A Bacterially Produced Virus Enhancing Factor from an Entomopoxvirus Enhances Nucleopolyhedrovirus Infection in Armyworm Larvae

Journal of Invertebrate Pathology 78, 25–30 (2001) doi:10.1006/jipa.2001.5036, available online at http://www.idealibrary.com on

A Bacterially Produced Virus Enhancing Factor from an Entomopoxvirus Enhances Nucleopolyhedrovirus Infection in Armyworm Larvae Tosihiko Hukuhara,* Takahiko Hayakawa,† and Arman Wijonarko* *College of Bioresource Sciences, Nihon University, Kameino, Fujisawa 252-8510, Japan; and †Plantech Research Institute, Kamoshida, Aoba-ku, Yokohama 227-0033, Japan E-mail: [email protected] Received November 22, 2000; accepted May 18, 2001; published online July 12, 2001

determined by SDS–PAGE (Xu and Hukuhara, 1992). A possible application of the EF will be in the area of insect pest control by NPVs. One of the demerits of viral insecticides is the high production cost stemming from currently used techniques of propagating the virus in insect larvae. This problem may be addressed by the use of the EF as a synergist, thereby potentially reducing the amount of NPV needed for successful application to crops. Inasmuch as the mass production of the EF in insect larvae suffers from the same problem of high cost, it is desirable to produce the EF in heterologous organisms that are amenable to the mass production of a protein of interest. Foreign proteins are often expressed in Escherichia coli as fusion proteins. This in-frame fusion with a bacterial protein protects the recombinant protein from degradation by bacterial proteases (Bond et al., 1991). The pGEX vectors permit expression of the cloned DNA fused to the glutathione S-transferase (GST) gene under the control of the tac promoter, which is inducible by the addition of the lactose analog, isopropyl-␤-D-thiogalactoside (IPTG), to the culture medium (Smith and Johnson, 1988). Some of the vectors also encode a cleavage site for a sequence-specific protease such as thrombin (Guan and Dixon, 1991). This allows the enzymatic release of a protein of interest from the fusion protein. The fusolin of Heliothis armigera EPV has been expressed in E. coli as a fusion protein by the use of a pGEX vector (Dall et al., 1993). We herein report the successful expression of the EF in E. coli by the use of a pGEX vector. The expressed EF enhanced NPV infection and cell–virus fusion. This result reinforces the conclusion that the EF alone, and not some contaminant in the PSEV preparation, is responsible for the enhancement of NPV infection. Moreover, this result should facilitate the use of the EF as a synergistic additive to viral insecticides.

Using an Escherichia coli expression system, pGEX2T, that expresses foreign sequences as fusion proteins with a glutathione S-transferase (GST) carrier, we have expressed a virus enhancing factor (EF) from Pseudaletia separata entomopoxvirus, which enhances P. unipuncta multi nucleopolyhedrovirus (PsunMNPV) infection in larvae of the armyworm, P. separata. The lysates of transformed E. coli cells, which were not active in enhancing PsunMNPV infection, became active when treated with either trypsin or thrombin. The GST–EF fusion protein in a lysate was purified with a bulk GST purification module and cleaved into the EF and GST moieties with thrombin. Removal of the GST moiety with glutathione–Sepharose 4B resulted in a highly purified EF preparation, which enhanced PsunMNPV infection in armyworm larvae and PsunMNPV fusion with an armyworm cell line, SIE-MSH-805-F. © 2001 Academic Press

INTRODUCTION

Xu and Hukuhara (1992, 1994) reported the isolation of a virus-enhancing factor (EF) that enhances nucleopolyhedrovirus (NPV) infection in the armyworm, Pseudaletia separata, from the spheroid of P. separata entomopoxvirus (PSEV). Further studies on the EF revealed the following information. The EF is present in the spindle and the virion, either nonoccluded or occluded within the spheroid (Hukuhara et al., 1995; Wijonarko and Hukuhara, 1998), and presumably identical with the fusolin, a protein constituting the spindle (Hayakawa et al., 1996). The sequence analysis of the EF gene predicts a 2.4-kDa signal peptide consisting of 20 amino acids and a 37.9-kDa truncated mature form (TMF) of the EF (Hayakawa et al., 1996). The latter value corresponds well to the molecular mass of the EF as 25

0022-2011/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

26

HUKUHARA, HAYAKAWA, AND WIJONARKO MATERIALS AND METHODS

Construction of EF expression vectors. The following three primers, which have BamHI or SmaI restriction enzyme site (underlined), were designed for polymerase chain reaction (PCR): (1) 5⬘ ⬎ AAGGGATCCATGAATAAATTTTATTATATA ⬍ 3⬘ (forward), (2) 5⬘ ⬎ ATCCCGGGGTATTATTTTTGGTATAGTTCG ⬍ 3⬘ (reverse), and (3) 5⬘ ⬎ AAGGGATCCCATGGATATATGACATTTC ⬎ 3⬘ (forward). The first and second primers were used to amplify PsEPV DNA fragments containing both the signaland the TMF-coding regions of the EF gene, and the second and third primers were used to amplify DNA fragments containing only the latter region. PCR conditions were as follows: 95°C for 30 s, 52°C for 30 s, 72°C for 1 min for 25 cycles. The obtained fragments were introduced into the BamHI and SmaI sites of the pGEX-2T vector (Amersham-Pharmacia Biotech, Cleveland, OH). The resultant vectors were used to transform the DH5␣ strain of E. coli as described by Hanahan (1985). Transformants were selected with 50 ␮g/ml ampicillin. Expression of the GST–EF fusion proteins. Another E. coli strain, BL2, was used for the production of the GST–EF fusion protein because it was more suited to the IPTG induction of the tac promotor than the DH5␣ strain. The EF expression vectors that had been maintained in the latter strain were introduced into BL21 cells via electroporation with the use of ECM 600 (BTX Inc., San Diego, CA), as described in the manufacturer’s manual. The parental pGEX vector not containing the EF gene was also used for transformation as a control. Transformed BL21 cells were cultured in 200 ml of 2⫻ YT medium containing 2% glucose and induced for the production of the fusion protein by the addition of IPTG (Amersham-Pharmacia Biotech) to the final concentration of 0.1 mM, as described in the manufacturer’s manual. After incubation for more than 6 h, the cells were harvested by centrifugation, suspended in distilled water, and lysed by mild sonication and 30-min incubation in 1% sodium dodecyl sulfate on ice. The bacterial lysate was cleared of cell debris and insoluble material by centrifugation at 12,000g for 10 min. Enzyme treatment of bacterial lysate. Two milliliters of a bacterial lysate was combined with either an equal volume of Rinialdi solution containing 0.2% trypsin (1300 BAAE units/mg; Sigma, St. Louis, MO) or 0.5 ml buffer (50 mM Tris, 150 mM NaCl, 2.5 mM CaCl 2, 0.1% ␤-mercaptoethanol, pH 8.0) containing 1% (w/w) thrombin (2500 NIH units/mg; Sigma). Trypsin action was stopped after 3 min incubation at 25°C by the addition of twice the volume of 0.01 M Tris buffer (pH 7). Thrombin action was stopped after overnight incu-

bation at 35°C by the addition of 0.01 M phenylmethylsulfonyl fluoride. Purification of expressed GST–EF fusion proteins. The fusion protein was purified from the bacterial lysates with a bulk GST purification module (AmershamPharmacia Biotech), as described in the manufacturer’s manual. The supernatant from 2 ml bacterial lysate was combined with 40 ␮l of a slurry (50% v/v) of glutathione–Sepharose 4B beads. The complex of the bead and the fusion protein was washed three times by low-speed centrifugation in phosphate-buffered saline (PBS) and suspended in 100 ␮l of PBS. Then, the suspension was combined with 10 ␮l of glutathione– elution buffer containing reduced glutathione, which replaced the bead in the complex by competition. After the released bead was sedimented by low-speed centrifugation, the supernatant was treated with thrombin as described in the above section and combined with 40 ml of glutathione–Sepharose beads (50% v/v). The resultant GST– glutahione–Sepharose 4B complex was removed by centrifugation (10 min at 5000g). The purified EF in the supernatant was cleared of glutathione by dialysis against 50 mM Tris buffer and kept at ⫺30°C until used. SDS–polyacrylamide gel electrophoresis and immunoblotting. The proteins from the bacterial lysates at different steps of purification were analyzed by SDS– PAGE as described by Hayakawa et al. (1992). Gels were stained with Coomassie brilliant blue R. Proteins separated by SDS–PAGE were processed for immunoblotting with an anti-EF rabbit antibody linked to alkaline phosphatase as described previously (Hukuhara et al., 1999). The amount of the expressed fusion protein was estimated from the relative density of their bands as compared with that of the known amount of the standard protein, PSEV fusolin. Bioassay in armyworm larvae and cultured cells. The NPV occlusion bodies, or polyhedra, of the typical strain of P. unipuncta multi NPV (PsunMNPV) were purified from infected larvae of the armyworm, P. separata. After serial 10-fold dilutions of the polyhedron suspension with distilled water, four graded doses of polyhedra were combined with the same volume of a bacterial lysate or a purified EF preparation. A piece of artificial diet (about 110 mg) was placed in a plastic rearing vial and covered with 100 ␮l of virus suspension. Fifth-instar P. separata larvae were individually transferred to the vial and allowed to feed on the viruscontaminated diet for 48 h. Those larvae that consumed the diet during the period were retained for further observation and administered fresh virus-free diet. Eighty larvae were used for one virus dilution series, that is, 20 larvae for each of the four graded doses of polyhedra. The test larvae were maintained at 25°C throughout the experiments. They were diag-

BACTERIALLY PRODUCED NPV ENHANCING FACTOR FROM EPV

27

the absence or presence of the signal region of the EF gene in the vector, and corresponded well to the sum of the M rs of the component proteins, with 26, 38, and 2 kDa contributions by GST, the TMF, and the signal peptide of the EF, respectively. The results indicated that the new protein bands were derived from the EF gene inserts which were in-frame with the GST gene. Purification of the Fusion Protein

FIG. 1. SDS–PAGE (lanes 1– 4) and immunoblotting (lanes 5– 8) patterns of soluble proteins produced by transformed E. coli cells. Two types of GST vectors were used: one contained both the TMFand the signal-coding regions of the EF gene (lanes 1 and 2 and 5 and 6) and the other contained only the TMF-coding region (lanes 3 and 4 and 7 and 8). The transformed bacteria were cultured in the presence (⫹) or absence (⫺) of IPTG. The positions of fusion protein bands are denoted with asterisks. The numerals on the left side represent molecular masses (kDa).

nosed microscopically preferably shortly before death for those showing distinct signs of virus infection and during the late last instar or at the prepupal stage. The median infectious doses, ID 50 and their standard errors (SEs) were calculated according to Berkson (1955). The difference between two log ID 50s was considered nonsignificant if there was overlap between their 95% fiducial limits that had been calculated from the SE. Fluorescence dequenching assays of membrane fusion were performed with cultured cells as described by Hukuhara and Wijonarko (2001). Purified EF preparations were added to suspensions of cultured cells (5 ⫻ 10 5/ml) of an armyworm cell line, SIE-MSH-805-F (MSH) (Hukuhara et al., 1990). After 30 min incubation at 25°C, polyhedron-derived virus of PsunMNPV, which had been labeled with octadecylrhodamine B chloride (R 18), was added to the cell culture at the final concentration of 2 ␮g/ml. The increase in fluorescence intensity was monitored with the use of a spectrophotofluorometer (Type FP-920; Nihon Bunko, Tokyo).

A bacterial lysate containing the 66-kDa fusion protein was combined with glutathione–Sepharose 4B. Binding, wash, and elution with reduced glutathione resulted in the purification of the fusion protein. SDS– PAGE of the purified sample yielded 66- and 26-kDa bands presumed to be the fusion protein and GST, respectively (Fig. 2, lane 2). The fusion protein was cleaved with thrombin, which recognized a cleavage sequence inserted between the GST and the EF. Replacement of the glutathione in the resulting GST– glutathione complex with glutathione–Sepharose 4B and subsequent removal of the complex by centrifugation yielded a single band of 38 kDa in SDS–PAGE analysis (Fig. 2, lane 3). In immunoblot analysis, however, a faint 66-kDa band was also detected (Fig. 2, lane 6). The results indicated that a highly purified preparation of the EF was obtained from the bacterial lysate, although a small proportion of the fusion protein remained uncleaved. Enhancement of NPV Infection by Bacterial Lysates and Purified EF In the first set of experiments, a lysate of E. coli cells that had been transformed with a pGEX expres-

RESULTS

Expression of GST–EF Fusion Proteins When pGEX vectors containing the EF gene fragments were introduced into exponentially growing cells of E. coli (BL2 strain), the transformants produced putative fusion proteins upon induction by IPTG as detected by SDS–PAGE and immunoblotting analyses (Fig. 1). The amount of the new proteins was estimated to constitute 3–5% of the total soluble proteins. The M r of the proteins was either 64 or 66 kDa, depending on

FIG. 2. SDS–PAGE (lanes 1– 4) and immunoblotting (lanes 5 and 6) patterns of soluble proteins from transformed E. coli cells at different steps of purification. The positions of the bands of the fusion protein (FP), EF, and GST are indicated by arrows. Lane 1, the bacterial lysate; lane 2, the supernatant obtained after elution with reduced glutathione; lane 3, the supernatant obtained after thrombin cleavage and the removal of the GST– glutathione–Sepharose 4B complex; lane 4, the lysate of E. coli cells that had been transformed with the parental pGEX vector; lane 5, the bacterial lysate; lane 6, the supernatant obtained after thrombin cleavage and the removal of the GST– glutathione–Sepharose 4B complex. The numerals on the left side represent molecular masses (kDa).

28

HUKUHARA, HAYAKAWA, AND WIJONARKO

TABLE 1 Comparison of the Median Infectious Dose of PsunMNPV in the Presence and in the Absence of a Trypsin-Treated Lysate from E. coli Transformants a Dose of the lysate (␮g/larva)

Type of vector used for transformation

Enzyme treatment b

Slope (b) and SE

576 576 667 0

EF expression EF expression Parental —

— Trypsin Trypsin —

0.45 ⫾ 0.15 0.64 ⫾ 0.16 0.39 ⫾ 0.21 0.57 ⫾ 0.15

ID 50 of NPV (polyhedra/larva) 4.30 ⫻ 10 3 1.86 ⫻ 10 2 5.05 ⫻ 10 3 7.86 ⫻ 10 3

Log 10 ID 50 and SE

95% Fiducial limit

Enhancement index log 10

3.63 ⫾ 0.43 2.27 ⫾ 0.22 3.70 ⫾ 0.25 3.89 ⫾ 0.29

2.77–4.49 1.83–2.71 3.20–4.20 3.31–4.47

0.26 1.71 0.19 —

a For bacterial transformation, an EF expression vector containing both the signal- and the TMP-coding regions of the EF gene was used. The parental pGEX vector served as control. b Bacterial lysates were either nontreated (—) or trypsin treated.

sion vector containing both the signal- and the TMPcoding regions of the EF gene was bioassayed in armyworm larvae. The enhancing activity of the lysate was assessed by comparison of the ID 50 of a NPV dilution series combined with a constant dose of the lysate and the ID 50 of the same NPV dilution series combined with distilled water. The ratio between the two ID 50 s was converted to a log 10 value and referred to as the enhancement index log 10 . The results of the bioassay showed that the ID 50 was not significantly affected when the lysate containing the GST–EF protein was added to the virus inocula (Tables 1 and 2). However, the ID 50 was significantly reduced when the lysate was treated with trypsin or thrombin prior to the addition to the virus inocula. The enhancement index log 10 of the trypsin-treated lysate was 1.71, and that of the thrombin-treated lysate was 1.92. The ID 50 was not significantly affected by the addition of enzyme-treated lysates of E. coli cells that had been transformed with the parental vector not containing the EF gene fragment. When trypsinand thrombin-treated lysates were compared in the same bioassay experiment (Table 3), the ID 50 s were not significantly different from each other, although both of them were significantly smaller than the ID 50 obtained in the control where distilled water was added to the virus inocula. Their enhancement indi-

ces log 10 were 2.05–2.43, which indicated that the ID 50 s were reduced 110 –270 times with the addition of enzyme-treated lysates. The results indicated that the GST–EF fusion protein in the lysate was inactive in its intact state but became active in enhancing NPV infection when treated with proteolytic enzymes. In the second set of experiments, a lysate of E. coli cells that had been transformed with a vector containing only the TMP-coding region was bioassayed. The intact lysate was inactive but became active after proteolysis with trypsin. The ID 50s were 8.74 ⫻ 10 2 polyhedra/larva when the treated lysate was present in the virus inocula and 5.57 ⫻ 10 4 polyhedra/larva without the treated lysate (enhancement index log 10, 1.80). The results indicated that the presence of the signal-coding region of the EF gene in the vector was not prerequisite for the enhancing activity of enzyme-treated lysates of transformed E. coli cells. In the third set of experiments, the EF was purified from a lysate containing the GST–EF fusion protein and bioassayed (Table 4). It reduced the ID 50 by 40 times (enhancement index log 10 , 1.60) when added to the virus inocula. The results indicated that the purified EF was active in enhancing NPV infection.

TABLE 2 Comparison of the Median Infectious Dose of PsunMNPV in the Presense and in the Absence of a Thrombin-Treated Lysate from E. coli Transformants a Dose of the lysate (␮g/larva)

Type of vector used for transformation

Enzyme treatment b

Slope (b) and SE

ID 50 of NPV (polyhedra/larva)

Log 10 ID 50 and SE

95% Fiducial limit

Enhancement index log 10

576 576 667 0

EF expression EF expression Parental —

— Thrombin Thrombin —

0.38 ⫾ 0.14 0.53 ⫾ 0.15 0.31 ⫾ 0.13 0.61 ⫾ 0.16

3.23 ⫻ 10 3 6.10 ⫻ 10 1 6.72 ⫻ 10 3 5.20 ⫻ 10 3

3.51 ⫾ 0.49 1.79 ⫾ 0.32 3.83 ⫾ 0.51 3.71 ⫾ 0.25

2.53–4.49 1.12–2.43 2.81–4.85 3.21–4.21

0.20 1.92 ⫺0.08 —

a For bacterial transformation, an EF expression vector containing both the signal- and the TMP-coding regions of the EF gene was used. The parental pGEX vector served as control. b Bacterial lysates were either nontreated (—) or thrombin treated.

29

BACTERIALLY PRODUCED NPV ENHANCING FACTOR FROM EPV

TABLE 3 Comparison of the Median Infectious Dose of PsunMNPV in the Presence and in the Absence of an Enzyme-Treated Lysate from E. coli Transformants a Dose of the lysate (␮g/larva)

Type of vector used for transformation

Enzyme treatment

Slope (b) and SE

ID 50 of NPV (polyhedra/larva)

Log 10 ID 50 and SE

95% Fiducial limit

Enhancement index log 10

576 576 0

EF expression EF expression —

Trypsin Thrombin —

0.38 ⫾ 0.14 0.49 ⫾ 0.15 0.57 ⫾ 0.16

3.09 ⫻ 10 1 1.27 ⫻ 10 1 3.44 ⫻ 10 3

1.49 ⫾ 0.25 1.10 ⫾ 0.47 3.54 ⫾ 0.33

0.99–1.99 0.17–2.04 2.88–4.20

2.05 2.43 —

a

For bacterial transformation, an EF expression vector containing both the signal- and the TMP-coding regions of the EF gene was used.

Effect of the Purified EF on Cell–Virus Fusion Cultured cells of an armyworm cell line, SIE-MSH805-F, were incubated with the EF that had been purified from the fusion protein and 30 min later combined with polyhedron-derived virus of armyworm NPV that had been labeled with octadecylrhodamine B chloride (R 18). The fluorescence intensities started to increase immediately after the virus addition (Fig. 3). The rate of increase was greater in the presence of the EF than in its absence. Similar results were obtained with trypsin- or thrombin-treated extracts (data not shown). The results indicated that the EF expressed in E. coli enhanced cell–virus fusion. DISCUSSION

We have demonstrated the successful expression of the EF in E. coli as a fusion protein. It may be mass produced more economically in E. coli than in insect larvae. Owing to the detailed knowledge and variety of technologies available for this bacterium, the production cost will be further reduced by technical improvement. For example, the engineering of a bacterial signal sequence at the N terminus of the TMF-coding sequence in place of the existing EF signal sequence may make the cell secrete the fusion protein into the culture medium and facilitate the purification of the protein (see Kudo, 1994). Furthermore, the secretion process itself may lead to correct protein folding, with disulfide bond formation, because of the difference in electrochemical potential between the cytoplasm and the external environment (Pollitt and Zalkin, 1983).

On the other hand, E. coli has some drawbacks as the host of heterologous proteins. One of them is the production of pyrogens (endotoxins). From the standpoint of public acceptance, crops and yeast may serve as suitable hosts for the production of heterologous proteins of agricultural importance, because these organisms are traditionally used in food production and brewing. Hukuhara et al. (1999) suggested the use of the EF expressed in rice as a synergistic additive of viral insecticide. Another drawback is concerned with posttranslational modifications. The recovery of biologically active glycoproteins following intracellular expression in E. coli has often been problematic because of its inability to carry out posttranslational modifications. The EF and the fusolin of Anomala cuprea EV have been shown to be glycoproteins (Xu and Hukuhara, 1994; Tomita et al., 1998; Mitsuhashi et al., 1997), whereas a glycan moiety has not been detected in the fusolins of Choristoneura biennis EV, Helicoverpa armigera EV, and Melolontha melolontha EV, although potential Nglycosylation sites are present in the gene sequences of the former two EVs (Yuen et al., 1990; Dall et al., 1993; Gauthier et al., 1995). The recovery of biologically active EF from transformed E. coli cells in this study suggests that the majority of the EF enhancing activity is mediated by the EF sequence in the protein backbone, with little or no requirement for posttranslational modifications that occur in the native EF production in armyworm cells. Hukuhara and Wijonarko (2001) have shown that the EF enhances the fusion between the PsunMNPV

TABLE 4 Comparison of the Median Infectious Dose of PsunMNPV in the Presence and in the Absence of the EF Purified from a Lysate of E. coli Transformants a Treatment b

Slope (b) and SE

ID 50 of NPV (polyhedra/larva)

Log 10 ID 50 and SE

95% Fiducial limit

Enhancement index log 10

Purified EF Control

0.58 ⫾ 0.17 0.69 ⫾ 0.32

1.07 ⫻ 10 2 4.31 ⫻ 10 3

2.03 ⫾ 0.28 3.63 ⫾ 0.32

1.47–2.59 2.99–4.27

1.60 —

a EF expression vector containing both the signal- and the TMP-coding regions of the EF gene was used for transformation. Thrombin was used for the cleavage of the GST–EF fusion protein. b Each larva was administered 2 ␮g of the purified EF or distilled water (in the control) combined with PsunMNPV.

30

HUKUHARA, HAYAKAWA, AND WIJONARKO

FIG. 3. Kinetics of fusion of PsunMNPV and SIE-MSH-805-F cells (1 ⫻ 10 6/ml) at 25°C in the presence (A) or absence (B) of the purified EF (2.5 ␮g/ml) from a bacterial lysate containing the GST–EF fusion protein. The fluorescence intensity was determined at specific time periods and presented as a fraction of the intensity observed at 100% dequenching.

and a cultured insect cell line and speculated that the NPV infection of armyworm larvae is enhanced by the EF through enhanced fusion between the virions and the microvillus membrane of midgut columnar cells. We have demonstrated the enhanced cell–virus fusion by a purified EF preparation from transformed E. coli cells. The activation of the GST–EF fusion proteins by treatment with proteolytic enzymes may have some analogy with the activation of a paramyxovirus protein that mediates virus– cell fusion (Lamb, 1993). We propose a hypothesis that the EF moiety of the intact GST–EF fusion proteins has a configuration different from that of the native EF and, hence, is unsuitable for the enhancement of virus–microvillus fusion. REFERENCES Berkson, J. 1955. Estimates of the integrated normal curve by minimum normit chi-square with particular reference to bio-assay. J. Am. Statist. Assoc. 50, 529 –549. Bond, J. F., Garman, R. D., Keating, K. M., Briner, T. J., Rafner, T., Klapper, D. G., and Rogers, B. L. 1991. Multiple Amb a I allergens demonstrate specific reactivity with IgE and T cells from ragweeallergic patients. J. Immunol. 146, 3380 –3385. Dall, D., Sriskantha, A., Vera, A., Lai-Fook, J., and Symonds, T. 1993. A gene encoding a highly expressed spindle body protein of Heliothis armigera entomopoxvirus. J. Gen. Virol. 74, 1811–1818. Guan, K., and Dizon, J. E. 1991. Eukaryotic proteins expressed in Escherichia coli: An improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem. 192, 262–267. Gauthier, L., Cousserans, F., Veyrunes, J. C., and Bergoin, M. 1995. The Melolontha melolontha entomopoxvirus (MmEPV) fusolin is

related to the fusolins of lepidopteran EPVs and to the 37k baculovirus glycoprotein. Virology 208, 427– 436. Hanahan, D. 1985. Techniques for transformation of E. coli. In “DNA Cloning: A Practical Approach” (D. M. Glover, Ed.), Vol. 1, pp. 109 –135. IRL Press, Oxford. Hayakawa, T., Xu, J., and Hukuhara, T. 1996. Cloning and sequencing of the gene for an enhancing factor from Pseudaletia separata entomopoxvirus. Gene 177, 269 –270. Hayakawa, T., Zhu, Y., Itoh, K., Kimura, Y., Izawa, T., Shimamoto, K., and Toriyama, S. 1992. Genetically engineered rice resistant to rice stripe virus, an insect-transmitted virus. Proc. Natl. Acad. Sci. USA 89, 9865–9869. Hukuhara, T., and Wijonarko, A. 2001. Enhanced fusion of a nucleopolyhedrovirus with cultured cells by a virus enhancing factor from an entomopoxvirus. J. Invertbr. Pathol. 77, 62– 67. Hukuhara, T., Hayakawa, T., and Wijonarko, A. 1999. Increased baculovirus susceptibility of armyworm larvae feeding on transgenic rice plants expressing an entomopoxvirus gene. Nat. Biotechnol. 17, 1122–1124. Hukuhara, T., Xu, J., and Yano, K. 1990. Replication of an entomopoxvirus in two lepidopteran cell lines. J. Invertbr. Pathol. 56, 222–232. Hukuhara, T., Yano, K., Xu, J., Tomita, M., and Miyajima, S. 1995. Detection of a virus enhancing factor in inclusion bodies of an entomopoxvirus by immunoelectron microscopy. J. Invertebr. Pathol. 65, 315–317. Kudo, T. 1994. Escherichia coli secretion vector using the kil gene. In “Recombinant Microbes for Industrial and Agricultural Applications” (Y. Murooka and T. Imanaka, Eds.), pp. 291–299. Dekker, New York. Lamb, R. A. 1993. Paramyxovirus fusion, a hypothesis for changes. Virology 197, 1–11. Mitsuhashi, W., Saito, H., and Sato, M. 1997. Complete nucleotide sequence of the fusolin gene of an entomopoxvirus in the cupreous shafer, Anomala cuprea Hope (Coleoptera; Scarabaeidae). Insect Biochem. Mol. Biol. 27, 869 – 876. Pollitt, S., and Zalkin, H. 1983. Role of primary structure and disulfide bond formation in beta-lactamase secretion. J. Bacteriol. 153, 27–32. Smith, D. B., and Johnson, K. S. 1988. Single step purification of polypeptides in Escherichia coli as fusions with glutathione Stransferase. Gene 67, 31– 40. Tomita, M., Takahashi, Y., Hukuhara, T., and Miyajima, S. 1998. Serological relationship between inclusion body proteins and a virus enhancing factor of an entomopoxvirus. Appl. Entomol. Zool. 33, 271–280. Wijonarko, A., and Hukuhara, T. 1998. Detection of a virus enhancing factor in the spheroid, spindle, and virion of an entomopoxvirus. J. Invertebr. Pathol. 72, 82– 86. Xu, J., and Hukuhara, T. 1992. Enhanced infection of a nuclear polyhedrosis virus in larvae of the armyworm, Pseudaletia unipuncta, by a factor in the spheroid of an entomopoxvirus. J. Invertebr. Pathol. 60, 259 –264. Xu, J., and Hukuhara, T. 1994. Biochemical properties of an enhancing factor of an entomopoxvirus. J. Invertebr. Pathol. 63, 14 –18. Yuen, L., Dionne, J., Arif, B., and Richardson, C. 1990. Identification and sequencing of the spheroidin gene of Choristoneura biennis entomopoxvirus. Virology 175, 427– 433.