- Email: [email protected]
T single nucleotide polymorphism at the tyrosine kinase domain of the insulin receptor gene is associated with polycystic ovary syndrome
FERTILITY AND STERILITY威 VOL. 78, NO. 6, DECEMBER 2002 Copyright ©2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A.
A C/T single nucleotide polymorphism at the tyrosine kinase domain of the insulin receptor gene is associated with polycystic ovary syndrome Sheera Siegel, M.D.,a Walter Futterweit, M.D.,a Terry F. Davies, M.D.,a Erlinda S. Concepcion, B.Sc.,a David A. Greenberg, Ph.D.,b Ronald Villanueva, M.D.,a and Yaron Tomer, M.D.a Mount Sinai School of Medicine and Columbia University, New York, New York
Objective: To examine whether the insulin receptor (INSR) gene contributes to genetic susceptibility to the polycystic ovary syndrome (PCOS). Design: Case– control study. Setting: Academic endocrinology clinic. Patient(s): Ninety-nine women with PCOS as defined by the National Institutes of Health consensus and polycystic ovaries on ultrasonography, and 136 healthy controls. Main Outcome Measure(s): Frequency of genotypes of a single nucleotide polymorphism of the INSR gene in patients and controls.
Received March 13, 2002; revised and accepted May 14, 2002. This work was supported in part by the following grants from the National Institutes of Health: DK35764, DK45011, and DK52464 to Dr. Davies; DK02498 to Dr. Tomer; and DK31775, NS27941, and MH48858 to Dr. Greenberg. Reprint requests: Yaron Tomer, M.D., Division of Endocrinology, Box 1055, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, New York 10029 (FAX: 212-241-4218; E-mail: [email protected]). a Division of Endocrinology Diabetes and Bone Disease, Department of Medicine. b Division of Statistical Genetics, Columbia University. 0015-0282/02/$22.00 PII S0015-0282(02)04241-3
1240
Result(s): After stratification of participants by body mass index, the frequency of the uncommon T allele of the INSR single nucleotide polymorphism was significantly increased in lean patients with PCOS (body mass index ⱕ27 kg/m2) compared with lean controls (relative risk, 2.1). Conclusion(s): The INSR gene is a susceptibility gene for PCOS among lean patients with PCOS. It remains to be determined whether the exon 17 C/T single nucleotide polymorphism is the susceptibility single nucleotide polymorphism for PCOS or whether it is in linkage disequilibrium with another INSR gene polymorphism. (Fertil Steril威 2002;78:1240 –3. ©2002 by American Society for Reproductive Medicine.) Key Words: Polycystic ovary syndrome, insulin receptor, association, gene, single nucleotide polymorphism
The polycystic ovary syndrome (PCOS) affects 5% to 10% of women of reproductive age (1). It is characterized by anovulation, with consequential menstrual irregularity, and signs of hyperandrogenism (2). Approximately 50% of patients with PCOS are obese, and up to 70% have enlarged ovaries with multiple subcapsular cysts 8 to 10 mm in size (3). However, ovarian volume has not been found to differ between lean and obese patients with PCOS (4). Both lean and obese patients with PCOS have been found to be at risk for insulin resistance and type 2 diabetes mellitus (5–7). In a recent cross-sectional study of 49 premenopausal women with type 2 diabetes mellitus, 82% had polycystic ovaries on ultrasonogra-
phy; of these women, 52% had clinical evidence of hyperandrogenism or menstrual disturbance (8). These findings may indicate that insulin resistance and hyperinsulinemia play a direct role in the development of hyperandrogenism and PCOS. Indeed, hyperandrogenism and polycystic ovaries have been described in nonobese patients with insulinomas (9). The mechanisms in which hyperinsulinemia causes androgen excess and polycystic ovaries are unknown. Receptors for insulin and insulinlike growth factor-1 have been found in ovarian tissue, and in vitro studies have shown that insulin stimulates steroidogenesis by the ovary (10). Insulin has also been shown in vitro and in vivo to enhance ovarian growth and cyst formation (11).
The etiology of PCOS is thought to involve a combination of genetic and environmental factors. Strong evidence indicates that PCOS is familial, and the sibling risk ratio S for PCOS is 50% to 80% (12, 13). Segregation analyses in families with PCOS suggested a mendelian dominant pattern of inheritance when premature baldness is assumed as the male phenotype of the disorder (14, 15). Although the susceptibility genes for PCOS are unknown, several candidate genes have been evaluated. To date, only VNTR (variable number of tandem repeats), which is located upstream of the insulin gene, has shown consistent linkage and association with PCOS (16, 17). Recently, we (18, 19) and others (20) found evidence that a susceptibility gene for PCOS is located on chromosome 19p13.3 in the insulin receptor (INSR) gene region. Therefore, we hypothesized that the INSR gene itself might be the susceptibility gene for PCOS. Given the wide variability of insulin resistance among patients with PCOS, it is unlikely that a major mutation in the insulin receptor gene would lead to PCOS. Rather, polymorphisms in the INSR gene that induce mild changes in insulin receptor function may contribute to the development of PCOS. Previous studies of the INSR gene have failed to find major mutations in the INSR gene in patients with PCOS (21, 22); however, in these studies, several polymorphisms were identified within the coding and noncoding regions of the INSR gene (21, 23). One of these is a C/T single nucleotide polymorphism at His1058. We analyzed this INSR gene single nucleotide polymorphism because it is located in the tyrosine kinase domain of INSR, which is critical to the function of the gene. We report a significant association between PCOS and the T allele of the His1058 C/T single nucleotide polymorphism of the INSR gene.
MATERIALS AND METHODS Participants The study was approved by the Mount Sinai School of Medicine institutional review board. Written consent was obtained from all participants, and clinical and laboratory information was stored in a database. We studied 99 white women 16 to 52 years of age (mean age, 28 years) who had PCOS. All patients had a history of oligomenorrhea and evidence of hyperandrogenism (on clinical examination or documented elevated testosterone levels). Women with any other cause of oligomenorrhea and hyperandrogenism were excluded. We enrolled only women who had polycystic ovaries on ultrasonography to ensure that the phenotype was definitely PCOS. This is crucial in genetic studies of PCOS, since some patients with PCOS do not have morphologic evidence of polycystic ovaries and may represent a different phenoFERTILITY & STERILITY威
type (24). Polycystic ovarian morphology was determined on the basis of ovarian volume measurement and follicle size and number, as described elsewhere (25). Fifty-two (52.5%) patients had a body mass index ⬎27 kg/m2; these women were considered obese. The 47 patients (47.5%) with a body mass index ⱕ27 were considered lean. We also included 136 age-matched white female controls. Of these women, 103 (75.7%) were lean and 33 (24.3%) were obese. The differing percentages of lean and obese women between the patients and controls did not affect our analysis, since we analyzed these groups separately. In all participants, a clinician blinded to genotype determined the phenotype.
Analysis of the INSR Exon 17 Single Nucleotide Polymorphism DNA was extracted from whole blood by using the Puregene kit (Gentra Systems, Minneapolis, MN). We analyzed the single nucleotide polymorphism of the INSR gene at the 3⬘ end of exon 17 (position 10923 of the INSR gene) by using automated fluorescent-based restriction fragment length polymorphism (RFLP) analysis, as described elsewhere (26). The DNA was amplified by using CCAAGGATGCTGTGTAGATAAG as the forward primer and TCAGGAAAGCCAGCCCATGTC as the reverse primer. The forward primer was fluorescent labeled. Amplification by polymerase chain reaction (PCR) was performed in a 20-L reaction mixture containing 50 ng of total DNA, as described elsewhere (26). Fluorescent-labeled PCR products were incubated at 37°C with the restriction enzyme Pml1 (New England Biolabs, Beverly, MA) for 2 hours. The digested PCR product was diluted at a ratio of 1:25 in ddH2O, denatured, and separated on an ABI-310 genetic analyzer (Applied Biosystems, Foster City, CA). The two alleles were separated by using the following method. The C allele resulted in an undigested PCR product of 317 base pairs (bp), and the T allele resulted in a digested PCR product with two fragments of 274 and 43 bp. Because the 274-bp fragment contained the fluorescent-labeled forward primer, it was visualized on the ABI-310 analyzer, whereas the 43 bp fragment was not. The alleles were typed by using Genotyper 2.0 software (Applied Biosystems, Foster City, CA).
Statistical Analysis Associations were analyzed by using the 2 test. Relative risks were calculated as described elsewhere (26).
RESULTS Table 1 shows the frequency of the CC and CT⫹TT genotypes of the INSR His 1058 C/T single nucleotide polymorphism in patients with PCOS and controls. The frequency of the T allele (i.e., the CT⫹TT genotypes) was 1241
TABLE 1 Allele frequencies of the INSR gene exon 17 C/T single nucleotide polymorphism in patients with PCOS (n ⫽ 99) and controls (n ⫽ 136).
Group Lean PCOS patients (n ⫽ 47) Lean controls (n ⫽ 103) Obese PCOS patients (n ⫽ 52) Obese controls (n ⫽ 33)
No. with CC genotype (%)
No. with CT and TT genotypes (%)
25 (53) 73 (71) 37 (71) 20 (61)
22 (47)a 30 (29) 15 (29) 13 (39)
PCOS ⫽ polycystic ovary syndrome. a P ⫽.03. Siegel. Insulin receptor single nucleotide polymorphism and PCO. Fertil Steril 2002.
significantly increased in lean patients with PCOS compared with lean controls. Twenty-two (47%) of lean patients with PCOS but only 29% of lean controls had the C-to-T substitution (relative risk, 2.1; P⫽.03). In contrast, the frequency of the C and T alleles did not differ significantly between obese patients with PCOS and obese controls (P⫽.32) (Table 1). The frequency of the T allele was nonsignificantly increased in obese controls compared with lean controls (39% and 29%, respectively) (Table 1).
DISCUSSION We found an association between a single nucleotide polymorphism at exon 17 of the INSR gene and PCOS. Therefore, sequence polymorphisms in the INSR gene itself may predispose to the development of PCOS. Previous studies have shown an association of the INSR gene region with PCOS (18 –20), but we show for the first time that the INSR gene itself participates in the development of PCOS. Of note, this single nucleotide polymorphism was only associated with PCOS in lean patients (those with body mass index ⱕ27 kg/m2). Because PCOS encompasses many phenotypic expressions that are probably affected by many genes, it was not surprising that only a subset of patients with PCOS showed an association with the INSR gene. However, it was unclear why the association with the INSR gene was seen only in the lean patients with PCOS, when obese patients with PCOS are notably more insulin resistant. Moreover, obesity predisposes to hyperandrogenism, and studies have shown a positive association between body mass index and testosterone level as well as the free androgen index in patients with PCOS but not in controls (27). These findings suggested a direct role of obesity and insulin resistance in the development of PCOS (11). However, previous studies have also shown that the in1242 Siegel et al.
sulin resistance in PCOS is independent of body weight (5). Therefore, such factors as changes in the function of the INSR gene may play a role in the development of PCOS. Our findings of an association between an INSR gene polymorphism and the lean PCOS phenotype support this hypothesis. It is possible that insulin resistance in the lean and obese subsets of PCOS patients was caused by different mechanisms. Alternatively, a larger sample size might have yielded significance in the entire sample. Analyses of large cohorts are needed to confirm our observations. The INSR receptor gene comprises 22 exons spanning 120 kilobases on chromosome 19 (21). Mutations in exons 17 to 21, the region that encodes the tyrosine kinase domain of the insulin receptor, have been shown to cause severe insulin resistance and hyperinsulinemia (28 –30). Of note, studies of insulin receptor function in some women with PCOS have detected changes in autophosphorylation that may have been secondary to polymorphisms in the tyrosine kinase domain (5). The single nucleotide polymorphism that we chose to evaluate is in exon 17 of the INSR gene, in the tyrosine kinase domain of the insulin receptor. Several previous studies also analyzed the INSR gene in patients with PCOS. In one study, the entire coding region of the insulin receptor gene was evaluated by single-strand conformational polymorphism analysis in 24 insulin-resistant patients with PCOS to screen for single-base changes (21). The authors found that 11 patients (46%) had the C-to-T substitution in the INSR gene His1058 C/T single nucleotide polymorphism. Only 1 of 5 controls had this substitution. The small number of participants precluded statistical analysis (21). In another study of 22 hyperinsulinemic patients with PCOS, 8 patients were found to have the C-to-T substitution in the INSR gene His 1058 C/T single nucleotide polymorphism, whereas 1 of 8 controls had the T allele (23). Thus, the combined previous data yield a 41% (19 of 46) frequency of the T allele in patients with PCOS and a 15% (2 of 13) frequency in controls. These frequencies were similar to the ones that we obtained in a much larger cohort. The only locus besides the INSR gene locus to show consistent association with PCOS is the insulin gene VNTR. The VNTR locus is upstream of the insulin gene and regulates insulin gene expression. Mapping of susceptibility to PCOS to the insulin gene VNTR implied that PCOS was due in part to an inherited alteration in insulin production. Our data support a role of the insulin-INSR axis in the development of PCOS, and combined alterations in insulin secretion and in INSR sensitivity to insulin may cause predisposition to PCOS (11). These data also suggest a mechanistic link between insulin resistance and PCOS. The definition of PCOS is broad and encompasses obese and lean women with a wide spectrum of clinical manifestations. It is possible that different genetic variations lead to
Insulin receptor single nucleotide polymorphism and PCO
Vol. 78, No. 6, December 2002
the various clinical expressions of PCOS as it is currently defined. In conclusion, we demonstrated that a single nucleotide polymorphism in the tyrosine kinase domain of the INSR gene was associated with one subtype of PCOS. Other susceptibility genes and environmental factors contributing to the expression of PCOS remain to be delineated.
Acknowledgments: The authors thank J. Lester Gabrilove, M.D., Mount Sinai School of Medicine, New York, New York for helpful discussions and comments, and Molly Shulman and Philip Kingsley for continuing support.
References 1. Futterweit W. Polycystic ovary syndrome: clinical perspectives and management. Obstet Gynecol Surv 1999;54:403–13. 2. Zacur HA. Polycystic ovary syndrome, hyperandrogenism, and insulin resistance. Obstet Gynecol Clin North Am 2001;28:21–33. 3. Conway GS, Honour JW, Jacobs HS. Heterogeneity of the polycystic ovary syndrome: clinical, endocrine and ultrasound features in 556 patients. Clin Endocrinol (Oxf) 1989;30:459 –70. 4. Sengos C, Andreakos C, Iatrakis G. Sonographic parameters and hormonal status in lean and obese women with polycystic ovary syndrome. Clin Exp Obstet Gynecol 2000;27:35–8. 5. Dunaif A, Segal KR, Shelley DR, Green G, Dobrjansky A, Licholai T. Evidence for distinctive and intrinsic defects in insulin action in polycystic ovary syndrome. Diabetes 1992;41:1257–66. 6. Poretsky L, Piper B. Insulin resistance, hypersecretion of LH, and a dual-defect hypothesis for the pathogenesis of polycystic ovary syndrome. Obstet Gynecol 1994;84:613–21. 7. Legro RS, Kunselman AR, Dodson WC, Dunaif A. Prevalence and predictors of risk for type 2 diabetes mellitus and impaired glucose tolerance in polycystic ovary syndrome: a prospective, controlled study in 254 affected women. J Clin Endocrinol Metab 1999;84:165–9. 8. Conn JJ, Jacobs HS, Conway GS. The prevalence of polycystic ovaries in women with type 2 diabetes mellitus. Clin Endocrinol (Oxf) 2000; 52:81–6. 9. Murray RD, Davison RM, Russell RC, Conway GS. Clinical presentation of PCOS following development of an insulinoma: case report. Hum Reprod 2000;15:86 –8. 10. Poretsky L, Smith D, Seibel M, Pazianos A, Moses AC, Flier JS. Specific insulin binding sites in human ovary. J Clin Endocrinol Metab 1984;59:809 –11. 11. Poretsky L, Cataldo NA, Rosenwaks Z, Giudice LC. The insulin-related ovarian regulatory system in health and disease. Endocr Rev 1999;20: 535–82. 12. Legro RS, Driscoll D, Strauss JF, 3rd, Fox J, Dunaif A. Evidence for a genetic basis for hyperandrogenemia in polycystic ovary syndrome. Proc Natl Acad Sci U S A 1998;95:14956 –60.
FERTILITY & STERILITY威
13. Hague WM, Adams J, Reeders ST, Peto TE, Jacobs HS. Familial polycystic ovaries: a genetic disease? Clin Endocrinol (Oxf) 1988;29: 593–605. 14. Carey AH, Chan KL, Short F, White D, Williamson R, Franks S. Evidence for a single gene effect causing polycystic ovaries and male pattern baldness. Clin Endocrinol (Oxf) 1993;38:653–8. 15. Legro RS. The genetics of polycystic ovary syndrome. Am J Med 1995;98(1A):9S–16S. 16. Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, Norman RJ, et al. Thirty-seven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. Proc Natl Acad Sci U S A 1999;96:8573–8. 17. Waterworth DM, Bennett ST, Gharani N, McCarthy MI, Hague S, Batty S, et al. Linkage and association of insulin gene VNTR regulatory polymorphism with polycystic ovary syndrome. Lancet 1997;349:986 – 90. 18. Tucci S, Futterweit W, Gabrilove JL, Concepcion ES, Greenberg DA, Villanueva RB, et al. The insulin receptor gene region contains a gene for polycystic ovary syndrome. In: 82nd Annual Meeting of the Endocrine Society, Toronto, Canada, June 21–24, 2000. 19. Tucci S, Futterweit W, Concepcion ES, Greenberg DA, Villanueva R, Davies TF, et al. Evidence for association of polycystic ovary syndrome in Caucasian women with a marker at the insulin receptor gene locus. J Clin Endocrinol Metab 2001;86:446 –9. 20. Urbanek M, Legro RS, Driscoll D, Strauss JF, 3rd, Dunaif A, Spielman RS. Searching for the polycystic ovary syndrome genes. J Pediatr Endocrinol Metab 2000;13(Suppl 5):1311–3. 21. Talbot JA, Bicknell EJ, Rajkhowa M, Krook A, O’Rahilly S, Clayton RN. Molecular scanning of the insulin receptor gene in women with polycystic ovarian syndrome. J Clin Endocrinol Metab 1996;81:1979 – 83. 22. Sorbara LR, Tang Z, Cama A, Xia J, Schenker E, Kohanski RA, et al. Absence of insulin receptor gene mutations in three insulin-resistant women with the polycystic ovary syndrome. Metabolism 1994;43: 1568 –74. 23. Conway GS, Avey C, Rumsby G. The tyrosine kinase domain of the insulin receptor gene is normal in women with hyperinsulinaemia and polycystic ovary syndrome. Hum Reprod 1994;9:1681–3. 24. Robert Y, Ardaens Y, Dewailly D. Imaging polycystic ovaries in polycystic ovary syndrome. In: Kovacs GT, editor. Polycystic ovary syndrome. Cambridge (UK): Cambridge University Press, 2000:56 –69. 25. Yeh HC, Futterweit W, Thornton JC. Polycystic ovarian disease: US features in 104 patients. Radiology 1987;163:111–6. 26. Villanueva R, Inzerillo AM, Tomer Y, Barbesino G, Meltzer M, Concepcion ES, et al. Limited genetic susceptibility to severe Graves’ ophthalmopathy: no role for CTLA-4 but evidence for an environmental etiology. Thyroid 2000;10:791–8. 27. Holte J, Bergh T, Gennarelli G, Wide L. The independent effects of polycystic ovary syndrome and obesity on serum concentrations of gonadotrophins and sex steroids in premenopausal women. Clin Endocrinol (Oxf) 1994;41:473–81. 28. Taylor SI, Kadowaki T, Kadowaki H, Accili D, Cama A, McKeon C. Mutations in insulin-receptor gene in insulin-resistant patients. Diabetes Care 1990;13:257–79. 29. Moller DE, Yokota A, White MF, Pazianos AG, Flier JS. A naturally occurring mutation of insulin receptor alanine 1134 impairs tyrosine kinase function and is associated with dominantly inherited insulin resistance. J Biol Chem 1990;265:14979 –85. 30. Moller DE, Flier JS. Detection of an alteration in the insulin-receptor gene in a patient with insulin resistance, acanthosis nigricans, and the polycystic ovary syndrome (type A insulin resistance). N Engl J Med 1988;319:1526 –9.
1243
A C/T single nucleotide polymorphism at the tyrosine kinase domain of the insulin receptor gene is associated with polycystic ovary syndrome Sheera Siegel, M.D.,a Walter Futterweit, M.D.,a Terry F. Davies, M.D.,a Erlinda S. Concepcion, B.Sc.,a David A. Greenberg, Ph.D.,b Ronald Villanueva, M.D.,a and Yaron Tomer, M.D.a Mount Sinai School of Medicine and Columbia University, New York, New York
Objective: To examine whether the insulin receptor (INSR) gene contributes to genetic susceptibility to the polycystic ovary syndrome (PCOS). Design: Case– control study. Setting: Academic endocrinology clinic. Patient(s): Ninety-nine women with PCOS as defined by the National Institutes of Health consensus and polycystic ovaries on ultrasonography, and 136 healthy controls. Main Outcome Measure(s): Frequency of genotypes of a single nucleotide polymorphism of the INSR gene in patients and controls.
Received March 13, 2002; revised and accepted May 14, 2002. This work was supported in part by the following grants from the National Institutes of Health: DK35764, DK45011, and DK52464 to Dr. Davies; DK02498 to Dr. Tomer; and DK31775, NS27941, and MH48858 to Dr. Greenberg. Reprint requests: Yaron Tomer, M.D., Division of Endocrinology, Box 1055, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, New York 10029 (FAX: 212-241-4218; E-mail: [email protected]). a Division of Endocrinology Diabetes and Bone Disease, Department of Medicine. b Division of Statistical Genetics, Columbia University. 0015-0282/02/$22.00 PII S0015-0282(02)04241-3
1240
Result(s): After stratification of participants by body mass index, the frequency of the uncommon T allele of the INSR single nucleotide polymorphism was significantly increased in lean patients with PCOS (body mass index ⱕ27 kg/m2) compared with lean controls (relative risk, 2.1). Conclusion(s): The INSR gene is a susceptibility gene for PCOS among lean patients with PCOS. It remains to be determined whether the exon 17 C/T single nucleotide polymorphism is the susceptibility single nucleotide polymorphism for PCOS or whether it is in linkage disequilibrium with another INSR gene polymorphism. (Fertil Steril威 2002;78:1240 –3. ©2002 by American Society for Reproductive Medicine.) Key Words: Polycystic ovary syndrome, insulin receptor, association, gene, single nucleotide polymorphism
The polycystic ovary syndrome (PCOS) affects 5% to 10% of women of reproductive age (1). It is characterized by anovulation, with consequential menstrual irregularity, and signs of hyperandrogenism (2). Approximately 50% of patients with PCOS are obese, and up to 70% have enlarged ovaries with multiple subcapsular cysts 8 to 10 mm in size (3). However, ovarian volume has not been found to differ between lean and obese patients with PCOS (4). Both lean and obese patients with PCOS have been found to be at risk for insulin resistance and type 2 diabetes mellitus (5–7). In a recent cross-sectional study of 49 premenopausal women with type 2 diabetes mellitus, 82% had polycystic ovaries on ultrasonogra-
phy; of these women, 52% had clinical evidence of hyperandrogenism or menstrual disturbance (8). These findings may indicate that insulin resistance and hyperinsulinemia play a direct role in the development of hyperandrogenism and PCOS. Indeed, hyperandrogenism and polycystic ovaries have been described in nonobese patients with insulinomas (9). The mechanisms in which hyperinsulinemia causes androgen excess and polycystic ovaries are unknown. Receptors for insulin and insulinlike growth factor-1 have been found in ovarian tissue, and in vitro studies have shown that insulin stimulates steroidogenesis by the ovary (10). Insulin has also been shown in vitro and in vivo to enhance ovarian growth and cyst formation (11).
The etiology of PCOS is thought to involve a combination of genetic and environmental factors. Strong evidence indicates that PCOS is familial, and the sibling risk ratio S for PCOS is 50% to 80% (12, 13). Segregation analyses in families with PCOS suggested a mendelian dominant pattern of inheritance when premature baldness is assumed as the male phenotype of the disorder (14, 15). Although the susceptibility genes for PCOS are unknown, several candidate genes have been evaluated. To date, only VNTR (variable number of tandem repeats), which is located upstream of the insulin gene, has shown consistent linkage and association with PCOS (16, 17). Recently, we (18, 19) and others (20) found evidence that a susceptibility gene for PCOS is located on chromosome 19p13.3 in the insulin receptor (INSR) gene region. Therefore, we hypothesized that the INSR gene itself might be the susceptibility gene for PCOS. Given the wide variability of insulin resistance among patients with PCOS, it is unlikely that a major mutation in the insulin receptor gene would lead to PCOS. Rather, polymorphisms in the INSR gene that induce mild changes in insulin receptor function may contribute to the development of PCOS. Previous studies of the INSR gene have failed to find major mutations in the INSR gene in patients with PCOS (21, 22); however, in these studies, several polymorphisms were identified within the coding and noncoding regions of the INSR gene (21, 23). One of these is a C/T single nucleotide polymorphism at His1058. We analyzed this INSR gene single nucleotide polymorphism because it is located in the tyrosine kinase domain of INSR, which is critical to the function of the gene. We report a significant association between PCOS and the T allele of the His1058 C/T single nucleotide polymorphism of the INSR gene.
MATERIALS AND METHODS Participants The study was approved by the Mount Sinai School of Medicine institutional review board. Written consent was obtained from all participants, and clinical and laboratory information was stored in a database. We studied 99 white women 16 to 52 years of age (mean age, 28 years) who had PCOS. All patients had a history of oligomenorrhea and evidence of hyperandrogenism (on clinical examination or documented elevated testosterone levels). Women with any other cause of oligomenorrhea and hyperandrogenism were excluded. We enrolled only women who had polycystic ovaries on ultrasonography to ensure that the phenotype was definitely PCOS. This is crucial in genetic studies of PCOS, since some patients with PCOS do not have morphologic evidence of polycystic ovaries and may represent a different phenoFERTILITY & STERILITY威
type (24). Polycystic ovarian morphology was determined on the basis of ovarian volume measurement and follicle size and number, as described elsewhere (25). Fifty-two (52.5%) patients had a body mass index ⬎27 kg/m2; these women were considered obese. The 47 patients (47.5%) with a body mass index ⱕ27 were considered lean. We also included 136 age-matched white female controls. Of these women, 103 (75.7%) were lean and 33 (24.3%) were obese. The differing percentages of lean and obese women between the patients and controls did not affect our analysis, since we analyzed these groups separately. In all participants, a clinician blinded to genotype determined the phenotype.
Analysis of the INSR Exon 17 Single Nucleotide Polymorphism DNA was extracted from whole blood by using the Puregene kit (Gentra Systems, Minneapolis, MN). We analyzed the single nucleotide polymorphism of the INSR gene at the 3⬘ end of exon 17 (position 10923 of the INSR gene) by using automated fluorescent-based restriction fragment length polymorphism (RFLP) analysis, as described elsewhere (26). The DNA was amplified by using CCAAGGATGCTGTGTAGATAAG as the forward primer and TCAGGAAAGCCAGCCCATGTC as the reverse primer. The forward primer was fluorescent labeled. Amplification by polymerase chain reaction (PCR) was performed in a 20-L reaction mixture containing 50 ng of total DNA, as described elsewhere (26). Fluorescent-labeled PCR products were incubated at 37°C with the restriction enzyme Pml1 (New England Biolabs, Beverly, MA) for 2 hours. The digested PCR product was diluted at a ratio of 1:25 in ddH2O, denatured, and separated on an ABI-310 genetic analyzer (Applied Biosystems, Foster City, CA). The two alleles were separated by using the following method. The C allele resulted in an undigested PCR product of 317 base pairs (bp), and the T allele resulted in a digested PCR product with two fragments of 274 and 43 bp. Because the 274-bp fragment contained the fluorescent-labeled forward primer, it was visualized on the ABI-310 analyzer, whereas the 43 bp fragment was not. The alleles were typed by using Genotyper 2.0 software (Applied Biosystems, Foster City, CA).
Statistical Analysis Associations were analyzed by using the 2 test. Relative risks were calculated as described elsewhere (26).
RESULTS Table 1 shows the frequency of the CC and CT⫹TT genotypes of the INSR His 1058 C/T single nucleotide polymorphism in patients with PCOS and controls. The frequency of the T allele (i.e., the CT⫹TT genotypes) was 1241
TABLE 1 Allele frequencies of the INSR gene exon 17 C/T single nucleotide polymorphism in patients with PCOS (n ⫽ 99) and controls (n ⫽ 136).
Group Lean PCOS patients (n ⫽ 47) Lean controls (n ⫽ 103) Obese PCOS patients (n ⫽ 52) Obese controls (n ⫽ 33)
No. with CC genotype (%)
No. with CT and TT genotypes (%)
25 (53) 73 (71) 37 (71) 20 (61)
22 (47)a 30 (29) 15 (29) 13 (39)
PCOS ⫽ polycystic ovary syndrome. a P ⫽.03. Siegel. Insulin receptor single nucleotide polymorphism and PCO. Fertil Steril 2002.
significantly increased in lean patients with PCOS compared with lean controls. Twenty-two (47%) of lean patients with PCOS but only 29% of lean controls had the C-to-T substitution (relative risk, 2.1; P⫽.03). In contrast, the frequency of the C and T alleles did not differ significantly between obese patients with PCOS and obese controls (P⫽.32) (Table 1). The frequency of the T allele was nonsignificantly increased in obese controls compared with lean controls (39% and 29%, respectively) (Table 1).
DISCUSSION We found an association between a single nucleotide polymorphism at exon 17 of the INSR gene and PCOS. Therefore, sequence polymorphisms in the INSR gene itself may predispose to the development of PCOS. Previous studies have shown an association of the INSR gene region with PCOS (18 –20), but we show for the first time that the INSR gene itself participates in the development of PCOS. Of note, this single nucleotide polymorphism was only associated with PCOS in lean patients (those with body mass index ⱕ27 kg/m2). Because PCOS encompasses many phenotypic expressions that are probably affected by many genes, it was not surprising that only a subset of patients with PCOS showed an association with the INSR gene. However, it was unclear why the association with the INSR gene was seen only in the lean patients with PCOS, when obese patients with PCOS are notably more insulin resistant. Moreover, obesity predisposes to hyperandrogenism, and studies have shown a positive association between body mass index and testosterone level as well as the free androgen index in patients with PCOS but not in controls (27). These findings suggested a direct role of obesity and insulin resistance in the development of PCOS (11). However, previous studies have also shown that the in1242 Siegel et al.
sulin resistance in PCOS is independent of body weight (5). Therefore, such factors as changes in the function of the INSR gene may play a role in the development of PCOS. Our findings of an association between an INSR gene polymorphism and the lean PCOS phenotype support this hypothesis. It is possible that insulin resistance in the lean and obese subsets of PCOS patients was caused by different mechanisms. Alternatively, a larger sample size might have yielded significance in the entire sample. Analyses of large cohorts are needed to confirm our observations. The INSR receptor gene comprises 22 exons spanning 120 kilobases on chromosome 19 (21). Mutations in exons 17 to 21, the region that encodes the tyrosine kinase domain of the insulin receptor, have been shown to cause severe insulin resistance and hyperinsulinemia (28 –30). Of note, studies of insulin receptor function in some women with PCOS have detected changes in autophosphorylation that may have been secondary to polymorphisms in the tyrosine kinase domain (5). The single nucleotide polymorphism that we chose to evaluate is in exon 17 of the INSR gene, in the tyrosine kinase domain of the insulin receptor. Several previous studies also analyzed the INSR gene in patients with PCOS. In one study, the entire coding region of the insulin receptor gene was evaluated by single-strand conformational polymorphism analysis in 24 insulin-resistant patients with PCOS to screen for single-base changes (21). The authors found that 11 patients (46%) had the C-to-T substitution in the INSR gene His1058 C/T single nucleotide polymorphism. Only 1 of 5 controls had this substitution. The small number of participants precluded statistical analysis (21). In another study of 22 hyperinsulinemic patients with PCOS, 8 patients were found to have the C-to-T substitution in the INSR gene His 1058 C/T single nucleotide polymorphism, whereas 1 of 8 controls had the T allele (23). Thus, the combined previous data yield a 41% (19 of 46) frequency of the T allele in patients with PCOS and a 15% (2 of 13) frequency in controls. These frequencies were similar to the ones that we obtained in a much larger cohort. The only locus besides the INSR gene locus to show consistent association with PCOS is the insulin gene VNTR. The VNTR locus is upstream of the insulin gene and regulates insulin gene expression. Mapping of susceptibility to PCOS to the insulin gene VNTR implied that PCOS was due in part to an inherited alteration in insulin production. Our data support a role of the insulin-INSR axis in the development of PCOS, and combined alterations in insulin secretion and in INSR sensitivity to insulin may cause predisposition to PCOS (11). These data also suggest a mechanistic link between insulin resistance and PCOS. The definition of PCOS is broad and encompasses obese and lean women with a wide spectrum of clinical manifestations. It is possible that different genetic variations lead to
Insulin receptor single nucleotide polymorphism and PCO
Vol. 78, No. 6, December 2002
the various clinical expressions of PCOS as it is currently defined. In conclusion, we demonstrated that a single nucleotide polymorphism in the tyrosine kinase domain of the INSR gene was associated with one subtype of PCOS. Other susceptibility genes and environmental factors contributing to the expression of PCOS remain to be delineated.
Acknowledgments: The authors thank J. Lester Gabrilove, M.D., Mount Sinai School of Medicine, New York, New York for helpful discussions and comments, and Molly Shulman and Philip Kingsley for continuing support.
References 1. Futterweit W. Polycystic ovary syndrome: clinical perspectives and management. Obstet Gynecol Surv 1999;54:403–13. 2. Zacur HA. Polycystic ovary syndrome, hyperandrogenism, and insulin resistance. Obstet Gynecol Clin North Am 2001;28:21–33. 3. Conway GS, Honour JW, Jacobs HS. Heterogeneity of the polycystic ovary syndrome: clinical, endocrine and ultrasound features in 556 patients. Clin Endocrinol (Oxf) 1989;30:459 –70. 4. Sengos C, Andreakos C, Iatrakis G. Sonographic parameters and hormonal status in lean and obese women with polycystic ovary syndrome. Clin Exp Obstet Gynecol 2000;27:35–8. 5. Dunaif A, Segal KR, Shelley DR, Green G, Dobrjansky A, Licholai T. Evidence for distinctive and intrinsic defects in insulin action in polycystic ovary syndrome. Diabetes 1992;41:1257–66. 6. Poretsky L, Piper B. Insulin resistance, hypersecretion of LH, and a dual-defect hypothesis for the pathogenesis of polycystic ovary syndrome. Obstet Gynecol 1994;84:613–21. 7. Legro RS, Kunselman AR, Dodson WC, Dunaif A. Prevalence and predictors of risk for type 2 diabetes mellitus and impaired glucose tolerance in polycystic ovary syndrome: a prospective, controlled study in 254 affected women. J Clin Endocrinol Metab 1999;84:165–9. 8. Conn JJ, Jacobs HS, Conway GS. The prevalence of polycystic ovaries in women with type 2 diabetes mellitus. Clin Endocrinol (Oxf) 2000; 52:81–6. 9. Murray RD, Davison RM, Russell RC, Conway GS. Clinical presentation of PCOS following development of an insulinoma: case report. Hum Reprod 2000;15:86 –8. 10. Poretsky L, Smith D, Seibel M, Pazianos A, Moses AC, Flier JS. Specific insulin binding sites in human ovary. J Clin Endocrinol Metab 1984;59:809 –11. 11. Poretsky L, Cataldo NA, Rosenwaks Z, Giudice LC. The insulin-related ovarian regulatory system in health and disease. Endocr Rev 1999;20: 535–82. 12. Legro RS, Driscoll D, Strauss JF, 3rd, Fox J, Dunaif A. Evidence for a genetic basis for hyperandrogenemia in polycystic ovary syndrome. Proc Natl Acad Sci U S A 1998;95:14956 –60.
FERTILITY & STERILITY威
13. Hague WM, Adams J, Reeders ST, Peto TE, Jacobs HS. Familial polycystic ovaries: a genetic disease? Clin Endocrinol (Oxf) 1988;29: 593–605. 14. Carey AH, Chan KL, Short F, White D, Williamson R, Franks S. Evidence for a single gene effect causing polycystic ovaries and male pattern baldness. Clin Endocrinol (Oxf) 1993;38:653–8. 15. Legro RS. The genetics of polycystic ovary syndrome. Am J Med 1995;98(1A):9S–16S. 16. Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, Norman RJ, et al. Thirty-seven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. Proc Natl Acad Sci U S A 1999;96:8573–8. 17. Waterworth DM, Bennett ST, Gharani N, McCarthy MI, Hague S, Batty S, et al. Linkage and association of insulin gene VNTR regulatory polymorphism with polycystic ovary syndrome. Lancet 1997;349:986 – 90. 18. Tucci S, Futterweit W, Gabrilove JL, Concepcion ES, Greenberg DA, Villanueva RB, et al. The insulin receptor gene region contains a gene for polycystic ovary syndrome. In: 82nd Annual Meeting of the Endocrine Society, Toronto, Canada, June 21–24, 2000. 19. Tucci S, Futterweit W, Concepcion ES, Greenberg DA, Villanueva R, Davies TF, et al. Evidence for association of polycystic ovary syndrome in Caucasian women with a marker at the insulin receptor gene locus. J Clin Endocrinol Metab 2001;86:446 –9. 20. Urbanek M, Legro RS, Driscoll D, Strauss JF, 3rd, Dunaif A, Spielman RS. Searching for the polycystic ovary syndrome genes. J Pediatr Endocrinol Metab 2000;13(Suppl 5):1311–3. 21. Talbot JA, Bicknell EJ, Rajkhowa M, Krook A, O’Rahilly S, Clayton RN. Molecular scanning of the insulin receptor gene in women with polycystic ovarian syndrome. J Clin Endocrinol Metab 1996;81:1979 – 83. 22. Sorbara LR, Tang Z, Cama A, Xia J, Schenker E, Kohanski RA, et al. Absence of insulin receptor gene mutations in three insulin-resistant women with the polycystic ovary syndrome. Metabolism 1994;43: 1568 –74. 23. Conway GS, Avey C, Rumsby G. The tyrosine kinase domain of the insulin receptor gene is normal in women with hyperinsulinaemia and polycystic ovary syndrome. Hum Reprod 1994;9:1681–3. 24. Robert Y, Ardaens Y, Dewailly D. Imaging polycystic ovaries in polycystic ovary syndrome. In: Kovacs GT, editor. Polycystic ovary syndrome. Cambridge (UK): Cambridge University Press, 2000:56 –69. 25. Yeh HC, Futterweit W, Thornton JC. Polycystic ovarian disease: US features in 104 patients. Radiology 1987;163:111–6. 26. Villanueva R, Inzerillo AM, Tomer Y, Barbesino G, Meltzer M, Concepcion ES, et al. Limited genetic susceptibility to severe Graves’ ophthalmopathy: no role for CTLA-4 but evidence for an environmental etiology. Thyroid 2000;10:791–8. 27. Holte J, Bergh T, Gennarelli G, Wide L. The independent effects of polycystic ovary syndrome and obesity on serum concentrations of gonadotrophins and sex steroids in premenopausal women. Clin Endocrinol (Oxf) 1994;41:473–81. 28. Taylor SI, Kadowaki T, Kadowaki H, Accili D, Cama A, McKeon C. Mutations in insulin-receptor gene in insulin-resistant patients. Diabetes Care 1990;13:257–79. 29. Moller DE, Yokota A, White MF, Pazianos AG, Flier JS. A naturally occurring mutation of insulin receptor alanine 1134 impairs tyrosine kinase function and is associated with dominantly inherited insulin resistance. J Biol Chem 1990;265:14979 –85. 30. Moller DE, Flier JS. Detection of an alteration in the insulin-receptor gene in a patient with insulin resistance, acanthosis nigricans, and the polycystic ovary syndrome (type A insulin resistance). N Engl J Med 1988;319:1526 –9.
1243