- Email: [email protected]
A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae
+
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63
RESMIC3338_proof ■ 5 October 2014 ■ 1/9
MODEL
Research in Microbiology xx (2014) 1e9 www.elsevier.com/locate/resmic
Original article
A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae Q2
Xian-Fei Zeng a,1, Yueyun Ma a,1, Liu Yang a, Lei Zhou a, Yijuan Xin a, Liang Chang a, Jing-Ren Zhang b, Xiaoke Hao a,* a
Department of Clinical Laboratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi'an 710032, China b Center for Infectious Disease Research, School of Medicine, Tsinghua University, Beijing 100017, China Received 15 May 2014; accepted 11 September 2014
Abstract LicC has been identified as a virulence factor of Streptococcus pneumoniae. However, its role in virulence is still not fully understood because deletion of licC is lethal for the bacterium. In this study, a mutant with 78-bp truncation at the C-terminus of licC was obtained from a signaturetagged mutagenesis (STM) library. The mutant was viable with a large reduction in enzymatic activity as CTP:phosphocholine cytidylyltransferase detected in vitro using a firefly luciferase assay. The mutation attenuated the adhesion and invasion of S. pneumoniae ST556 (serotype 19F) to epithelial cells by 72% and 80%, respectively, and increased the phagocytosis by macrophages for 16.5%, compared to the parental strain. When the mutation was introduced into the encapsulated D39 strain (serotype 2), it led to attenuated virulence in mouse models either by intranasal colonization or by intraperitoneal infection. In addition, the phosphocholine (PCho) on cell surface was decreased, and the choline binding proteins (CBPs) were impaired, which may explain the attenuated virulence of the mutant. These observations indicate that C-terminus of licC is accounted for the main activity of LicC in PCho metabolism and is essential for the virulence of S. pneumoniae, which provides a novel target for drug design against pneumococcal infection. © 2014 Published by Elsevier Masson SAS on behalf of Institut Pasteur.
Keywords: Phosphocholine cytidylyltransferase; Phosphocholine; Choline binding proteins; Virulence
1. Introduction The pneumococci are a unique group of prokaryotes due to their absolute nutritional requirement for choline. These
Abbreviations: STM, signature-tagged mutagenesis; PCho, phosphocholine; CBPs, choline binding proteins; TA, teichoic acid; LicC, CTP:phosphocholine cytidylyltransferase; TacF, teichoic acid flippase; SpCCT, Streptococcus pneumoniae CTP:phosphocholine cytidylyltransferase. * Corresponding author. Tel.: þ86 29 84775457; fax: þ86 29 82550450. E-mail addresses: [email protected] (X.-F. Zeng), cmbmayy@fmmu. edu.cn (Y. Ma), [email protected] (L. Yang), [email protected] (L. Zhou), [email protected] (Y. Xin), [email protected] (L. Chang), [email protected] (J.-R. Zhang), [email protected]. cn, [email protected] (X. Hao). 1 These authors contributed equally to this work.
bacteria take up choline from the growth environment and incorporate it into phosphocholine (PCho), which is universally present in cell-wall teichoic acid (TA) and membrane lipoteichoic acid (LTA) [39,12]. The integrated choline moieties are widely involved in the physiological function of the pneumococci. A deficiency in choline residues or the replacement of choline with ethanolamine has been shown to cause an inhibition in autolysis, blockage of natural transformation, interruption of cell separation [40], and attenuation of virulence [24]. It has been further demonstrated in the strains R6Cho [35,23] and R6Chip [9]. In addition, the PCho residues on cell wallemembrane complex are also believed as the anchoring sites for specific binding of choline binding proteins (CBPs), a family of surface virulent factors related to pneumococcal adhesion, colonization and invasion to host
http://dx.doi.org/10.1016/j.resmic.2014.09.002 0923-2508/© 2014 Published by Elsevier Masson SAS on behalf of Institut Pasteur. Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
RESMIC3338_proof ■ 5 October 2014 ■ 2/9
2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
cells [19]. This may be the major explanation for the role of choline moieties in pneumococcal virulence. The synthesis of PCho in pneumococci occurs primarily in the lic-encoded pathway [6,36] and requires the choline transport system (LicB) [44], choline kinase (LicA) [43], CTP:phosphocholine cytidylyltransferase (LicC) [6,33], choline phosphotransferase (LicD) [44], and a TA flippase (TacF) [9]. Streptococcus pneumoniae CTP:phosphocholine cytidylyltransferase (SpCCT), one of the key enzymes for PCho metabolism, possesses a high degree of selectivity for PCho and CTP. It catalyzes the transference of a cytidine monophosphate from CTP to PCho to form CDP-choline with the release of PPi [6,33,25]. CDP-choline is sequentially tied to the TA subunits on the cytoplasmic side of the membrane by LicD before they are transported across the cytoplasmic membrane by TacF. Although SpCCT has been crystallized and its mode of action was studied [6,33,25], a licC deletion strain has never been generated to explore the role of the lic system in the pneumococcal survival and virulence. The double mutants D39ChiplicC112 [9] and R6CholicC11 [24] exhibited a drastic reduction in virulence. However, these mutants were studied in a choline-free background, and thus it was not possible to exclude the effect of support from choline-free conditions. In this communication, we described a licC partially deleted mutant recovered from a signature-tagged mutagenesis (STM) screening that was performed with a S. pneumoniae ST556 strain (serotype 19F), a clinical isolate from an otitis media patient [7]. We also checked the essentiality of this truncation in SpCCT and virulence through activity measurements of truncated (DLicC) and full-length LicC using a novel bioluminescence assay and animal infection, respectively. Interestingly, the truncation of 78 bp at the C-terminus showed significant impact on PCho metabolism and pneumococcal virulence. The mutation was responsible for the decrease of PCho on pneumococcal surface and the consequently impaired CBPs attached to the cell wall in the mutant, which eventually resulted in the attenuated virulence of S . pneumoniae in both cellular and animal models. 2. Materials and methods 2.1. Bacterial strains and growth conditions Pneumococci were grown at 37 C in Todd-Hewitt broth supplemented with 5% (w/v) yeast extract (THY) or on tryptic soy agar (TSA) plates containing 3% (v/v) sheep blood in the presence or absence of the indicated antibiotics [26]. Escherichia coli cultures were grown in LuriaeBertani (LB) broth or on LB agar plates with the necessary antibiotics. All ingredients for bacterial culture media used in this work were obtained from Oxoid (Basingstoke, UK). 2.2. Generation of licC mutants The licC truncated mutant, named ST42A5, which lost a 78-bp segment from the C-terminus of licC, was recovered from a STM mutant library derived from the multi-drug resistant isolate ST556 [7].
A truncated licC mutation was introduced into encapsulated strain D39 of serotype 2 named D39DlicC, via homologous recombination, similarly as described previously [7,26]. It was more suitable to observe the virulence change caused by loss of the 78-bp fragment. Briefly, upstream and downstream fragments of the target sequence were amplified from D39 with primers Pr001/Pr002 and Pr003/Pr004, and used to generate the allelic exchange construct. To make the 78 bp replacement, a Janus cassette containing a kanamycinresistance gene and a dominant WT rpsLþ allele [37] was incorporated into the construct for direct selection of transformants. The cassette was amplified with primers Pr005/ Pr006 from genomic DNA of pneumococcal strain ST588 [26]. All of the primers used in the present study are listed in Table 1. The PCR products were digested and ligated, and the ligated product containing the antibiotic resistance cassette was used to transform D39, as previously described [3]. The mutant was confirmed by sequencing of the genomic DNA. 2.3. Cloning, expression and purification of SpCCT The licC (Gene ID: 4442550) and DlicC genes were amplified by PCR with primers Pr007/Pr008 and Pr007/Pr009 as shown in Table 1 using ST556 genomic DNA as template and High Fidelity Mix (TakaraBio, Ohtsu, Japan) as PCR reaction reagent. PCR products were purified using an extraction kit (Qiagen, Hilden, Germany) and ligated into the pQE80 plasmid following digestion with BamHI and HindIII. Competent E. coli DH5а cells were transformed with the ligation products, and transformants were plated onto LB agar containing 100 mg/mL of ampicillin. The cloned inserts were verified by enzymatic digestion and DNA sequencing, and the final plasmids were named pQE80::licC and pQE80::DlicC. E. coli BL21 competent cells were transformed with the resulting plasmids and cultured in 200 mL of LB broth containing 100 mg/mL of ampicillin at 37 C until the optical density at 600 nm (OD600) reached 0.4. Isopropyl b-D-thiogalactoside (IPTG) was then added to the cultures at a final concentration of 0.1 mM. The cultures were incubated for an additional 4 h with shaking (200 rpm) at 30 C. Cells were harvested by centrifugation at 2000 g for 20 min at 4 C, and the cell pellets were resuspended in Binding Buffer (GE healthcare, Buckinghamshire, United Kingdom) and disrupted by sonication on ice. The His-tagged recombinant proteins,
Table 1 Primers used in this study. Primers
Sequence (50 e30 )
Pr001 Pr002 Pr003 Pr004 Pr005 Pr006 Pr007 Pr008 Pr009
AGGCTACAGGCTTGAACGT ATTGGCGCGCCTAATTCTTCAACATAGACATCTAGCT ATTGGCCGGCCAGATTCCAACATCTGACAAAATA ACGACAAAGTCCAGCAATGA ATTGGCGCGCCACCGTTTGATTTTTAATGGATAATG ATTGGCCGGCCCCTTTCCTTATGCTTTTGGAC CGCGGATCCGTGAAAGCCATTATCTTAGCAGC CCCAAGCTTCCGACTATTTTGTCAGATGTTG CCCAAGCTTTAATTCTTCAACATAGACATCTAGCTC
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 3/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
LicC and DLicC, were purified using a Niþ sepharose Fast Flow column (GE healthcare, Buckinghamshire, United Kingdom) according to the manufacturer's instructions. Samples were then treated in a bag filter in filter buffer for 12 h to remove excess imidazole. Recombinant protein concentrations were determined via the absorbance at 280 nm using a protein quantitation kit (Bio-Rad Laboratories, Hercules, Canada). Western blot was carried out using an anti-His tag antibody to confirm protein expression. Finally, the proteins were stored in 20 mM TriseHCl plus 50% glycerol (pH 7.5) at 80 C for subsequent activity analysi s, as has been described previously [33]. 2.4. Enzymatic analysis of SpCCT The activity of LicC and DLicC was determined using a bioluminescence test based on the firefly luciferase assay system. Briefly, the generation velocity of PPi in the SpCCT reaction can be measured with a bioluminescence assay system to reflect the enzymatic activity. The reaction conditions for SpCCT activity, including the reaction time, pH, Mg2þ concentration, and reaction buffer, were optimized in an isotopic assay using phospho[methyl-14C]choline as substrate [6,25]. The enzymatic reaction was performed in a final volume of 50 mL that contained 10 mM MgCl2, 150 mM bis-TrisHCl (pH 8.0), and excess substrate (CTP and PCho). The reaction mixture was pre-warmed at 37 C followed by the addition of SpCCT at the start of the reaction. After incubating the mixture at 37 C for 2 min, 5 mL of 0.5 M EDTA was added to stop the reaction. The quantity of PPi generated in the SpCCT reaction was then immediately measured at room temperature (25 C) using the bioluminescence assay. To do this, a 10 mL aliquot of the reaction mixture was pipetted into a luminescence tube. Then 80 mL of TriseHCl buffer (pH 7.75), 10 mL of 2 mM adenosine phosphosulfate and 0.2 U ATP sulfurylase were added to a final volume of 100 mL. In this reaction system, PPi was transformed to ATP as was reflected in the integral luminous intensity in 10 s. Finally, the integral luminous intensity was measured immediately after addition of 100 mL of luminous solution. One unit (U) of SpCCT was defined as the enzymatic activity needed to produce 105 mmol of PPi in 1 min with 1 mg of enzyme. To further eliminate the assay background, several controls were analyzed: tube A contained LicC but not P-Cho or CTP; tube B contained DLicC but not P-Cho and CTP; tube C contained P-Cho and CTP but not proteins; and the blank control only contained deionized water. To obtain final values, the results from the corresponding control tubes were subtracted. All measurements, including the control tubes, were performed in duplicate. In addition, the dosage of LicC and DLicC were determined by the signal-to-noise ratio (S/N). The doses with the highest S/N were chosen as the optimal condition. 2.5. Pneumococcal growth curves The wild-types, D39 and ST556, and their licC mutants were cultured in 5 mL of THY to an OD620 of ~0.4 and then diluted in the pre-warmed THY to an optical density of ~0.01.
3
Next, the OD620 was detected every 30 min for 6 h to determine the growth curve. Each experiment was repeated three times to calculate the means and standard deviation (SD) of the OD620 readings. 2.6. Hydrocarbon adhesion assay Pneumococcal surface hydrophobicity was measured by bacterial adherence to hexadecane according to a previously described procedure [22]. ST556 and ST42A5 were grown in 5 mL of THY to an OD620 of ~0.4 (approximately mid-log phase). Cells were precipitated via centrifugation (2000 g for 5 min), washed twice in PBS (pH 7.0), and then resuspended in 1 mL of PBS. The OD620 was measured as a control (Co). Subsequently, 100 mL of hexadecane was added to the bacterial suspension and vortexed for 1 min. After the phases were allowed to separate, the OD620 of the lower aqueous phase was measured (CH). Bacterial adhesion to hydrocarbon was calculated as (Co CH) 100/Co (%). 2.7. Bacterial adhesion and invasion assay Cell adhesion assays were performed as previously described [34]. A549 cells cultured in F-12 media supplemented with 10% fetal bovine serum were grown to confluence in COSTAR 24-well polystyrene plates at 37 C with 5% CO2. Then the cell monolayers were exposed to 1 mL of media containing 2 107 colony forming units (CFU) per mL of bacteria (ST556 or ST42A5) diluted with pre-warmed cell culture medium. The mixture was incubated at 37 C for 1 h to allow bacterial adhesion, followed by three washes with sterile PBS (pH 7.4). Then pre-warmed 0.25% trypsin-0.02% EDTA was added to detach the cells, and ice-cold 0.025% Triton-X 100 was added to lyse the cells by thorough pipetting. Cell lysates were diluted in PBS and plated on blood agar plates. The number of adherent bacteria was determined by counting the bacterial colonies on plates incubated overnight. Each experiment was repeated more than three times with samples in triplicate. Adhesion was expressed as a percentage relative to the standard strain counterpart. Pneumococcal invasion to A549 cells was performed similarly as the adherence assay except that 20 mg/mL of ampicillin and 400 mg/mL of gentamicin were added into each well after A549 cells were exposed to bacteria for 1 h. After 1 h of incubation to kill the extracellular bacteria, excess antibiotics and extracellular bacteria were removed by gently washing the cells three times with PBS. Then the cells were lysed and the number of invasive bacteria was determined similarly as described in the adhesion assay. 2.8. Macrophage phagocytosis assay S. pneumoniae ST556 and ST42A5 were grown to OD620 of ~0.4, washed three times, and resuspended in sterile PBS to ~107/ml. The suspension of 1 ml was then incubated at 37 C for 30 min in the dark with 10 ml of a 2.0 mM solution of 5(6)Carboxyfluorescein diacetate N-succinimidyl ester (CFSE,
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 4/9
4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
SigmaeAldrich St. Louis, MO, USA) as described [41]. After labeling, pneumococci were washed three times with PBS to remove excess dye and then suspended in equal volume RPMI medium without antibiotics. The efficiency of CFSE-labeling was checked by flow cytometry to ensure the equal number of CFSE-bacteria between wild-type and mutant suspension used to interact with Raw264.7 cells. Raw264.7 cells (106/ml, 200 ml) were seeded and then incubated with CFSE-bacteria (107/ml, 200 ml) in COSTAR plates. After incubation for 1 h, cells were treated with 0.125% trypan blue for 5 min to quench the extracellular fluorescence, followed by washing for three times with PBS. The samples were transferred into FACS (Fluorescence Activated Cell Sorter) tubes and immediately detected by flow cytometry. The percentage of cells infected was determined as the ratio of the number of Raw264.7 cells containing one or more bacteria to the total number of cells examined [32].
Bacteria were collected by centrifugation. Pellets were washed 3 times with PBS, then resuspended in 200 mL of 2% (w/v) choline chloride, followed by shaking on a vortex mixer (Thermo Scientific) for 20 min [44]. The CBPs on pneumococcal surface were washed after this procedure. Then, 100 mL supernatants were taken, and mixed with 20 mL sample loading buffer. The mixture was incubated for 5 min at 100 C before loading onto a 10% (w/v) SDS-polyacrylamide gel. Proteins were transferred onto nitrocellulose membrane (Life Technology, Kiryat Shmora, Israel) by semidry blotting using an Invitrogen iBlot transfer unit. Western blot was performed as previously described [28] using a rabbit polyclonal antibody against pneumococcal CBPs (1:800). A LI-COR IRDye™ 800-labeled secondary antibody and Odyssey Infrared Imaging System (LI-COR Biosciences, Nebraska, USA) were used for signal detection.
2.9. Analysis of virulence in animal tests
2.12. Statistical analysis
All animal infection procedures were approved by the relevant Animal Ethics Committees. For intranasal (i.n.) infection, 5 female CD1 mice, 6-week-old, were challenged with approximately 1 107 CFU of the D39DlicC or wildtype strain administered in a 40-mL volume inoculated into a single nostril. The bacteria were recovered by nasal washing 3 days after infection and grown dilutions on TSA blood agar plates for 16 h to calculate the number of colonies and the Ratio (Ratio ¼ mutant CFU/wild-type CFU). For intraperitoneal (i.p.) infection studies, groups of 9 female CD1 mice, 6week-old, were anesthetized with 2% Avertin at 120 mL/10 g and then challenged with the following doses of each strain: approximately 3 103 CFU for the D39 group and 3 103 CFU or 3 105 CFU for the D39 DlicC group. Mouse survival was observed for 21 days.
Statistical analysis was performed using GraphPad Prism (GraphPad Software, La Jolla, CA). A Student t test was used to compare the means of mutant samples against the corresponding values of wild-type. Furthermore, differences in the overall survival rates between the groups were analyzed using the Log-rank test. A p-value of <0.05 was considered statistically significant.
2.10. PCho assessed by flow cytometry Wild-type D39 and its licC mutant were grown in THY broth to an OD620 of 0.4. Cells in culture of 500 mL were precipitated via centrifuged at 2000 g for 5 min, washed twice in PBS (pH 7.0), and then resuspended in 1 mL of PBS containing 1% bovine serum albumin (BSA). After 1 h incubation at room temperature, bacteria were incubated with a 1:200 dilution of the mouse anti-phosphorylcholine monoclonal antibody TEPC15 (IgA-k) (SigmaeAldrich, St. Louis, MO) [15] and then washed for 3 times with 1% BSA-PBS. Subsequently, pneumococcal cells were treated with the FITC-labeled anti-mouse IgA antibody (SigmaeAldrich, St. Louis, MO) for 1 h. After washing 3 times, the bacteria were detected by flow cytometry. The percentage of FITC positive bacteria in total bacteria counted and the FITC fluorescence intensity of equal numbers of bacteria between wild-type and mutant were recorded. 2.11. Western-blot analysis of CBPs For preparation of bacterial extracts, D39 wild-type and DlicC were grown in 5 mL THY medium to an OD620 of 0.4.
3. Results 3.1. Growth phenotypes of the licC mutant strain Choline is an essential nutrient for S. pneumoniae, and S. pneumoniae licC has been considered as an essential gene [24,9]. In this study, when bacteria were grown in THY broth, the truncated licC mutants in both D39 and ST556 genetic background displayed slower growth rate compared to the wild-type strains (Fig. 1A). The significant difference could be seen from 2.5 h between ST42A5 and wild-type ST556 ( p ¼ 0.009; n ¼ 3). From 3 h between D39DlicC and D39 ( p ¼ 0.024; n ¼ 3). Meanwhile, both the mutants exhibited longer chains compared to their parental strains in THY media at OD620 of both 0.1 and 0.5 (Fig. 1B). These results indicate that LicC plays an important role in pneumococcal growth, which is consistent with the essentiality of LicC. 3.2. Effect of licC mutation on pneumococcal adhesion and invasion to epithelial cells and phagocytosis by macrophages The hydrophobic activities of ST556 and ST42A5 were determined. ST42A5 exhibited a significant increase in hydrophobicity, which was two-fold higher than wild-type (Fig. 2B). The elevated hydrophobicity of the bacterial surface caused by the insertion mutation had a deleterious effect on the adherence of A549 epithelial cells. Compared with the wild-type strain, adhesion of ST42A5 was impaired by 70% (Fig. 2C), and invasion of ST42A5 to A549 cells was
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 5/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
5
the licC mutant infected mice displayed significantly increased median survival times compared to those infected with the parental strain (>21 days versus 48 h; p < 0.001; Fig. 4). All the mice challenged by D39DlicC (3 103 CFU/mouse) survived for the duration of the experiment (>21 days), while all D39 wild-type (3 103 CFU/mouse) infected mice succumbed within 72 h. When higher dose of D39DlicC (3 105 CFU/mouse) was used, there were still 78% of the mice survived at 96 h post infection, and these mice remained alive at the end of the experiment, which is 21 d post infection (Fig. 4). 3.5. The effect of licC mutation on cell surface PCho and CBPs
Fig. 1. Growth curves and morphology of the licC mutant strains. (A) Growth curves for the licC mutants in D39 and ST556. The OD620 of the bacteria culture was checked every half hour for 6 h. The data shown is a representative of three biological repeats. *p ¼ 0.009 (Student's t test; n ¼ 3) compared the OD620 of ST42A5 with that of ST556 wild-type. #p ¼ 0.024 (Student's t test; n ¼ 3) compared the OD620 of D39 DlicC with that of D39 wild-type. (B) Morphology of the licC mutants in D39 and ST556. The images were obtained under light microscope at 200.
attenuated by 80% (Fig. 2D). Additionally, the phagocytosis of the mutant strain by macrophage RAW264.7 was increased by 16.5% in comparison with that of wild-type ST556 (Fig. 2E). Together, our data indicate that LicC plays an essential role in interaction with the host cells. 3.3. Enzymatic analysis of SpCCT His-tagged LicC and DLicC were purified by Ninitrilotriacetic acid affinity chromatograph to concentrations of 1.25 and 0.65 mg/mL, respectively. Then 1 mg of each protein was used to determine the enzymatic activity. A standard curve to calculate SpCCT activity was graphed with the concentration of PPi as the horizontal axis and the integral luminous intensity at 10 s as the vertical axis. Our result showed that the activity of DLicC was only approximately 6% of compared to that of LicC in this assay (Fig. 3). This data indicates that the C-terminal 26 aa in LicC is critical for its SpCCT activity. 3.4. Virulence of the licC mutant The virulence of D39DlicC was investigated by challenging mice via i.n. and i.p. routes. Similar to the STM strain ST42A5 during middle ear infection, D39DlicC could not be recovered from nasal washes; however, 3.2 105 CFU/ml (n ¼ 5) pneumococci were recovered in nasal wash from the D39 infected group. In the i.p. challenge experiment, as expected,
The PCho on pneumococcal surface was analyzed by flow cytometry. The fluorescence intensity of pneumococcal cell can reflect the quantity of PCho on cell surface. The percentages of FITC-cells in total counted cells between D39 and D39DlicC had no statistically significant difference ( p ¼ 0.114; n ¼ 3; data not shown). However, the mutant bacteria exhibited lower mean fluorescence intensity ( p < 0.01; n ¼ 3), which is decreased by 56.4% compared to the wild-type (Fig. 5A). Furthermore, pneumococcal CBPs were analyzed using western blot (Fig. 5B). Our result showed that the 4 major CBPs in the mutant were either reduced or absent compared to those in the wild-type strain (Fig. 5A). This data indicates that the CBPs are either less expressed or more likely lost on pneumococcal surface in the mutant. 4. Discussion S. pneumoniae relies on a lic system to satisfy nutritional requirements and obtain active choline moieties for various physiological functions [14]. Several studies have demonstrated that the lic operons, including lic1 and lic2, are required for pneumococcal pathogenicity and growth by taking part in pneumococcal choline uptake, PCho metabolism and its transmembrane transportation [9,21,24,44]. As a key enzyme in the biosynthesis of pneumococcal PCho, LicC has been investigated for its role in virulence via two licC-deleted mutant strains constructed from choline-independent strains [9,23]. However, the influence of these two strains on pneumococcal virulence was based on choline-starvation and point mutation in tacF (D39ChiplicC112) or a complex origin including a heterologous genetic cross (R6CholicC11). A simple licC deletion mutant has never been constructed. In this study, we characterized a licC mutant obtained from an STM library and generated the same mutation in D39 via homologous recombination. Our results showed that the mutation in licC, 78 bp truncation at its 30 end (LEGNSIYE216ID218SVQDYRKLEEILKNEN), resulted in the alteration in pneumococcal growth and morphology, the decreased PCho on cell surface, the impaired CBPs bound to PCho, and accordingly the attenuation of pneumococcal virulence.
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 6/9
6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
Fig. 2. Infection of the licC mutant (ST42A5) in vitro using epithelial cell and macrophage cell lines. (A) The structure of the mutant licC gene. The fragment of 78 bp, which is deleted in the mutant, is indicated in the wild-type. (B) Hydrophobicity analysis of the licC mutant with the wild-type as a control. *p < 0.001 (Student's t test; n ¼ 4) compared with control. (C) Adhesion of ST556 was analyzed, and the mean and standard error were calculated from four independent experiments. xp < 0.001 (Student's t test; n ¼ 4) compared with wild-type. (D) The invasive ability of ST556 was analyzed, and the mean and standard error were calculated from four independent experiments. #p < 0.001 (Student's t test; n ¼ 4) compared with wild-type. (E) Levels of phagocytosis by Raw264.7 cells were shown. ##p < 0.02 (Student's t test; n ¼ 3) compared with wild-type ST556.
The crystal structure of LicC suggested that Glu216 plays an important role in enzymatic reactions catalyzed by LicC [25]. First, this residue is a part of the LicC's active site, and it is also conserved in most NTP transferase family members, with the exception of GlmU and E. coli methylerythritol-4phosphate cytidylyltransferase. Second, breaking the Glu216$Arg129 salt bridge, driven by the multivalent coordination of Mg2þ, is a trigger for the subsequent cascade. Our data
demonstrated that the activity of DLicC, which happened to miss Glu216, is markedly decreased. Using a firefly luciferasebased bioluminometric assay to detect the generation of PPi, we found the activity of DLicC is only approximately 6% of wild-type LicC (Fig. 3). These observations indicate that the truncated sequence is a key functional site for SpCCT. Meanwhile, the residual SpCCT activity of DLicC is enough to allow the mutant to be viable in vitro, but not to full
Fig. 3. Measurement of SpCCT activity for recombinant LicC and DLicC. (A) Assay optimization of recombinant proteins for different reaction dosages. The rate of signal-to-noise (S/N) was the highest at 1.0 mg of the individual protein for both the LicC and DLicC reactive systems. Data shown are the means of three biological repeat experiments. The error bars denote SD. (B) Comparison of the enzymatic activity between LicC and DLicC (#p < 0.001; Student's t test) in three independent experiments. Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 7/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
Fig. 4. Virulence of the licC mutant in a mouse infection model. Mice were challenged with approximately 3 103 and 3 105 CFU of D39DlicC intraperitoneally. Wild-type D39 at 3 103 CFU was used as control. The survival of mice were monitored every 12 h for 21 d. After 96 h post infection, all the survived mice remained alive at the end of the experiment. Therefore, only the result within 96 h was shown. The survival of the mutants was significantly greater ( p < 0.001 in log-rank tests) than that of the wild-type.
virulence in vivo, which was indicated by the results of the growth curves and the animal experiment. The low activity (6% of wild-type) of the mutant leads to the decreased production of choline-containing TA precursor [9,36,33] and the accumulation of choline-free TA subunits [9], which cannot be transported to the outer layer of the cytoplasmic membrane by TacF flippase [9]. The latter could disrupt the membrane integrity, trap the undecaprenyl phosphate transport lipid and consequently inhibit the growth of mutants [11,9]. Considering the important role of cell growth in physiological functions [27], we propose that the slower growth, which may restrict the expression of virulent factor, cripple the resistance to host immune response or suppress the cell wall biosynthesis, is one of the reason for the impaired pathogenicity of the licC mutants. Previous studies have demonstrated that PCho is involved in the process of pneumococcal infection [12,31], including adhesion and invasion. PCho residues provide a niche for the anchor of CBPs, a family of surface proteins that noncovalently bind to phosphorylcholine moieties in the cell wall and mediate bacterial attachment and colonization to the host
7
cell [18,13]. Furthermore, pneumococci can transmit the lung epithelium as well as the endothelium of the bloodebrain barrier through an interaction between phosphorylcholine on the bacterial surface and platelet activating factor receptor (PAFR) [38]. These observations are further supported by studies that demonstrated the modulation or deletion of PCho expression in Haemophilus influenzae or the pneumococci resulted in significant decrease of adherence and invasion [30,13]. In our study, phenotypic changes for the licC mutant, which include slower growth velocity (Fig. 1A), long-chain morphology (Fig. 1B), and attenuated virulence (Figs. 2 and 4), are consistent with the key role of LicC in the pathway for the addition of PCho to TA. The decreased PCho components on pneumococcal surface were also found by the loss of the 78-bp fragment in licC (Fig. 5A). Importantly, because of damage of their binding-sites to cell wall surface, the CBPs being partially responsible for pneumococcal pathogenicity are significantly impaired (Fig. 5B), which may be the linchpin of relationship between LicC and pneumococcal virulence. Long chain formation was noted in both ST42A5 and D39DlicC. It had been suggested to be important in pathogenesis because it increases the susceptibility to the host immune response mainly by complement mediated immunity and phagocytosis [8]. Also the morphologic change was reported in the pneumococcal mutants of lytA [8], lytB [29], tacF [17], and lic locus that containing licA, licB, and licC [24]. Accordingly, it was assumed that long chain formation was resulted from the incomplete cleavage of peptidoglycan between daughter cells following cell division when key enzymes like LytA or LytB for daughter cell separation were disrupted [8,29]. But when choline metabolism was interfered from genetic mutation of lic locus, or choline deprived condition [5,4,16], similar phenotypes have also been observed. This effect is probably due to the release or inhibition of either LytA or LytB, each as one of the CBPs with endo-b-N-acetylglucosaminidase activity [19,1]. The decreased virulence and enhanced phagocytosis are the common results from the elongated chain of S. pneumoniae, these phenomena were also observed in this study (Figs. 2 and 4). It was suggested that
Fig. 5. Pneumococcal PCho and CBPs analysis. (A) Comparison of fluorescence intensity between D39 and D39DlicC in PCho determined by using flow cytometry (#p < 0.01; Student's t test; n ¼ 3). The mean fluorescence intensity in D39 cells was defined as 100%. (B) Detection of CBPs on pneumococcal surface by western blotting analysis. Four proteins were clearly down-regulated or lost in the mutant are indicated with arrows. Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 8/9
8
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
1 long chain formation enhanced susceptibility to opsonopha2 gocytosis (OPH) killing and uptake by human neutrophils, and 3 promoted C3 complement deposition on pneumococci [8]. 4 Herein we deeply demonstrate that it may be caused by the 5 losing of CBPs (Fig. 5B). Several CBPs have been implicated 6 in virulence, such as PcpA, PspA and PspC (also named 7 CbpA, SpsA, PbcA, and Hic) [2,20,42], in which, CbpA binds 8 9 to factor H, thus avoiding C3 complement activation and 10 phagocytosis [10,26]. Finally, we propose that both of the 11 changes of cell morphology and impaired CBPs on cell sur12 face were caused by loss of PCho, then lead to the increased 13 the susceptibility to the host immune response and the reduced 14 abilities to infect host of licC mutant. 15 This study demonstrated that the C-terminus of licC was 16 17 essential for the main activity of LicC in PCho metabolism and 18 the virulence of S. pneumoniae. Our results provide insight a 19 novel target for drug design against pneumococcal infection. 20 21 Conflict of interest statement 22 23 There are no conflicts of interest regarding the publication 24 25 of this article. 26 27 Acknowledgment 28 29 This work was supported by a grant from the National 30 Natural Science Foundation of China (30873074). 31 32 33 References 34 35 [1] Bai XH, Chen HJ, Jiang YL, Wen Z, Huang Y, Cheng W, et al. 36 Structure of pneumococcal peptidoglycan hydrolase LytB reveals in37 sights into the bacterial cell wall remodeling and pathogenesis. J Biol 38 Q1 Chem 2014. 39 [2] Bergmann S, Hammerschmidt S. Versatility of pneumococcal surface 40 proteins. Microbiology 2006;152:295e303. 41 [3] Bricker AL, Camilli A. Transformation of a type 4 encapsulated strain of Streptococcus pneumoniae. FEMS Microbiol Lett 1999;172:131e5. 42 [4] Briese T, Hakenbeck R. Interaction between choline and the N-acetyl43 muramyl-L-alanine-amidase of Streptococcus pneumoniae, the target of 44 penicillin. Berlin: Walter de Gruyter; 1983. p. 173e8. 45 [5] Briese T, Hakenbeck R. Interaction of the pneumococcal amidase with 46 lipoteichoic acid and choline. Eur J Biochem 1985;146:417e27. 47 [6] Campbell HA, Kent C. The CTP:phosphocholine cytidylyltransferase 48 encoded by the licC gene of Streptococcus pneumoniae: cloning, 49 expression, purification, and characterization. Biochim Biophys Acta 50 2001;1534:85e95. 51 [7] Chen H, Ma Y, Yang J, O'Brien CJ, Lee SL, Mazurkiewicz JE, et al. 52 Genetic requirement for pneumococcal ear infection. PLoS One 53 2008;3:e2950. 54 [8] Dalia AB, Weiser JN. Minimization of bacterial size allows for com55 plement evasion and is overcome by the agglutinating effect of antibody. 56 Cell Host Microbe 2011;10:486e96. 57 [9] Damjanovic M, Kharat AS, Eberhardt A, Tomasz A, Vollmer W. The 58 essential tacF gene is responsible for the choline-dependent growth 59 phenotype of Streptococcus pneumoniae. J Bacteriol 2007;189:7105e11. 60 [10] Duthy TG, Ormsby RJ, Giannakis E, Ogunniyi AD, Stroeher UH, 61 Paton JC, et al. The human complement regulator factor H binds pneumococcal surface protein PspC via short consensus repeats 13 to 15. 62 Infect Immun 2002;70:5604e11. 63 [11] Fischer H, Tomasz A. Peptidoglycan cross-linking and teichoic acid 64 attachment in Streptococcus pneumoniae. J Bacteriol 1985;163:46e54. 65
[12] Fischer W. Phosphocholine of pneumococcal teichoic acids: role in bacterial physiology and pneumococcal infection. Res Microbiol 2000;151:421e7. [13] Gehre F, Spisek R, Kharat AS, Matthews P, Kukreja A, Anthony RM, et al. Role of teichoic acid choline moieties in the virulence of Streptococcus pneumoniae. Infect Immun 2009;77:2824e31. [14] Geiger O, Lopez-Lara IM, Sohlenkamp C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim Biophys Acta 2013;1831:503e13. [15] Gerber J, Redlich S, Ribes S, Tauber SC, Schmidt H, Nau R. Intrathecal treatment with the anti-phosphorylcholine monoclonal antibody TEPC15 decreases neuronal damage in experimental pneumococcal meningitis. Chemotherapy 2012;58:212e6. [16] Giudicelli S, Tomasz A. Attachment of pneumococcal autolysin to wall teichoic acids, an essential step in enzymatic wall degradation. J Bacteriol 1984;158:1188e90. [17] Gonzalez A, Llull D, Morales M, Garcia P, Garcia E. Mutations in the tacF gene of clinical strains and laboratory transformants of Streptococcus pneumoniae: impact on choline auxotrophy and growth rate. J Bacteriol 2008;190:4129e38. [18] Gosink KK, Mann ER, Guglielmo C, Tuomanen EI, Masure HR. Role of novel choline binding proteins in virulence of Streptococcus pneumoniae. Infect Immun 2000;68:5690e5. [19] Hakenbeck R, Madhour A, Denapaite D, Bruckner R. Versatility of choline metabolism and choline-binding proteins in Streptococcus pneumoniae and commensal streptococci. FEMS Microbiol Rev 2009;33:572e86. [20] Hammerschmidt S, Agarwal V, Kunert A, Haelbich S, Skerka C, Zipfel PF. The host immune regulator factor H interacts via two contact sites with the PspC protein of Streptococcus pneumoniae and mediates adhesion to host epithelial cells. J Immunol 2007;178:5848e58. [21] Humphries HE, High NJ. The role of licA phase variation in the pathogenesis of invasive disease by Haemophilus influenzae type b. FEMS Immunol Med Microbiol 2002;34:221e30. [22] Joshi LT, Phillips DS, Williams CF, Alyousef A, Baillie L. Contribution of spores to the ability of Clostridium difficile to adhere to surfaces. Appl Environ Microbiol 2012;78:7671e9. [23] Kharat AS, Denapaite D, Gehre F, Bruckner R, Vollmer W, Hakenbeck R, et al. Different pathways of choline metabolism in two choline-independent strains of Streptococcus pneumoniae and their impact on virulence. J Bacteriol 2008;190:5907e14. [24] Kharat AS, Tomasz A. Drastic reduction in the virulence of Streptococcus pneumoniae expressing type 2 capsular polysaccharide but lacking choline residues in the cell wall. Mol Microbiol 2006;60:93e107. [25] Kwak BY, Zhang YM, Yun M, Heath RJ, Rock CO, Jackowski S, et al. Structure and mechanism of CTP:phosphocholine cytidylyltransferase (LicC) from Streptococcus pneumoniae. J Biol Chem 2002;277:4343e50. [26] Lu L, Ma Y, Zhang JR. Streptococcus pneumoniae recruits complement factor H through the amino terminus of CbpA. J Biol Chem 2006;281:15464e74. [27] Massidda O, Novakova L, Vollmer W. From models to pathogens: how much have we learned about Streptococcus pneumoniae cell division? Environ Microbiol 2013;15:3133e57. [28] Morrison DA, Mortier-Barriere I, Attaiech L, Claverys JP. Identification of the major protein component of the pneumococcal eclipse complex. J Bacteriol 2007;189:6497e500. [29] Moscoso M, Obregon V, Lopez R, Garcia JL, Garcia E. Allelic variation of polymorphic locus lytB, encoding a choline-binding protein, from streptococci of the mitis group. Appl Environ Microbiol 2005;71:8706e13. [30] Pang B, Winn D, Johnson R, Hong W, West-Barnette S, Kock N, et al. Lipooligosaccharides containing phosphorylcholine delay pulmonary clearance of nontypeable Haemophilus influenzae. Infect Immun 2008;76:2037e43. [31] Percy MG, Grundling A. Lipoteichoic acid synthesis and function in Gram-positive bacteria. Annu Rev Microbiol 2014. [32] Ricci S, Gerlini A, Pammolli A, Chiavolini D, Braione V, Tripodi SA, et al. Contribution of different pneumococcal virulence factors to experimental meningitis in mice. BMC Infect Dis 2013;13:444.
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 9/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
[33] Rock CO, Heath RJ, Park HW, Jackowski S. The licC gene of Streptococcus pneumoniae encodes a CTP:phosphocholine cytidylyltransferase. J Bacteriol 2001;183:4927e31. [34] Rose L, Shivshankar P, Hinojosa E, Rodriguez A, Sanchez CJ, Orihuela CJ. Antibodies against PsrP, a novel Streptococcus pneumoniae adhesin, block adhesion and protect mice against pneumococcal challenge. J Infect Dis 2008;198:375e83. [35] Severin A, Horne D, Tomasz A. Autolysis and cell wall degradation in a choline-independent strain of Streptococcus pneumoniae. Microb Drug Resist 1997;3:391e400. [36] Sohlenkamp C, Lopez-Lara IM, Geiger O. Biosynthesis of phosphatidylcholine in bacteria. Prog Lipid Res 2003;42:115e62. [37] Sung CK, Li H, Claverys JP, Morrison DA. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl Environ Microbiol 2001;67:5190e6. [38] Thornton JA, Durick-Eder K, Tuomanen EI. Pneumococcal pathogenesis: “innate invasion” yet organ-specific damage. J Mol Med (Berl) 2010;88:103e7.
9
[39] Tomasz A. Choline in the cell wall of a bacterium: novel type of polymer-linked choline in Pneumococcus. Science 1967;157:694e7. [40] Tomasz A. Biological consequences of the replacement of choline by ethanolamine in the cell wall of Pneumococcus: chanin formation, loss of transformability, and loss of autolysis. Proc Natl Acad Sci U S A 1968;59:86e93. [41] Vander Top EA, Perry GA, Gentry-Nielsen MJ. A novel flow cytometric assay for measurement of in vivo pulmonary neutrophil phagocytosis. BMC Microbiol 2006;6:61. [42] Vollmer W, Joris B, Charlier P, Foster S. Bacterial peptidoglycan (murein) hydrolases. FEMS Microbiol Rev 2008;32:259e86. [43] Whiting GC, Gillespie SH. Incorporation of choline into Streptococcus pneumoniae cell wall antigens: evidence for choline kinase activity. FEMS Microbiol Lett 1996;138:141e5. [44] Zhang JR, Idanpaan-Heikkila I, Fischer W, Tuomanen EI. Pneumococcal licD2 gene is involved in phosphorylcholine metabolism. Mol Microbiol 1999;31:1477e88.
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63
RESMIC3338_proof ■ 5 October 2014 ■ 1/9
MODEL
Research in Microbiology xx (2014) 1e9 www.elsevier.com/locate/resmic
Original article
A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae Q2
Xian-Fei Zeng a,1, Yueyun Ma a,1, Liu Yang a, Lei Zhou a, Yijuan Xin a, Liang Chang a, Jing-Ren Zhang b, Xiaoke Hao a,* a
Department of Clinical Laboratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi'an 710032, China b Center for Infectious Disease Research, School of Medicine, Tsinghua University, Beijing 100017, China Received 15 May 2014; accepted 11 September 2014
Abstract LicC has been identified as a virulence factor of Streptococcus pneumoniae. However, its role in virulence is still not fully understood because deletion of licC is lethal for the bacterium. In this study, a mutant with 78-bp truncation at the C-terminus of licC was obtained from a signaturetagged mutagenesis (STM) library. The mutant was viable with a large reduction in enzymatic activity as CTP:phosphocholine cytidylyltransferase detected in vitro using a firefly luciferase assay. The mutation attenuated the adhesion and invasion of S. pneumoniae ST556 (serotype 19F) to epithelial cells by 72% and 80%, respectively, and increased the phagocytosis by macrophages for 16.5%, compared to the parental strain. When the mutation was introduced into the encapsulated D39 strain (serotype 2), it led to attenuated virulence in mouse models either by intranasal colonization or by intraperitoneal infection. In addition, the phosphocholine (PCho) on cell surface was decreased, and the choline binding proteins (CBPs) were impaired, which may explain the attenuated virulence of the mutant. These observations indicate that C-terminus of licC is accounted for the main activity of LicC in PCho metabolism and is essential for the virulence of S. pneumoniae, which provides a novel target for drug design against pneumococcal infection. © 2014 Published by Elsevier Masson SAS on behalf of Institut Pasteur.
Keywords: Phosphocholine cytidylyltransferase; Phosphocholine; Choline binding proteins; Virulence
1. Introduction The pneumococci are a unique group of prokaryotes due to their absolute nutritional requirement for choline. These
Abbreviations: STM, signature-tagged mutagenesis; PCho, phosphocholine; CBPs, choline binding proteins; TA, teichoic acid; LicC, CTP:phosphocholine cytidylyltransferase; TacF, teichoic acid flippase; SpCCT, Streptococcus pneumoniae CTP:phosphocholine cytidylyltransferase. * Corresponding author. Tel.: þ86 29 84775457; fax: þ86 29 82550450. E-mail addresses: [email protected] (X.-F. Zeng), cmbmayy@fmmu. edu.cn (Y. Ma), [email protected] (L. Yang), [email protected] (L. Zhou), [email protected] (Y. Xin), [email protected] (L. Chang), [email protected] (J.-R. Zhang), [email protected]. cn, [email protected] (X. Hao). 1 These authors contributed equally to this work.
bacteria take up choline from the growth environment and incorporate it into phosphocholine (PCho), which is universally present in cell-wall teichoic acid (TA) and membrane lipoteichoic acid (LTA) [39,12]. The integrated choline moieties are widely involved in the physiological function of the pneumococci. A deficiency in choline residues or the replacement of choline with ethanolamine has been shown to cause an inhibition in autolysis, blockage of natural transformation, interruption of cell separation [40], and attenuation of virulence [24]. It has been further demonstrated in the strains R6Cho [35,23] and R6Chip [9]. In addition, the PCho residues on cell wallemembrane complex are also believed as the anchoring sites for specific binding of choline binding proteins (CBPs), a family of surface virulent factors related to pneumococcal adhesion, colonization and invasion to host
http://dx.doi.org/10.1016/j.resmic.2014.09.002 0923-2508/© 2014 Published by Elsevier Masson SAS on behalf of Institut Pasteur. Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
RESMIC3338_proof ■ 5 October 2014 ■ 2/9
2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
cells [19]. This may be the major explanation for the role of choline moieties in pneumococcal virulence. The synthesis of PCho in pneumococci occurs primarily in the lic-encoded pathway [6,36] and requires the choline transport system (LicB) [44], choline kinase (LicA) [43], CTP:phosphocholine cytidylyltransferase (LicC) [6,33], choline phosphotransferase (LicD) [44], and a TA flippase (TacF) [9]. Streptococcus pneumoniae CTP:phosphocholine cytidylyltransferase (SpCCT), one of the key enzymes for PCho metabolism, possesses a high degree of selectivity for PCho and CTP. It catalyzes the transference of a cytidine monophosphate from CTP to PCho to form CDP-choline with the release of PPi [6,33,25]. CDP-choline is sequentially tied to the TA subunits on the cytoplasmic side of the membrane by LicD before they are transported across the cytoplasmic membrane by TacF. Although SpCCT has been crystallized and its mode of action was studied [6,33,25], a licC deletion strain has never been generated to explore the role of the lic system in the pneumococcal survival and virulence. The double mutants D39ChiplicC112 [9] and R6CholicC11 [24] exhibited a drastic reduction in virulence. However, these mutants were studied in a choline-free background, and thus it was not possible to exclude the effect of support from choline-free conditions. In this communication, we described a licC partially deleted mutant recovered from a signature-tagged mutagenesis (STM) screening that was performed with a S. pneumoniae ST556 strain (serotype 19F), a clinical isolate from an otitis media patient [7]. We also checked the essentiality of this truncation in SpCCT and virulence through activity measurements of truncated (DLicC) and full-length LicC using a novel bioluminescence assay and animal infection, respectively. Interestingly, the truncation of 78 bp at the C-terminus showed significant impact on PCho metabolism and pneumococcal virulence. The mutation was responsible for the decrease of PCho on pneumococcal surface and the consequently impaired CBPs attached to the cell wall in the mutant, which eventually resulted in the attenuated virulence of S . pneumoniae in both cellular and animal models. 2. Materials and methods 2.1. Bacterial strains and growth conditions Pneumococci were grown at 37 C in Todd-Hewitt broth supplemented with 5% (w/v) yeast extract (THY) or on tryptic soy agar (TSA) plates containing 3% (v/v) sheep blood in the presence or absence of the indicated antibiotics [26]. Escherichia coli cultures were grown in LuriaeBertani (LB) broth or on LB agar plates with the necessary antibiotics. All ingredients for bacterial culture media used in this work were obtained from Oxoid (Basingstoke, UK). 2.2. Generation of licC mutants The licC truncated mutant, named ST42A5, which lost a 78-bp segment from the C-terminus of licC, was recovered from a STM mutant library derived from the multi-drug resistant isolate ST556 [7].
A truncated licC mutation was introduced into encapsulated strain D39 of serotype 2 named D39DlicC, via homologous recombination, similarly as described previously [7,26]. It was more suitable to observe the virulence change caused by loss of the 78-bp fragment. Briefly, upstream and downstream fragments of the target sequence were amplified from D39 with primers Pr001/Pr002 and Pr003/Pr004, and used to generate the allelic exchange construct. To make the 78 bp replacement, a Janus cassette containing a kanamycinresistance gene and a dominant WT rpsLþ allele [37] was incorporated into the construct for direct selection of transformants. The cassette was amplified with primers Pr005/ Pr006 from genomic DNA of pneumococcal strain ST588 [26]. All of the primers used in the present study are listed in Table 1. The PCR products were digested and ligated, and the ligated product containing the antibiotic resistance cassette was used to transform D39, as previously described [3]. The mutant was confirmed by sequencing of the genomic DNA. 2.3. Cloning, expression and purification of SpCCT The licC (Gene ID: 4442550) and DlicC genes were amplified by PCR with primers Pr007/Pr008 and Pr007/Pr009 as shown in Table 1 using ST556 genomic DNA as template and High Fidelity Mix (TakaraBio, Ohtsu, Japan) as PCR reaction reagent. PCR products were purified using an extraction kit (Qiagen, Hilden, Germany) and ligated into the pQE80 plasmid following digestion with BamHI and HindIII. Competent E. coli DH5а cells were transformed with the ligation products, and transformants were plated onto LB agar containing 100 mg/mL of ampicillin. The cloned inserts were verified by enzymatic digestion and DNA sequencing, and the final plasmids were named pQE80::licC and pQE80::DlicC. E. coli BL21 competent cells were transformed with the resulting plasmids and cultured in 200 mL of LB broth containing 100 mg/mL of ampicillin at 37 C until the optical density at 600 nm (OD600) reached 0.4. Isopropyl b-D-thiogalactoside (IPTG) was then added to the cultures at a final concentration of 0.1 mM. The cultures were incubated for an additional 4 h with shaking (200 rpm) at 30 C. Cells were harvested by centrifugation at 2000 g for 20 min at 4 C, and the cell pellets were resuspended in Binding Buffer (GE healthcare, Buckinghamshire, United Kingdom) and disrupted by sonication on ice. The His-tagged recombinant proteins,
Table 1 Primers used in this study. Primers
Sequence (50 e30 )
Pr001 Pr002 Pr003 Pr004 Pr005 Pr006 Pr007 Pr008 Pr009
AGGCTACAGGCTTGAACGT ATTGGCGCGCCTAATTCTTCAACATAGACATCTAGCT ATTGGCCGGCCAGATTCCAACATCTGACAAAATA ACGACAAAGTCCAGCAATGA ATTGGCGCGCCACCGTTTGATTTTTAATGGATAATG ATTGGCCGGCCCCTTTCCTTATGCTTTTGGAC CGCGGATCCGTGAAAGCCATTATCTTAGCAGC CCCAAGCTTCCGACTATTTTGTCAGATGTTG CCCAAGCTTTAATTCTTCAACATAGACATCTAGCTC
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 3/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
LicC and DLicC, were purified using a Niþ sepharose Fast Flow column (GE healthcare, Buckinghamshire, United Kingdom) according to the manufacturer's instructions. Samples were then treated in a bag filter in filter buffer for 12 h to remove excess imidazole. Recombinant protein concentrations were determined via the absorbance at 280 nm using a protein quantitation kit (Bio-Rad Laboratories, Hercules, Canada). Western blot was carried out using an anti-His tag antibody to confirm protein expression. Finally, the proteins were stored in 20 mM TriseHCl plus 50% glycerol (pH 7.5) at 80 C for subsequent activity analysi s, as has been described previously [33]. 2.4. Enzymatic analysis of SpCCT The activity of LicC and DLicC was determined using a bioluminescence test based on the firefly luciferase assay system. Briefly, the generation velocity of PPi in the SpCCT reaction can be measured with a bioluminescence assay system to reflect the enzymatic activity. The reaction conditions for SpCCT activity, including the reaction time, pH, Mg2þ concentration, and reaction buffer, were optimized in an isotopic assay using phospho[methyl-14C]choline as substrate [6,25]. The enzymatic reaction was performed in a final volume of 50 mL that contained 10 mM MgCl2, 150 mM bis-TrisHCl (pH 8.0), and excess substrate (CTP and PCho). The reaction mixture was pre-warmed at 37 C followed by the addition of SpCCT at the start of the reaction. After incubating the mixture at 37 C for 2 min, 5 mL of 0.5 M EDTA was added to stop the reaction. The quantity of PPi generated in the SpCCT reaction was then immediately measured at room temperature (25 C) using the bioluminescence assay. To do this, a 10 mL aliquot of the reaction mixture was pipetted into a luminescence tube. Then 80 mL of TriseHCl buffer (pH 7.75), 10 mL of 2 mM adenosine phosphosulfate and 0.2 U ATP sulfurylase were added to a final volume of 100 mL. In this reaction system, PPi was transformed to ATP as was reflected in the integral luminous intensity in 10 s. Finally, the integral luminous intensity was measured immediately after addition of 100 mL of luminous solution. One unit (U) of SpCCT was defined as the enzymatic activity needed to produce 105 mmol of PPi in 1 min with 1 mg of enzyme. To further eliminate the assay background, several controls were analyzed: tube A contained LicC but not P-Cho or CTP; tube B contained DLicC but not P-Cho and CTP; tube C contained P-Cho and CTP but not proteins; and the blank control only contained deionized water. To obtain final values, the results from the corresponding control tubes were subtracted. All measurements, including the control tubes, were performed in duplicate. In addition, the dosage of LicC and DLicC were determined by the signal-to-noise ratio (S/N). The doses with the highest S/N were chosen as the optimal condition. 2.5. Pneumococcal growth curves The wild-types, D39 and ST556, and their licC mutants were cultured in 5 mL of THY to an OD620 of ~0.4 and then diluted in the pre-warmed THY to an optical density of ~0.01.
3
Next, the OD620 was detected every 30 min for 6 h to determine the growth curve. Each experiment was repeated three times to calculate the means and standard deviation (SD) of the OD620 readings. 2.6. Hydrocarbon adhesion assay Pneumococcal surface hydrophobicity was measured by bacterial adherence to hexadecane according to a previously described procedure [22]. ST556 and ST42A5 were grown in 5 mL of THY to an OD620 of ~0.4 (approximately mid-log phase). Cells were precipitated via centrifugation (2000 g for 5 min), washed twice in PBS (pH 7.0), and then resuspended in 1 mL of PBS. The OD620 was measured as a control (Co). Subsequently, 100 mL of hexadecane was added to the bacterial suspension and vortexed for 1 min. After the phases were allowed to separate, the OD620 of the lower aqueous phase was measured (CH). Bacterial adhesion to hydrocarbon was calculated as (Co CH) 100/Co (%). 2.7. Bacterial adhesion and invasion assay Cell adhesion assays were performed as previously described [34]. A549 cells cultured in F-12 media supplemented with 10% fetal bovine serum were grown to confluence in COSTAR 24-well polystyrene plates at 37 C with 5% CO2. Then the cell monolayers were exposed to 1 mL of media containing 2 107 colony forming units (CFU) per mL of bacteria (ST556 or ST42A5) diluted with pre-warmed cell culture medium. The mixture was incubated at 37 C for 1 h to allow bacterial adhesion, followed by three washes with sterile PBS (pH 7.4). Then pre-warmed 0.25% trypsin-0.02% EDTA was added to detach the cells, and ice-cold 0.025% Triton-X 100 was added to lyse the cells by thorough pipetting. Cell lysates were diluted in PBS and plated on blood agar plates. The number of adherent bacteria was determined by counting the bacterial colonies on plates incubated overnight. Each experiment was repeated more than three times with samples in triplicate. Adhesion was expressed as a percentage relative to the standard strain counterpart. Pneumococcal invasion to A549 cells was performed similarly as the adherence assay except that 20 mg/mL of ampicillin and 400 mg/mL of gentamicin were added into each well after A549 cells were exposed to bacteria for 1 h. After 1 h of incubation to kill the extracellular bacteria, excess antibiotics and extracellular bacteria were removed by gently washing the cells three times with PBS. Then the cells were lysed and the number of invasive bacteria was determined similarly as described in the adhesion assay. 2.8. Macrophage phagocytosis assay S. pneumoniae ST556 and ST42A5 were grown to OD620 of ~0.4, washed three times, and resuspended in sterile PBS to ~107/ml. The suspension of 1 ml was then incubated at 37 C for 30 min in the dark with 10 ml of a 2.0 mM solution of 5(6)Carboxyfluorescein diacetate N-succinimidyl ester (CFSE,
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 4/9
4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
SigmaeAldrich St. Louis, MO, USA) as described [41]. After labeling, pneumococci were washed three times with PBS to remove excess dye and then suspended in equal volume RPMI medium without antibiotics. The efficiency of CFSE-labeling was checked by flow cytometry to ensure the equal number of CFSE-bacteria between wild-type and mutant suspension used to interact with Raw264.7 cells. Raw264.7 cells (106/ml, 200 ml) were seeded and then incubated with CFSE-bacteria (107/ml, 200 ml) in COSTAR plates. After incubation for 1 h, cells were treated with 0.125% trypan blue for 5 min to quench the extracellular fluorescence, followed by washing for three times with PBS. The samples were transferred into FACS (Fluorescence Activated Cell Sorter) tubes and immediately detected by flow cytometry. The percentage of cells infected was determined as the ratio of the number of Raw264.7 cells containing one or more bacteria to the total number of cells examined [32].
Bacteria were collected by centrifugation. Pellets were washed 3 times with PBS, then resuspended in 200 mL of 2% (w/v) choline chloride, followed by shaking on a vortex mixer (Thermo Scientific) for 20 min [44]. The CBPs on pneumococcal surface were washed after this procedure. Then, 100 mL supernatants were taken, and mixed with 20 mL sample loading buffer. The mixture was incubated for 5 min at 100 C before loading onto a 10% (w/v) SDS-polyacrylamide gel. Proteins were transferred onto nitrocellulose membrane (Life Technology, Kiryat Shmora, Israel) by semidry blotting using an Invitrogen iBlot transfer unit. Western blot was performed as previously described [28] using a rabbit polyclonal antibody against pneumococcal CBPs (1:800). A LI-COR IRDye™ 800-labeled secondary antibody and Odyssey Infrared Imaging System (LI-COR Biosciences, Nebraska, USA) were used for signal detection.
2.9. Analysis of virulence in animal tests
2.12. Statistical analysis
All animal infection procedures were approved by the relevant Animal Ethics Committees. For intranasal (i.n.) infection, 5 female CD1 mice, 6-week-old, were challenged with approximately 1 107 CFU of the D39DlicC or wildtype strain administered in a 40-mL volume inoculated into a single nostril. The bacteria were recovered by nasal washing 3 days after infection and grown dilutions on TSA blood agar plates for 16 h to calculate the number of colonies and the Ratio (Ratio ¼ mutant CFU/wild-type CFU). For intraperitoneal (i.p.) infection studies, groups of 9 female CD1 mice, 6week-old, were anesthetized with 2% Avertin at 120 mL/10 g and then challenged with the following doses of each strain: approximately 3 103 CFU for the D39 group and 3 103 CFU or 3 105 CFU for the D39 DlicC group. Mouse survival was observed for 21 days.
Statistical analysis was performed using GraphPad Prism (GraphPad Software, La Jolla, CA). A Student t test was used to compare the means of mutant samples against the corresponding values of wild-type. Furthermore, differences in the overall survival rates between the groups were analyzed using the Log-rank test. A p-value of <0.05 was considered statistically significant.
2.10. PCho assessed by flow cytometry Wild-type D39 and its licC mutant were grown in THY broth to an OD620 of 0.4. Cells in culture of 500 mL were precipitated via centrifuged at 2000 g for 5 min, washed twice in PBS (pH 7.0), and then resuspended in 1 mL of PBS containing 1% bovine serum albumin (BSA). After 1 h incubation at room temperature, bacteria were incubated with a 1:200 dilution of the mouse anti-phosphorylcholine monoclonal antibody TEPC15 (IgA-k) (SigmaeAldrich, St. Louis, MO) [15] and then washed for 3 times with 1% BSA-PBS. Subsequently, pneumococcal cells were treated with the FITC-labeled anti-mouse IgA antibody (SigmaeAldrich, St. Louis, MO) for 1 h. After washing 3 times, the bacteria were detected by flow cytometry. The percentage of FITC positive bacteria in total bacteria counted and the FITC fluorescence intensity of equal numbers of bacteria between wild-type and mutant were recorded. 2.11. Western-blot analysis of CBPs For preparation of bacterial extracts, D39 wild-type and DlicC were grown in 5 mL THY medium to an OD620 of 0.4.
3. Results 3.1. Growth phenotypes of the licC mutant strain Choline is an essential nutrient for S. pneumoniae, and S. pneumoniae licC has been considered as an essential gene [24,9]. In this study, when bacteria were grown in THY broth, the truncated licC mutants in both D39 and ST556 genetic background displayed slower growth rate compared to the wild-type strains (Fig. 1A). The significant difference could be seen from 2.5 h between ST42A5 and wild-type ST556 ( p ¼ 0.009; n ¼ 3). From 3 h between D39DlicC and D39 ( p ¼ 0.024; n ¼ 3). Meanwhile, both the mutants exhibited longer chains compared to their parental strains in THY media at OD620 of both 0.1 and 0.5 (Fig. 1B). These results indicate that LicC plays an important role in pneumococcal growth, which is consistent with the essentiality of LicC. 3.2. Effect of licC mutation on pneumococcal adhesion and invasion to epithelial cells and phagocytosis by macrophages The hydrophobic activities of ST556 and ST42A5 were determined. ST42A5 exhibited a significant increase in hydrophobicity, which was two-fold higher than wild-type (Fig. 2B). The elevated hydrophobicity of the bacterial surface caused by the insertion mutation had a deleterious effect on the adherence of A549 epithelial cells. Compared with the wild-type strain, adhesion of ST42A5 was impaired by 70% (Fig. 2C), and invasion of ST42A5 to A549 cells was
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 5/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
5
the licC mutant infected mice displayed significantly increased median survival times compared to those infected with the parental strain (>21 days versus 48 h; p < 0.001; Fig. 4). All the mice challenged by D39DlicC (3 103 CFU/mouse) survived for the duration of the experiment (>21 days), while all D39 wild-type (3 103 CFU/mouse) infected mice succumbed within 72 h. When higher dose of D39DlicC (3 105 CFU/mouse) was used, there were still 78% of the mice survived at 96 h post infection, and these mice remained alive at the end of the experiment, which is 21 d post infection (Fig. 4). 3.5. The effect of licC mutation on cell surface PCho and CBPs
Fig. 1. Growth curves and morphology of the licC mutant strains. (A) Growth curves for the licC mutants in D39 and ST556. The OD620 of the bacteria culture was checked every half hour for 6 h. The data shown is a representative of three biological repeats. *p ¼ 0.009 (Student's t test; n ¼ 3) compared the OD620 of ST42A5 with that of ST556 wild-type. #p ¼ 0.024 (Student's t test; n ¼ 3) compared the OD620 of D39 DlicC with that of D39 wild-type. (B) Morphology of the licC mutants in D39 and ST556. The images were obtained under light microscope at 200.
attenuated by 80% (Fig. 2D). Additionally, the phagocytosis of the mutant strain by macrophage RAW264.7 was increased by 16.5% in comparison with that of wild-type ST556 (Fig. 2E). Together, our data indicate that LicC plays an essential role in interaction with the host cells. 3.3. Enzymatic analysis of SpCCT His-tagged LicC and DLicC were purified by Ninitrilotriacetic acid affinity chromatograph to concentrations of 1.25 and 0.65 mg/mL, respectively. Then 1 mg of each protein was used to determine the enzymatic activity. A standard curve to calculate SpCCT activity was graphed with the concentration of PPi as the horizontal axis and the integral luminous intensity at 10 s as the vertical axis. Our result showed that the activity of DLicC was only approximately 6% of compared to that of LicC in this assay (Fig. 3). This data indicates that the C-terminal 26 aa in LicC is critical for its SpCCT activity. 3.4. Virulence of the licC mutant The virulence of D39DlicC was investigated by challenging mice via i.n. and i.p. routes. Similar to the STM strain ST42A5 during middle ear infection, D39DlicC could not be recovered from nasal washes; however, 3.2 105 CFU/ml (n ¼ 5) pneumococci were recovered in nasal wash from the D39 infected group. In the i.p. challenge experiment, as expected,
The PCho on pneumococcal surface was analyzed by flow cytometry. The fluorescence intensity of pneumococcal cell can reflect the quantity of PCho on cell surface. The percentages of FITC-cells in total counted cells between D39 and D39DlicC had no statistically significant difference ( p ¼ 0.114; n ¼ 3; data not shown). However, the mutant bacteria exhibited lower mean fluorescence intensity ( p < 0.01; n ¼ 3), which is decreased by 56.4% compared to the wild-type (Fig. 5A). Furthermore, pneumococcal CBPs were analyzed using western blot (Fig. 5B). Our result showed that the 4 major CBPs in the mutant were either reduced or absent compared to those in the wild-type strain (Fig. 5A). This data indicates that the CBPs are either less expressed or more likely lost on pneumococcal surface in the mutant. 4. Discussion S. pneumoniae relies on a lic system to satisfy nutritional requirements and obtain active choline moieties for various physiological functions [14]. Several studies have demonstrated that the lic operons, including lic1 and lic2, are required for pneumococcal pathogenicity and growth by taking part in pneumococcal choline uptake, PCho metabolism and its transmembrane transportation [9,21,24,44]. As a key enzyme in the biosynthesis of pneumococcal PCho, LicC has been investigated for its role in virulence via two licC-deleted mutant strains constructed from choline-independent strains [9,23]. However, the influence of these two strains on pneumococcal virulence was based on choline-starvation and point mutation in tacF (D39ChiplicC112) or a complex origin including a heterologous genetic cross (R6CholicC11). A simple licC deletion mutant has never been constructed. In this study, we characterized a licC mutant obtained from an STM library and generated the same mutation in D39 via homologous recombination. Our results showed that the mutation in licC, 78 bp truncation at its 30 end (LEGNSIYE216ID218SVQDYRKLEEILKNEN), resulted in the alteration in pneumococcal growth and morphology, the decreased PCho on cell surface, the impaired CBPs bound to PCho, and accordingly the attenuation of pneumococcal virulence.
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 6/9
6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
Fig. 2. Infection of the licC mutant (ST42A5) in vitro using epithelial cell and macrophage cell lines. (A) The structure of the mutant licC gene. The fragment of 78 bp, which is deleted in the mutant, is indicated in the wild-type. (B) Hydrophobicity analysis of the licC mutant with the wild-type as a control. *p < 0.001 (Student's t test; n ¼ 4) compared with control. (C) Adhesion of ST556 was analyzed, and the mean and standard error were calculated from four independent experiments. xp < 0.001 (Student's t test; n ¼ 4) compared with wild-type. (D) The invasive ability of ST556 was analyzed, and the mean and standard error were calculated from four independent experiments. #p < 0.001 (Student's t test; n ¼ 4) compared with wild-type. (E) Levels of phagocytosis by Raw264.7 cells were shown. ##p < 0.02 (Student's t test; n ¼ 3) compared with wild-type ST556.
The crystal structure of LicC suggested that Glu216 plays an important role in enzymatic reactions catalyzed by LicC [25]. First, this residue is a part of the LicC's active site, and it is also conserved in most NTP transferase family members, with the exception of GlmU and E. coli methylerythritol-4phosphate cytidylyltransferase. Second, breaking the Glu216$Arg129 salt bridge, driven by the multivalent coordination of Mg2þ, is a trigger for the subsequent cascade. Our data
demonstrated that the activity of DLicC, which happened to miss Glu216, is markedly decreased. Using a firefly luciferasebased bioluminometric assay to detect the generation of PPi, we found the activity of DLicC is only approximately 6% of wild-type LicC (Fig. 3). These observations indicate that the truncated sequence is a key functional site for SpCCT. Meanwhile, the residual SpCCT activity of DLicC is enough to allow the mutant to be viable in vitro, but not to full
Fig. 3. Measurement of SpCCT activity for recombinant LicC and DLicC. (A) Assay optimization of recombinant proteins for different reaction dosages. The rate of signal-to-noise (S/N) was the highest at 1.0 mg of the individual protein for both the LicC and DLicC reactive systems. Data shown are the means of three biological repeat experiments. The error bars denote SD. (B) Comparison of the enzymatic activity between LicC and DLicC (#p < 0.001; Student's t test) in three independent experiments. Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 7/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
Fig. 4. Virulence of the licC mutant in a mouse infection model. Mice were challenged with approximately 3 103 and 3 105 CFU of D39DlicC intraperitoneally. Wild-type D39 at 3 103 CFU was used as control. The survival of mice were monitored every 12 h for 21 d. After 96 h post infection, all the survived mice remained alive at the end of the experiment. Therefore, only the result within 96 h was shown. The survival of the mutants was significantly greater ( p < 0.001 in log-rank tests) than that of the wild-type.
virulence in vivo, which was indicated by the results of the growth curves and the animal experiment. The low activity (6% of wild-type) of the mutant leads to the decreased production of choline-containing TA precursor [9,36,33] and the accumulation of choline-free TA subunits [9], which cannot be transported to the outer layer of the cytoplasmic membrane by TacF flippase [9]. The latter could disrupt the membrane integrity, trap the undecaprenyl phosphate transport lipid and consequently inhibit the growth of mutants [11,9]. Considering the important role of cell growth in physiological functions [27], we propose that the slower growth, which may restrict the expression of virulent factor, cripple the resistance to host immune response or suppress the cell wall biosynthesis, is one of the reason for the impaired pathogenicity of the licC mutants. Previous studies have demonstrated that PCho is involved in the process of pneumococcal infection [12,31], including adhesion and invasion. PCho residues provide a niche for the anchor of CBPs, a family of surface proteins that noncovalently bind to phosphorylcholine moieties in the cell wall and mediate bacterial attachment and colonization to the host
7
cell [18,13]. Furthermore, pneumococci can transmit the lung epithelium as well as the endothelium of the bloodebrain barrier through an interaction between phosphorylcholine on the bacterial surface and platelet activating factor receptor (PAFR) [38]. These observations are further supported by studies that demonstrated the modulation or deletion of PCho expression in Haemophilus influenzae or the pneumococci resulted in significant decrease of adherence and invasion [30,13]. In our study, phenotypic changes for the licC mutant, which include slower growth velocity (Fig. 1A), long-chain morphology (Fig. 1B), and attenuated virulence (Figs. 2 and 4), are consistent with the key role of LicC in the pathway for the addition of PCho to TA. The decreased PCho components on pneumococcal surface were also found by the loss of the 78-bp fragment in licC (Fig. 5A). Importantly, because of damage of their binding-sites to cell wall surface, the CBPs being partially responsible for pneumococcal pathogenicity are significantly impaired (Fig. 5B), which may be the linchpin of relationship between LicC and pneumococcal virulence. Long chain formation was noted in both ST42A5 and D39DlicC. It had been suggested to be important in pathogenesis because it increases the susceptibility to the host immune response mainly by complement mediated immunity and phagocytosis [8]. Also the morphologic change was reported in the pneumococcal mutants of lytA [8], lytB [29], tacF [17], and lic locus that containing licA, licB, and licC [24]. Accordingly, it was assumed that long chain formation was resulted from the incomplete cleavage of peptidoglycan between daughter cells following cell division when key enzymes like LytA or LytB for daughter cell separation were disrupted [8,29]. But when choline metabolism was interfered from genetic mutation of lic locus, or choline deprived condition [5,4,16], similar phenotypes have also been observed. This effect is probably due to the release or inhibition of either LytA or LytB, each as one of the CBPs with endo-b-N-acetylglucosaminidase activity [19,1]. The decreased virulence and enhanced phagocytosis are the common results from the elongated chain of S. pneumoniae, these phenomena were also observed in this study (Figs. 2 and 4). It was suggested that
Fig. 5. Pneumococcal PCho and CBPs analysis. (A) Comparison of fluorescence intensity between D39 and D39DlicC in PCho determined by using flow cytometry (#p < 0.01; Student's t test; n ¼ 3). The mean fluorescence intensity in D39 cells was defined as 100%. (B) Detection of CBPs on pneumococcal surface by western blotting analysis. Four proteins were clearly down-regulated or lost in the mutant are indicated with arrows. Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 8/9
8
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9
1 long chain formation enhanced susceptibility to opsonopha2 gocytosis (OPH) killing and uptake by human neutrophils, and 3 promoted C3 complement deposition on pneumococci [8]. 4 Herein we deeply demonstrate that it may be caused by the 5 losing of CBPs (Fig. 5B). Several CBPs have been implicated 6 in virulence, such as PcpA, PspA and PspC (also named 7 CbpA, SpsA, PbcA, and Hic) [2,20,42], in which, CbpA binds 8 9 to factor H, thus avoiding C3 complement activation and 10 phagocytosis [10,26]. Finally, we propose that both of the 11 changes of cell morphology and impaired CBPs on cell sur12 face were caused by loss of PCho, then lead to the increased 13 the susceptibility to the host immune response and the reduced 14 abilities to infect host of licC mutant. 15 This study demonstrated that the C-terminus of licC was 16 17 essential for the main activity of LicC in PCho metabolism and 18 the virulence of S. pneumoniae. Our results provide insight a 19 novel target for drug design against pneumococcal infection. 20 21 Conflict of interest statement 22 23 There are no conflicts of interest regarding the publication 24 25 of this article. 26 27 Acknowledgment 28 29 This work was supported by a grant from the National 30 Natural Science Foundation of China (30873074). 31 32 33 References 34 35 [1] Bai XH, Chen HJ, Jiang YL, Wen Z, Huang Y, Cheng W, et al. 36 Structure of pneumococcal peptidoglycan hydrolase LytB reveals in37 sights into the bacterial cell wall remodeling and pathogenesis. J Biol 38 Q1 Chem 2014. 39 [2] Bergmann S, Hammerschmidt S. Versatility of pneumococcal surface 40 proteins. Microbiology 2006;152:295e303. 41 [3] Bricker AL, Camilli A. Transformation of a type 4 encapsulated strain of Streptococcus pneumoniae. FEMS Microbiol Lett 1999;172:131e5. 42 [4] Briese T, Hakenbeck R. Interaction between choline and the N-acetyl43 muramyl-L-alanine-amidase of Streptococcus pneumoniae, the target of 44 penicillin. Berlin: Walter de Gruyter; 1983. p. 173e8. 45 [5] Briese T, Hakenbeck R. Interaction of the pneumococcal amidase with 46 lipoteichoic acid and choline. Eur J Biochem 1985;146:417e27. 47 [6] Campbell HA, Kent C. The CTP:phosphocholine cytidylyltransferase 48 encoded by the licC gene of Streptococcus pneumoniae: cloning, 49 expression, purification, and characterization. Biochim Biophys Acta 50 2001;1534:85e95. 51 [7] Chen H, Ma Y, Yang J, O'Brien CJ, Lee SL, Mazurkiewicz JE, et al. 52 Genetic requirement for pneumococcal ear infection. PLoS One 53 2008;3:e2950. 54 [8] Dalia AB, Weiser JN. Minimization of bacterial size allows for com55 plement evasion and is overcome by the agglutinating effect of antibody. 56 Cell Host Microbe 2011;10:486e96. 57 [9] Damjanovic M, Kharat AS, Eberhardt A, Tomasz A, Vollmer W. The 58 essential tacF gene is responsible for the choline-dependent growth 59 phenotype of Streptococcus pneumoniae. J Bacteriol 2007;189:7105e11. 60 [10] Duthy TG, Ormsby RJ, Giannakis E, Ogunniyi AD, Stroeher UH, 61 Paton JC, et al. The human complement regulator factor H binds pneumococcal surface protein PspC via short consensus repeats 13 to 15. 62 Infect Immun 2002;70:5604e11. 63 [11] Fischer H, Tomasz A. Peptidoglycan cross-linking and teichoic acid 64 attachment in Streptococcus pneumoniae. J Bacteriol 1985;163:46e54. 65
[12] Fischer W. Phosphocholine of pneumococcal teichoic acids: role in bacterial physiology and pneumococcal infection. Res Microbiol 2000;151:421e7. [13] Gehre F, Spisek R, Kharat AS, Matthews P, Kukreja A, Anthony RM, et al. Role of teichoic acid choline moieties in the virulence of Streptococcus pneumoniae. Infect Immun 2009;77:2824e31. [14] Geiger O, Lopez-Lara IM, Sohlenkamp C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim Biophys Acta 2013;1831:503e13. [15] Gerber J, Redlich S, Ribes S, Tauber SC, Schmidt H, Nau R. Intrathecal treatment with the anti-phosphorylcholine monoclonal antibody TEPC15 decreases neuronal damage in experimental pneumococcal meningitis. Chemotherapy 2012;58:212e6. [16] Giudicelli S, Tomasz A. Attachment of pneumococcal autolysin to wall teichoic acids, an essential step in enzymatic wall degradation. J Bacteriol 1984;158:1188e90. [17] Gonzalez A, Llull D, Morales M, Garcia P, Garcia E. Mutations in the tacF gene of clinical strains and laboratory transformants of Streptococcus pneumoniae: impact on choline auxotrophy and growth rate. J Bacteriol 2008;190:4129e38. [18] Gosink KK, Mann ER, Guglielmo C, Tuomanen EI, Masure HR. Role of novel choline binding proteins in virulence of Streptococcus pneumoniae. Infect Immun 2000;68:5690e5. [19] Hakenbeck R, Madhour A, Denapaite D, Bruckner R. Versatility of choline metabolism and choline-binding proteins in Streptococcus pneumoniae and commensal streptococci. FEMS Microbiol Rev 2009;33:572e86. [20] Hammerschmidt S, Agarwal V, Kunert A, Haelbich S, Skerka C, Zipfel PF. The host immune regulator factor H interacts via two contact sites with the PspC protein of Streptococcus pneumoniae and mediates adhesion to host epithelial cells. J Immunol 2007;178:5848e58. [21] Humphries HE, High NJ. The role of licA phase variation in the pathogenesis of invasive disease by Haemophilus influenzae type b. FEMS Immunol Med Microbiol 2002;34:221e30. [22] Joshi LT, Phillips DS, Williams CF, Alyousef A, Baillie L. Contribution of spores to the ability of Clostridium difficile to adhere to surfaces. Appl Environ Microbiol 2012;78:7671e9. [23] Kharat AS, Denapaite D, Gehre F, Bruckner R, Vollmer W, Hakenbeck R, et al. Different pathways of choline metabolism in two choline-independent strains of Streptococcus pneumoniae and their impact on virulence. J Bacteriol 2008;190:5907e14. [24] Kharat AS, Tomasz A. Drastic reduction in the virulence of Streptococcus pneumoniae expressing type 2 capsular polysaccharide but lacking choline residues in the cell wall. Mol Microbiol 2006;60:93e107. [25] Kwak BY, Zhang YM, Yun M, Heath RJ, Rock CO, Jackowski S, et al. Structure and mechanism of CTP:phosphocholine cytidylyltransferase (LicC) from Streptococcus pneumoniae. J Biol Chem 2002;277:4343e50. [26] Lu L, Ma Y, Zhang JR. Streptococcus pneumoniae recruits complement factor H through the amino terminus of CbpA. J Biol Chem 2006;281:15464e74. [27] Massidda O, Novakova L, Vollmer W. From models to pathogens: how much have we learned about Streptococcus pneumoniae cell division? Environ Microbiol 2013;15:3133e57. [28] Morrison DA, Mortier-Barriere I, Attaiech L, Claverys JP. Identification of the major protein component of the pneumococcal eclipse complex. J Bacteriol 2007;189:6497e500. [29] Moscoso M, Obregon V, Lopez R, Garcia JL, Garcia E. Allelic variation of polymorphic locus lytB, encoding a choline-binding protein, from streptococci of the mitis group. Appl Environ Microbiol 2005;71:8706e13. [30] Pang B, Winn D, Johnson R, Hong W, West-Barnette S, Kock N, et al. Lipooligosaccharides containing phosphorylcholine delay pulmonary clearance of nontypeable Haemophilus influenzae. Infect Immun 2008;76:2037e43. [31] Percy MG, Grundling A. Lipoteichoic acid synthesis and function in Gram-positive bacteria. Annu Rev Microbiol 2014. [32] Ricci S, Gerlini A, Pammolli A, Chiavolini D, Braione V, Tripodi SA, et al. Contribution of different pneumococcal virulence factors to experimental meningitis in mice. BMC Infect Dis 2013;13:444.
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
RESMIC3338_proof ■ 5 October 2014 ■ 9/9
X.-F. Zeng et al. / Research in Microbiology xx (2014) 1e9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
[33] Rock CO, Heath RJ, Park HW, Jackowski S. The licC gene of Streptococcus pneumoniae encodes a CTP:phosphocholine cytidylyltransferase. J Bacteriol 2001;183:4927e31. [34] Rose L, Shivshankar P, Hinojosa E, Rodriguez A, Sanchez CJ, Orihuela CJ. Antibodies against PsrP, a novel Streptococcus pneumoniae adhesin, block adhesion and protect mice against pneumococcal challenge. J Infect Dis 2008;198:375e83. [35] Severin A, Horne D, Tomasz A. Autolysis and cell wall degradation in a choline-independent strain of Streptococcus pneumoniae. Microb Drug Resist 1997;3:391e400. [36] Sohlenkamp C, Lopez-Lara IM, Geiger O. Biosynthesis of phosphatidylcholine in bacteria. Prog Lipid Res 2003;42:115e62. [37] Sung CK, Li H, Claverys JP, Morrison DA. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl Environ Microbiol 2001;67:5190e6. [38] Thornton JA, Durick-Eder K, Tuomanen EI. Pneumococcal pathogenesis: “innate invasion” yet organ-specific damage. J Mol Med (Berl) 2010;88:103e7.
9
[39] Tomasz A. Choline in the cell wall of a bacterium: novel type of polymer-linked choline in Pneumococcus. Science 1967;157:694e7. [40] Tomasz A. Biological consequences of the replacement of choline by ethanolamine in the cell wall of Pneumococcus: chanin formation, loss of transformability, and loss of autolysis. Proc Natl Acad Sci U S A 1968;59:86e93. [41] Vander Top EA, Perry GA, Gentry-Nielsen MJ. A novel flow cytometric assay for measurement of in vivo pulmonary neutrophil phagocytosis. BMC Microbiol 2006;6:61. [42] Vollmer W, Joris B, Charlier P, Foster S. Bacterial peptidoglycan (murein) hydrolases. FEMS Microbiol Rev 2008;32:259e86. [43] Whiting GC, Gillespie SH. Incorporation of choline into Streptococcus pneumoniae cell wall antigens: evidence for choline kinase activity. FEMS Microbiol Lett 1996;138:141e5. [44] Zhang JR, Idanpaan-Heikkila I, Fischer W, Tuomanen EI. Pneumococcal licD2 gene is involved in phosphorylcholine metabolism. Mol Microbiol 1999;31:1477e88.
Please cite this article in press as: Zeng X-F, et al., A C-terminal truncated mutation of licC attenuates the virulence of Streptococcus pneumoniae, Research in Microbiology (2014), http://dx.doi.org/10.1016/j.resmic.2014.09.002
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36