurement of iron binding in the presence of other metals. In line with the crystallographic data [7], we found that Ni2+ and Co2+, but not Cu2+, significantly competed with iron for binding. In particular, Ni2+ fully competed with iron, while Co2+ was a partial (ca. 50%) competitor and Cu2+ was totally ineffective. This suggests that in vivo bdFpn may act as a multivalent divalent metal transporter. In mutants D24A and E166A, removal of the acidic residue slows down the kinetics of iron transport, while not grossly affecting the iron binding ability. However, subtle changes of the KD for iron cannot be ruled out due to the sensitivity limits of the filter binding assay. It is worth noting that mutation D24A has been recently shown to reduce the KD of bdFpn for Co2+ [7]. It is also interesting to note that while Asp24 is orthologous to Asp39 of hFpn, Glu166 corresponds to Asn185 in the sequence-based alignment and that mutation N185D in hFpn has been reported to cause defective iron transport [16]. The molecular coordinates of the crystallographic structure of bdFpn, which appeared while our manuscript was in the review process [7], are not available to date, however our model seems to satisfactorily match the crystal structure. In that paper, the role of Asp24 as the orthologue of Asp39 in the human protein [5] is confirmed, consistent with the data we present here. No evidence is instead presented on the involvement of His261 and Arg348, which we show here to play a fundamental role in iron binding and translocation. Little can be said on the physiological role of bdFpn. B. bacteriovorus stands out as a peculiar bacterial species, as it lives by preying other larger Gram-negative bacteria. In doing so, it invades the periplasm of the prey where it divides before lysing the host and releasing a progeny [17]. Most of the molecular details related to how attachment to and entry into prey is mediated and how the outer membrane of the prey is traversed are currently missing. More important, very little is known to date on the possibility that, once inside the periplasm, B. bacteriovorus exports its proteins on the prey plasma membrane. A single report suggested that B. bacteriovorus translocates a specific protein to gain access to the cytoplasmic contents of the prey during the intraperiplasmic

M.C. Bonaccorsi di Patti et al. / FEBS Letters 589 (2015) 3829–3835

3833

Fig. 4. Iron binding by bdFpn. SDS–PAGE analysis (A), far UV CD spectra (B) and iron binding assay (C and D) of purified bdFpn wild type and mutants. Data in panels C and D are mean values from at least two independent experiments run in duplicate.

3. Materials and methods

between the bdFpn model and the best template (YajR structure) was also evaluated calculating the TM-score [21]. This is a parameter which is less sensitive than RMSD to local structural deviations and, as such, is a more reliable measure of the global structural similarity between two protein structures [21]. The TM-score calculated for bdFpn model is 0.9 and taking into account that TM-score values in the range 0.5–1.0 indicate that the pair of proteins display the same fold [21], the assignment of bdFpn to the MFS is highly reliable.

3.1. Molecular modeling

3.2. Constructs

The structural model of bdFpn has been built using the ab initio molecular modeling package I-TASSER which has been shown to yield reliable models in the absence of evolutionary information in a number of different studies [11]. I-TASSER first identifies template proteins which are predicted to display a fold similar to that of the protein of interest using several threading approaches implemented in LOMETS. Replica-exchange Monte Carlo simulations are then used to assemble structure fragments excised from the templates. Finally, the models obtained are refined iteratively to optimize their free energy and global topology [19]. The best templates identified by I-TASSER were two E. coli transporters belonging to the MFS, the drug efflux transporter YajR and the glycerol-3-phosphate transporter GlpT (PDB codes 3WDO and 1PW4, respectively). The crystal structures of these two templates correspond to the inward-open conformation of the transporters and thus the bdFpn model represents an inward open conformation of the protein as well. The quality of the bdFpn final model was checked using PROCHECK [20]. This analysis revealed that 97.1% of the residues are in the most favored and allowed regions of the Ramachandran plot. The overall PROCHECK G-factor is 0.4, well above the 0.5 threshold for good structural models [20]. The structural similarity

Genomic DNA from B. bacteriovorus strain HD100 was from DSM (Germany), the coding sequence of bdFpn was retrieved by PCR and cloned in pCMVTag4b (Agilent) to produce a Cterminally FLAG-tagged protein. FLAG-tagged bdFpn was then amplified by PCR and cloned NcoI/SalI in pET28a (Novagen). Sitedirected mutagenesis was performed with the QuikChange II XL kit (Agilent) or by overlap-extension PCR. Sequences of oligonucleotides used can be obtained upon request. All constructs were sequence-verified by automated DNA sequencing at Ylichron (Italy) or GATC Biotech (Germany).

growth phase [18]. Therefore, while we can easily postulate that the presence of a ferroportin has to do with the preying lifestyle of this bacterium, we cannot speculate on whether bdFpn serves to control iron levels inside Bdellovibrio, or rather it is somehow used to draw iron out of the prey. We can only conclude that the presence of bdFpn suggests a unique case of a prokaryotic iron exporter.

3.3. Expression and purification of recombinant bdFpn Recombinant bdFpn was expressed in E. coli BL21(DE3). Cells were grown to OD600 0.3–0.6 and induced with 0.2 mM IPTG for 4 h at 37 °C. Lysis of cells was performed by sonication in 25 mM MOPS/150 mM NaCl pH 7.4 supplemented with protease inhibitors, DNase and RNase. The lysate was centrifuged at 4000 rpm 10 min to remove debris and unbroken cells; the supernatant was centrifuged at 35 000 rpm 50 min to obtain a membrane pellet. Membrane proteins were extracted in 25 mM MOPS/150 mM NaCl pH 7.4 containing 1% Triton X-100 on ice for 1 h. Following

3834

M.C. Bonaccorsi di Patti et al. / FEBS Letters 589 (2015) 3829–3835

centrifugation at 35 000 rpm 30 min, the supernatant was diluted 5-fold and applied to a DEAE-Sepharose column equilibrated in 25 mM MOPS/30 mM NaCl pH 7 containing 0.01% DDM. After washing to OD280 < 0.05, bdFpn was eluted with 5 column volumes of 25 mM MOPS/500 mM NaCl pH 7 with 0.01% DDM. This fraction was applied (twice) to anti-FLAG M2 agarose (Sigma) in 25 mM MOPS/150 mM NaCl pH 7 with 0.01% DDM, the resin was washed with 10–15 bed volumes of the same buffer and bound protein was eluted in 0.1 M glycine pH 3.5 containing 0.05% DDM. Purified bdFpn was concentrated and buffer exchanged to raise the pH when required using Vivaspin 20 devices. 3.4. Spectroscopic analyses Far UV circular dichroism (CD) spectra were obtained using a Jasco J-815 spectropolarimeter; protein samples were diluted in 10 mM potassium phosphate buffer pH 7, containing 50 mM Na2SO4 and 0.01% DDM and the spectra were recorded in 0.1 cm quartz cuvettes. All CD spectra are the average of 4 scans with the spectrum for buffer alone subtracted. 3.5. Western blot For Western blot analysis, cells lysates were prepared with the same procedure described for purification of bdFpn except that cells were lysed with lysozyme and centrifugation steps were performed at 13 000 rpm. Equivalent amounts of total protein were loaded on SDS–PAGE in the presence of DTT but without heat treatment. Detection of bdFpn was performed with polyclonal anti-FLAG (Sigma, 1:10 000 dilution) and amino-ethyl-carbazole (Sigma). 3.6. Iron export assay 25-ml cultures of E. coli cells expressing bdFpn were grown to OD600 0.3–0.6, 0.2 mM IPTG was added and the culture was split into two 12-ml aliquots to which either FeCl3 or 55FeCl3 (Perkin Elmer) was added at 0.4 lM final concentration. Cells were incubated at 37 °C and after 1 h and 2 h a 5-ml aliquot was collected. Cells grown in the presence of FeCl3 were lysed and used for Western blot analysis and total protein content determination with the Bradford assay. Cells grown in the presence of 55FeCl3 were filtered on Whatman GF/C glass fiber filters, washed with cold MOPS/NaCl buffer (5 ml  2) and filters were counted in 5 ml liquid scintillation cocktail (Ultima Gold, Perkin Elmer) with a LSC6000 Beckman b-counter. Radioactivity was normalized on total protein content. 3.7. Filter binding assay Purified bdFpn (5 lM) was incubated with 10 lM 55FeCl3 (Perkin Elmer) in the presence of 1 mM ascorbate in 25 mM MOPS/150 mM NaCl pH 7, containing DDM 0.01% at room temperature for 2 min. The solution (25 ll) was spotted onto nitrocellulose and washed with cold MOPS/NaCl/DDM buffer (0.5 ml  3) by vacuum filtration, the filter was dried and counted in 10 ml liquid scintillation cocktail Ultima Gold (Perkin Elmer). A bufferonly blank was subtracted from the cpm values obtained for the protein samples. For pH dependence studies the buffers used were: 25 mM sodium acetate/150 mM NaCl pH 5, DDM 0.01%; 25 mM potassium phosphate/150 mM NaCl pH 6, DDM 0.01%; 25 mM Tris–HCl/150 mM NaCl pH 8, DDM 0.01%. 3.8. RT-PCR assays Total RNA was prepared from E. coli by the hot phenol method [22]. RT-PCR was performed with the SV RT-PCR Access System

(Promega) with the following oligos: gapA_for: GTTGTCGCTGAAGCAACTGG; gapA_rev: AGACGAACGGTCAGGTCAAC; sodA_for: CCGTATGCTTACGATGCCCT; sodA_rev: CAGTAGAAACCACCGCCAGT; entE_for: GGAAGTTGGACGCCTGATGA; entE_rev: CTGTTCACGCAGGAAACGAC. Acknowledgements This work has been supported by Roma Tre University (CAL2015 to FP) and by Vifor Pharma funding to GM. References [1] Ward, D.M. and Kaplan, J. (2012) Ferroportin-mediated iron transport: expression and regulation. Biochim. Biophys. Acta 1823, 1426–1433. [2] Nemeth, E., Tuttle, M.S., Powelson, J., Vaughn, M.B., Donovan, A., Ward, D.M., Ganz, T. and Kaplan, J. (2004) Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 306, 2090–2093. [3] Wallace, D.F., Harris, J.M. and Subramaniam, V.N. (2010) Functional analysis and theoretical modeling of ferroportin reveals clustering of mutations according to phenotype. Am. J. Physiol. Cell Physiol. 298, C75–C84. [4] Le Gac, G., Ka, C., Joubrel, R., Gourlaouen, I., Lehn, P., Mornon, J.P., Ferec, C. and Callebaut, I. (2013) Structure-function analysis of the human ferroportin iron exporter (SLC40A1): effect of hemochromatosis type 4 mutations and identification of critical residues. Hum. Mutat. 34, 1371–1380. [5] Bonaccorsi di Patti, M.C., Polticelli, F., Cece, G., Cutone, A., Felici, F., Persichini, T. and Musci, G. (2014) A structural model of human ferroportin and of its iron binding site. FEBS J. 281, 2851–2860. [6] Shi, Y. (2013) Common folds and transport mechanisms of secondary active transporters. Annu. Rev. Biophys. 42, 51–72. [7] Taniguchi, R., Kato, H.E., Font, J., Deshpande, C.N., Wada, M., Ito, K., Ishitani, R., Jormakka, M. and Nureki, O. (2015) Outward- and inward-facing structures of a putative bacterial transition-metal transporter with homology to ferroportin. Nat. Commun. 6, 8545. [8] Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. [9] Jiang, D., Zhao, Y., Wang, X., Fan, J., Heng, J., Liu, X., Feng, W., Kang, X., Huang, B., Liu, J. and Zhang, X.C. (2013) Structure of the YajR transporter suggests a transport mechanism based on the conserved motif A. Proc. Natl. Acad. Sci. U.S. A. 110, 14664–14669. [10] Gan, H.H., Perlow, R.A., Roy, S., Ko, J., Wu, M., Huang, J., Yan, S., Nicoletta, A., Vafai, J., Sun, D., Wang, L., Noah, J.E., Pasquali, S. and Schlick, T. (2002) Analysis of protein sequence/structure similarity relationships. Biophys. J. 83, 2781– 2791. [11] Xu, D., Zhang, J., Roy, A. and Zhang, Y. (2011) Automated protein structure modeling in CASP9 by I-TASSER pipeline combined with QUARK-based ab initio folding and FG-MD-based structure refinement. Proteins 79, 147– 160. [12] Schimanski, L.M., Drakesmith, H., Merryweather-Clarke, A.T., Viprakasit, V., Edwards, J.P., Sweetland, E., Bastin, J.M., Cowley, D., Chinthammitr, Y., Robson, K.J.H. and Townsend, A.R.M. (2005) In vitro functional analysis of human ferroportin (FPN) and hemochromatosis-associated FPN mutations. Blood 105, 4096–4102. [13] Girelli, D., De Domenico, I., Bozzini, C., Campostrini, N., Busti, F., Castagna, A., Soriani, N., Cremonesi, L., Ferrari, M., Colombari, R., McVey Ward, D., Kaplan, J. and Corrocher, R. (2008) Clinical, pathological, and molecular correlates in ferroportin disease: a study of two novel mutations. J. Hepatol. 49, 664–671. [14] Andrews, S.C., Robinson, A.K. and Rodriguez-Quinones, F. (2003) Bacterial iron homeostasis. FEMS Microbiol. Rev. 27, 215–237. [15] Whitmore, L. and Wallace, B.A. (2008) Protein secondary structure analyses from circular dichroism spectroscopy: methods and reference databases. Biopolymers 89, 392–400. [16] Detivaud, L., Island, M.L., Jouanolle, A.M., Ropert, M., Bardou-Jaquet, E., Le Lan, C., Mosser, A., Leroyer, P., Deugnier, Y., David, V., Brissot, P. and Loreal, O. (2013) Ferroportin diseases: functional studies, a link between genetic and clinical phenotype. Hum. Mutat. 34, 1529–1536. [17] Sockett, R.E. (2009) Predatory lifestyle of Bdellovibrio bacteriovorus. Annu. Rev. Microbiol. 63, 523–539. [18] Tudor, J.J. and Karp, M.A. (1994) Translocation of an outer membrane protein into prey cytoplasmic membranes by bdellovibrios. J. Bacteriol. 176, 948–952. [19] Roy, A., Kucukural, A. and Zhang, Y. (2010) I-TASSER: a unified platform for automated protein structure and function prediction. Nat. Protoc. 5, 725–738. [20] Laskowski, R., MacArthur, M., Moss, D. and Thornton, J. (1993) PROCHECK—a program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 26, 283–291. [21] Zhang, Y. and Skolnick, J. (2005) TM-align: a protein structure alignment algorithm based on the TM-score. Nucleic Acids Res. 33, 2302–2309. [22] Aiba, H., Adhya, S. and de Crombrugghe, B. (1981) Evidence for two functional gal promoters in intact Escherichia coli cells. J. Biol. Chem. 256, 11905–11910.

M.C. Bonaccorsi di Patti et al. / FEBS Letters 589 (2015) 3829–3835 [23] Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. [24] Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. [25] Nei, M. and Kumar, S. (2000) Molecular Evolution and Phylogenetics, Oxford University Press, New York.

3835

[26] Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. [27] Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C. and Ferrin, T.E. (2004) UCSF Chimera – a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612.