- Email: [email protected]
A case of desmoplastic fibroma of bone with CTNNB1 point mutation
Journal Pre-proof
A case of desmoplastic fibroma of bone with CTNNB1 point mutation Hiroko Kadowaki MD , Yuzo Oyama MD , Haruto Nishida PhD , Takahiro Kusaba MD , Motoki Arakane MD , Kazuhiro Kawamura MD , Kenji Kawano PhD , Tsutomu Daa PhD PII: DOI: Reference:
S2212-4403(19)31493-2 https://doi.org/10.1016/j.oooo.2019.09.007 OOOO 4236
To appear in:
Oral Surg Oral Med Oral Pathol Oral Radiol
Received date: Revised date: Accepted date:
24 May 2019 30 August 2019 14 September 2019
Please cite this article as: Hiroko Kadowaki MD , Yuzo Oyama MD , Haruto Nishida PhD , Takahiro Kusaba MD , Motoki Arakane MD , Kazuhiro Kawamura MD , Kenji Kawano PhD , Tsutomu Daa PhD , A case of desmoplastic fibroma of bone with CTNNB1 point mutation, Oral Surg Oral Med Oral Pathol Oral Radiol (2019), doi: https://doi.org/10.1016/j.oooo.2019.09.007
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Inc.
A case of desmoplastic fibroma of bone with CTNNB1 point mutation
Hiroko Kadowaki, MDa, Yuzo Oyama, MDb, Haruto Nishida, PhDc, Takahiro Kusaba, MDd, Motoki Arakane, MDe, Kazuhiro Kawamura, MDf, Kenji Kawano, PhDg, Tsutomu Daa, PhDh, a
Clinical Fellow, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] b
Clinical Fellow, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] c
Assistant Professor, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] d
Clinical Fellow, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] e
Specially Appointed Assistant Professor, Department of Diagnostic Pathology, Faculty
of Medicine, Oita University [email protected] f
Assistant Professor, Dentistry and Oral-Maxillo-Facial Surgery , Faculty of Medicine,
Oita University [email protected]
1
g
Professor, Dentistry and Oral-Maxillo-Facial Surgery , Faculty of Medicine, Oita
University [email protected] h
Professor, Department of Diagnostic Pathology, Faculty of Medicine, Oita University
[email protected] Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Address for correspondence and reprint requests: Haruto Nishida, M. D., Ph. D. 1-1, Idaigaoka, Hasama-machi, Yufu, 879-5593, Japan Tel.: +81-97-586-5683 Fax: +81-97-586-5686 E-mail: [email protected]
Conflicts of Interest: The authors declare there are no conflicts of interest. Abstract word count: 165 Manuscript word count: 1179 Number of references: 14 Number of figures/tables: 4 2
Abstract Desmoplastic fibroma of bone (DFB, a bone tumor) is considered to be an osseous counterpart of desmoid-type fibromatosis (DF). Herein, we report a case of DFB with CTNNB1 point mutation. The 5-year-old male patient had complained of
trismus and pain in the jaw. Magnetic resonance imaging revealed a mass in the left mandible. Radical treatment involved surgical resection. Microscopically, the lesion consisted of a bundle-like proliferation of uniform spindle-shaped cells with abundant collagenous stroma, which resembled DF. Immunohistochemical analysis revealed intranuclear accumulation of beta-catenin in the tumor cells. Based on clinical and histological analysis, we diagnosed the patient as having DFB. We examined the CTNNB1 and APC sequence and found an A-to-G transition at codon 41 of CTNNB1, i.e., Thr was substituted by Ala. Our findings suggest that the dysregulation of Wnt/β-catenin signaling pathway is related to the tumorigenesis of some cases of DFB. This hypothesis indicates that there are some cases of DFB in which nuclear positive expression of β-catenin are useful for diagnosis.
Keywords: mandibula, desmoplastic fibroma, be-ta catenin
3
Introduction Desmoplastic fibroma of bone (DFB) is a rare bone tumor with an incidence rate of less than 0.1% of all primary bone tumors.1 DFB is a benign but locally aggressive tumor that is recognized as an osseous counterpart of desmoid-type fibromatosis (DF) based on morphological similarity.2, 3, 4 Majority of DF cases involve a CTNNB1 point mutation or APC germ-line mutation.5 However, both point mutations have been detected in a limited number of DFB cases. 6, 7 Herein, we present a case report of DFB harboring a CTNNB1 point mutation. Case presentation A 5-year-old boy without any developmental problems visited a dentist, complaining of jaw pain for a month and trismus since a few weeks recently. His left jaw was swollen, and the mandible slightly deviated to the right; however, the mass was indistinct on palpation (Figure 1A). A panoramic radiograph revealed a multilocular radiolucent tumor in the left mandible (Figure 1B). The patient was admitted to our hospital for further evaluation and treatment. Magnetic resonance imaging (MRI) revealed that the tumor (2.0 × 1.5 cm) was mainly located in the mandible and focally
4
expanded into the surrounding soft tissue (Figure 1C, 1D). The biopsy did not confirm the diagnosis, but DFB was suspected. The patient underwent surgical resection for radical treatment and definite diagnosis. At the time of surgery, we confirmed that the suspected central origin of the neoplastic process was in the mandible. Histologically, the tumor cells, which that showed uniform spindle-shaped nuclei with pale chromatin proliferated in fascicles. There were abundant collagenous stroma between tumor cells, and the cellularity was low. Blood vessels with perivascular edema were dispersed in the tumor. No mitotic figures or necrosis was observed (Figure 2A, 2B). Bone fragments were observed in the tumor periphery. Immunohistochemical analysis of the tumor cells revealed positive results for vimentin and α-SMA, but negative results for AE1/AE3 and S-100 protein. In addition, β-catenin had accumulated in the nuclei of tumor cells (Figure2C). Finally, we diagnosed the tumor as DFB based on histological features, the location of the tumor in MRI images, and the surgical findings. We performed PCR direct sequencing of CTNNB1 (exon3) and APC (exon15) using the primers presented in Table 1. An A-to-G transition was detected at codon 41 of
5
CTNNB1 (Figure 3), which resulted in the substitution of Thr by Ala. No mutation was detected in APC exon 15. Trismus and deviation of the mandible were improved greatly after the operation and the patient has been free from recurrence for one year. Discussion DFB was initially described by Jaffe et al. in 1958.3 DFB has been reported in various bones, although the mandible is mostly affected.1 In gnathic DFB, morbidity is reportedly female dominant and the average age of patients is 17 years (range: 6 months to 60 years).4 Histologically, DFB shows uniform spindle cells without atypia proliferating in fascicles and there are abundant collagenous stroma in the background. The microscopic appearance resembles DF.2 The only difference between DFB and DF is the location of the tumor: i.e., in bone and in soft tissue, respectively.8, 9 MRI is a useful tool to evaluate the relationship between the primary site and surrounding tissue.9 In the present case, MRI showed that most of the tumor was located in the mandible, which suggested it originated from bone and not soft tissue. The main subject of histological differential diagnosis is low-grade fibrosarcoma,
6
which shows the features of herringbone pattern, nuclear pleomorphism, and mitoses8). In addition, ossifying fibroma, fibrous dysplasia, low grade-central osteosarcoma, and odontogenic fibroma should also be differentiated from DFB; they intermix neoplastic bone components or odontogenic epithelial components.4 Our case did not show them. β-catenin, which is encoded by CTNNB1, is degraded by the APC/AXIN/GSK-3β-complex in the cytoplasm.5, 10 β-catenin is stabilized and translocated into the nucleus via the activation of the Wnt/β-catenin signaling pathway, where it binds to the T-cell factor/lymphoid enhancer factor, and acts as a transcription factor.10 As a result, the transcription of various genes, including some oncogenes such as c-myc or cyclinD1 is accelerated.10 Therefore, both mutations of CTNNB1 and APC may lead to tumorigenesis.11 The dysregulation of the Wnt/β-catenin signaling pathway is profoundly associated with the tumorigenesis of DF.11 DF is classified as sporadic and familial. Mutations at codons 41A, 45F, and 45P of CTNNB1 are mostly identified in the former, and the APC germ-line mutation is generally detected in the latter.5 In 70–75% of DF, nuclear expression of β-catenin is detected by immunohistochemistry, which is highly correlated with the somatic mutation of CTNNB1 or the germ-line mutation of APC.11, 12 However, in DFB, very
7
few cases demonstrate the mutation of CTNNB1 or APC. 7, 13 Flucke et al. presented one case of DFB with the common mutation of sporadic DF; although, it is controversial whether DFB and DF are genetically identical.1, 7, 14 In the present case, nuclear β-catenin was positively expressed, and we successfully identified an A-to-G transition at codon 41 of CTNNB1, which is typical in sporadic DF.5 Previous reports and our result suggest a possibility that DFB shows genetic diversity, in other words, some cases of DFB harbor gene mutations that are similar to those in DF but others not. There will be a need to reveal more molecular understanding about tumorigenesis of DFB that is different from DF. Because the recurrence rates of DFB are high, at 20~40% in enucleation and 70% in curettage, the most common treatment is complete surgical resection with wide margin. 8
However, the effects of radiation therapy and chemotherapy remain unclear.10 It is
difficult to demarcate the histopathological margins of DFB. Immunostaing of β-catenin may be helpful in clarifying the border; however, this method would be limited to the cases with positive expression of immunohistochemical nuclear β-catenin. In other words, the method would only be suitable for cases where the expression are positive in the neoplasm while being negative in the surrounding
8
tissue. In conclusion, we present a case report of DFB harboring a CTNNB1 point mutation, which is identical to that of sporadic DF. The present case indicates that there may be a group of DFB cases that involve dysregulation of the Wnt/β-catenin signaling pathway which is associated with the tumorigenesis of DF. Acknowledgements We would like to thank Editage (www.editage.lp) for English language editing. References 1) E. Hauben, A.M. Cleton-Jansen, Desmoplastic fibroma of bone, in: C.D. Fletcher, J.A. Bridge, P.C. Hogendoorn, F. Mertens (Eds.), WHO classification of tumours of soft tissue and bone, Lyon, IARC Press, 2013, pp. 298. 2) A. Ferri, M. Leporati, D. Corradi, T. Ferri, E. Sesenna, Huge desmoplastic fibroma of the paediatric mandible: surgical considerations and follow-up in three cases, J. Craniomaxillofac. Surg. 41 (2013) 367–370. 3) H.L. Jaffe, Tumors and tumorous conditions of the bones and joints, Lea & Febiger, Philadelphia, 1958, pp. 298–303.
9
4) T.R. Woods, D.M. Cohen, M.N. Islam, Y. Rawal, I. Bhattacharyya. Desmoplastic fibroma of the mandible: a series of three cases and review of literature, Head Neck Pathol. 9 (2015) 196–204. 5) A.J. Lazar, D. Tuvin, S. Hajibashi, S. Habeeb, S. Bolshakov, E. Mayordomo-Aranda, C.L. Warneke, D. Lopez-Terrada, R.E. Pollock, D. Lev, Specific mutations in the beta-catenin gene (CTNNB1) correlate with local recurrence in sporadic desmoid tumors, Am. J. Pathol. 173 (2008) 1518–1527. 6) A.E. Horvai, R.C. Jordan, Fibro-osseous lesions of the craniofacial bones: β-catenin immunohistochemical analysis and CTNNB1 and APC mutation analysis, Head Neck Pathol. 8 (2014) 291–297. 7) U. Flucke, B.B. Tops, P.J. van Diest, P.J. Slootweg, Desmoid-type fibromatosis of the head and neck region in the paediatric population: a clinicopathological and genetic study seven cases, Histopathol. 64 (2014) 769–776. 8) N. Said-Al-Naief, R. Fernandes, P. Louis, W. Bell, G.P. Siegal, Desmoplastic fibroma of the jaw: a case report and review of literature, Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 101 (2006) 82–94.
10
9) Y. Takahashi, T. Kono, K. Ono, K. Kawano, Aggressive fibromatosis of the mandibular region: A report of an infant case, J. Jpn. Stomatol. Soc. 61 (2012) 337–343.
10) A. Kawahara, H. Harada, H. Abe, T. Yamaguchi, T. Taira, K. Nakashima, H.
Mihashi, J. Akiba, M. Kage, Nuclear β-catenin expression in basal cell adenomas of salivary gland, J. Oral Pathol. Med. 40 (2011) 460–466.
11) T.L. Ng, A.M. Gown, T.S. Barry, M.C. Cheang, A.K. Chan, D.A. Turbin, F.D. Hsu, R.B. West, T.O. Nielsen, Nuclear beta-catenin in mesenchymal tumors, Mod. Pathol. 18 (2005) 68–74. 12) J.R. Goldblum, J.A. Fletcher, Desmoid-type fibromatosis, in: C.D. Fletcher, J.A. Bridge, P.C. Hogendoorn, F. Mertens (Eds.), WHO classification of tumours of soft tissue and bone, Lyon, IARC Press, 2013, pp. 72–73. 13) E.I. Hauben, G. Jundt, A.M. Cleton-Jansen, A. Yavas, H.M. Kroon, E. Van Marck, P.C. Hogendoorn, Desmoplastic fibroma of bone: an immunohistochemical study including beta-catenin expression and mutational analysis for beta-catenin, Hum. Pathol. 36 (2005) 1025–1030.
11
14) U. Flucke, H. Coleman, Desmoplastic fibroma, in: A.K. El-Nagger, J.K. Chan, J.R. Grandis, T. Takata, P.J. Slootweg (Eds.), WHO classification of head and neck tumours, Lyon, IARC Press, 2016, p. 250.
12
Figure Legends
(A)
(B)
13
(C)
14
(D) Figure 1. Pre-operative images. A. The patient’s left jaw is swollen and the mandible slightly deviates to the right. B. The panoramic radiograph shows a multilocular translucent tumor in the left mandible.
C, D. Magnetic resonance imaging demonstrates that the mass in the mandible expanded into surrounding soft tissue focally. It is isodense with skeletal muscle in T1WI and slightly hyperintense in T2WI.
15
(A)
(B)
16
(C) Figure 2. Histopathological findings from resected specimen. A. The tumor proliferated in fascicles. There is abundant collagenous stroma in the background. Cellularity is low. B. The tumor cells show uniform spindle-shaped nuclei with pale chromatin. There are no mitotic figures. C. Imunohistochemically, beta-catenin proteins accumulate in the nuclei of tumor cells.
17
Figure 3. DNA sequencing result of CTNNB1.
The black arrow shows the position of the point mutation. A to G transition at codon 41 of CTNNB1 is detected.
18
Table 1. Primers APC primer1-F
ACCTTCATCTAATGCCAAGAGG
APC primer1-R
GTCTGCTGGATTTGGTTCTAGG
APC primer2-F
TTGGAACTAGGTCAGCTGAAGA
APC primer2-R
ATGGTTTGTCCAGGGCTATCT
APC primer3-F
GCATTATAAGCCCCAGTGATCT
APC primer3-R
TGCTCTGATTCTGTTTCATTCC
APC primer4-F
ATAATGCCTCCAGTTCAGGAAA
APC primer4-R
AACTAACATGCTTTTGGGGTTG
CTNNB1 primer1-F
ATGGGTCATATCACAGATTC
CTNNB1 primer1-R
TGACTTTCAGTAAGGCAATG
19
A case of desmoplastic fibroma of bone with CTNNB1 point mutation Hiroko Kadowaki MD , Yuzo Oyama MD , Haruto Nishida PhD , Takahiro Kusaba MD , Motoki Arakane MD , Kazuhiro Kawamura MD , Kenji Kawano PhD , Tsutomu Daa PhD PII: DOI: Reference:
S2212-4403(19)31493-2 https://doi.org/10.1016/j.oooo.2019.09.007 OOOO 4236
To appear in:
Oral Surg Oral Med Oral Pathol Oral Radiol
Received date: Revised date: Accepted date:
24 May 2019 30 August 2019 14 September 2019
Please cite this article as: Hiroko Kadowaki MD , Yuzo Oyama MD , Haruto Nishida PhD , Takahiro Kusaba MD , Motoki Arakane MD , Kazuhiro Kawamura MD , Kenji Kawano PhD , Tsutomu Daa PhD , A case of desmoplastic fibroma of bone with CTNNB1 point mutation, Oral Surg Oral Med Oral Pathol Oral Radiol (2019), doi: https://doi.org/10.1016/j.oooo.2019.09.007
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Inc.
A case of desmoplastic fibroma of bone with CTNNB1 point mutation
Hiroko Kadowaki, MDa, Yuzo Oyama, MDb, Haruto Nishida, PhDc, Takahiro Kusaba, MDd, Motoki Arakane, MDe, Kazuhiro Kawamura, MDf, Kenji Kawano, PhDg, Tsutomu Daa, PhDh, a
Clinical Fellow, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] b
Clinical Fellow, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] c
Assistant Professor, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] d
Clinical Fellow, Department of Diagnostic Pathology, Faculty of Medicine, Oita
University [email protected] e
Specially Appointed Assistant Professor, Department of Diagnostic Pathology, Faculty
of Medicine, Oita University [email protected] f
Assistant Professor, Dentistry and Oral-Maxillo-Facial Surgery , Faculty of Medicine,
Oita University [email protected]
1
g
Professor, Dentistry and Oral-Maxillo-Facial Surgery , Faculty of Medicine, Oita
University [email protected] h
Professor, Department of Diagnostic Pathology, Faculty of Medicine, Oita University
[email protected] Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Address for correspondence and reprint requests: Haruto Nishida, M. D., Ph. D. 1-1, Idaigaoka, Hasama-machi, Yufu, 879-5593, Japan Tel.: +81-97-586-5683 Fax: +81-97-586-5686 E-mail: [email protected]
Conflicts of Interest: The authors declare there are no conflicts of interest. Abstract word count: 165 Manuscript word count: 1179 Number of references: 14 Number of figures/tables: 4 2
Abstract Desmoplastic fibroma of bone (DFB, a bone tumor) is considered to be an osseous counterpart of desmoid-type fibromatosis (DF). Herein, we report a case of DFB with CTNNB1 point mutation. The 5-year-old male patient had complained of
trismus and pain in the jaw. Magnetic resonance imaging revealed a mass in the left mandible. Radical treatment involved surgical resection. Microscopically, the lesion consisted of a bundle-like proliferation of uniform spindle-shaped cells with abundant collagenous stroma, which resembled DF. Immunohistochemical analysis revealed intranuclear accumulation of beta-catenin in the tumor cells. Based on clinical and histological analysis, we diagnosed the patient as having DFB. We examined the CTNNB1 and APC sequence and found an A-to-G transition at codon 41 of CTNNB1, i.e., Thr was substituted by Ala. Our findings suggest that the dysregulation of Wnt/β-catenin signaling pathway is related to the tumorigenesis of some cases of DFB. This hypothesis indicates that there are some cases of DFB in which nuclear positive expression of β-catenin are useful for diagnosis.
Keywords: mandibula, desmoplastic fibroma, be-ta catenin
3
Introduction Desmoplastic fibroma of bone (DFB) is a rare bone tumor with an incidence rate of less than 0.1% of all primary bone tumors.1 DFB is a benign but locally aggressive tumor that is recognized as an osseous counterpart of desmoid-type fibromatosis (DF) based on morphological similarity.2, 3, 4 Majority of DF cases involve a CTNNB1 point mutation or APC germ-line mutation.5 However, both point mutations have been detected in a limited number of DFB cases. 6, 7 Herein, we present a case report of DFB harboring a CTNNB1 point mutation. Case presentation A 5-year-old boy without any developmental problems visited a dentist, complaining of jaw pain for a month and trismus since a few weeks recently. His left jaw was swollen, and the mandible slightly deviated to the right; however, the mass was indistinct on palpation (Figure 1A). A panoramic radiograph revealed a multilocular radiolucent tumor in the left mandible (Figure 1B). The patient was admitted to our hospital for further evaluation and treatment. Magnetic resonance imaging (MRI) revealed that the tumor (2.0 × 1.5 cm) was mainly located in the mandible and focally
4
expanded into the surrounding soft tissue (Figure 1C, 1D). The biopsy did not confirm the diagnosis, but DFB was suspected. The patient underwent surgical resection for radical treatment and definite diagnosis. At the time of surgery, we confirmed that the suspected central origin of the neoplastic process was in the mandible. Histologically, the tumor cells, which that showed uniform spindle-shaped nuclei with pale chromatin proliferated in fascicles. There were abundant collagenous stroma between tumor cells, and the cellularity was low. Blood vessels with perivascular edema were dispersed in the tumor. No mitotic figures or necrosis was observed (Figure 2A, 2B). Bone fragments were observed in the tumor periphery. Immunohistochemical analysis of the tumor cells revealed positive results for vimentin and α-SMA, but negative results for AE1/AE3 and S-100 protein. In addition, β-catenin had accumulated in the nuclei of tumor cells (Figure2C). Finally, we diagnosed the tumor as DFB based on histological features, the location of the tumor in MRI images, and the surgical findings. We performed PCR direct sequencing of CTNNB1 (exon3) and APC (exon15) using the primers presented in Table 1. An A-to-G transition was detected at codon 41 of
5
CTNNB1 (Figure 3), which resulted in the substitution of Thr by Ala. No mutation was detected in APC exon 15. Trismus and deviation of the mandible were improved greatly after the operation and the patient has been free from recurrence for one year. Discussion DFB was initially described by Jaffe et al. in 1958.3 DFB has been reported in various bones, although the mandible is mostly affected.1 In gnathic DFB, morbidity is reportedly female dominant and the average age of patients is 17 years (range: 6 months to 60 years).4 Histologically, DFB shows uniform spindle cells without atypia proliferating in fascicles and there are abundant collagenous stroma in the background. The microscopic appearance resembles DF.2 The only difference between DFB and DF is the location of the tumor: i.e., in bone and in soft tissue, respectively.8, 9 MRI is a useful tool to evaluate the relationship between the primary site and surrounding tissue.9 In the present case, MRI showed that most of the tumor was located in the mandible, which suggested it originated from bone and not soft tissue. The main subject of histological differential diagnosis is low-grade fibrosarcoma,
6
which shows the features of herringbone pattern, nuclear pleomorphism, and mitoses8). In addition, ossifying fibroma, fibrous dysplasia, low grade-central osteosarcoma, and odontogenic fibroma should also be differentiated from DFB; they intermix neoplastic bone components or odontogenic epithelial components.4 Our case did not show them. β-catenin, which is encoded by CTNNB1, is degraded by the APC/AXIN/GSK-3β-complex in the cytoplasm.5, 10 β-catenin is stabilized and translocated into the nucleus via the activation of the Wnt/β-catenin signaling pathway, where it binds to the T-cell factor/lymphoid enhancer factor, and acts as a transcription factor.10 As a result, the transcription of various genes, including some oncogenes such as c-myc or cyclinD1 is accelerated.10 Therefore, both mutations of CTNNB1 and APC may lead to tumorigenesis.11 The dysregulation of the Wnt/β-catenin signaling pathway is profoundly associated with the tumorigenesis of DF.11 DF is classified as sporadic and familial. Mutations at codons 41A, 45F, and 45P of CTNNB1 are mostly identified in the former, and the APC germ-line mutation is generally detected in the latter.5 In 70–75% of DF, nuclear expression of β-catenin is detected by immunohistochemistry, which is highly correlated with the somatic mutation of CTNNB1 or the germ-line mutation of APC.11, 12 However, in DFB, very
7
few cases demonstrate the mutation of CTNNB1 or APC. 7, 13 Flucke et al. presented one case of DFB with the common mutation of sporadic DF; although, it is controversial whether DFB and DF are genetically identical.1, 7, 14 In the present case, nuclear β-catenin was positively expressed, and we successfully identified an A-to-G transition at codon 41 of CTNNB1, which is typical in sporadic DF.5 Previous reports and our result suggest a possibility that DFB shows genetic diversity, in other words, some cases of DFB harbor gene mutations that are similar to those in DF but others not. There will be a need to reveal more molecular understanding about tumorigenesis of DFB that is different from DF. Because the recurrence rates of DFB are high, at 20~40% in enucleation and 70% in curettage, the most common treatment is complete surgical resection with wide margin. 8
However, the effects of radiation therapy and chemotherapy remain unclear.10 It is
difficult to demarcate the histopathological margins of DFB. Immunostaing of β-catenin may be helpful in clarifying the border; however, this method would be limited to the cases with positive expression of immunohistochemical nuclear β-catenin. In other words, the method would only be suitable for cases where the expression are positive in the neoplasm while being negative in the surrounding
8
tissue. In conclusion, we present a case report of DFB harboring a CTNNB1 point mutation, which is identical to that of sporadic DF. The present case indicates that there may be a group of DFB cases that involve dysregulation of the Wnt/β-catenin signaling pathway which is associated with the tumorigenesis of DF. Acknowledgements We would like to thank Editage (www.editage.lp) for English language editing. References 1) E. Hauben, A.M. Cleton-Jansen, Desmoplastic fibroma of bone, in: C.D. Fletcher, J.A. Bridge, P.C. Hogendoorn, F. Mertens (Eds.), WHO classification of tumours of soft tissue and bone, Lyon, IARC Press, 2013, pp. 298. 2) A. Ferri, M. Leporati, D. Corradi, T. Ferri, E. Sesenna, Huge desmoplastic fibroma of the paediatric mandible: surgical considerations and follow-up in three cases, J. Craniomaxillofac. Surg. 41 (2013) 367–370. 3) H.L. Jaffe, Tumors and tumorous conditions of the bones and joints, Lea & Febiger, Philadelphia, 1958, pp. 298–303.
9
4) T.R. Woods, D.M. Cohen, M.N. Islam, Y. Rawal, I. Bhattacharyya. Desmoplastic fibroma of the mandible: a series of three cases and review of literature, Head Neck Pathol. 9 (2015) 196–204. 5) A.J. Lazar, D. Tuvin, S. Hajibashi, S. Habeeb, S. Bolshakov, E. Mayordomo-Aranda, C.L. Warneke, D. Lopez-Terrada, R.E. Pollock, D. Lev, Specific mutations in the beta-catenin gene (CTNNB1) correlate with local recurrence in sporadic desmoid tumors, Am. J. Pathol. 173 (2008) 1518–1527. 6) A.E. Horvai, R.C. Jordan, Fibro-osseous lesions of the craniofacial bones: β-catenin immunohistochemical analysis and CTNNB1 and APC mutation analysis, Head Neck Pathol. 8 (2014) 291–297. 7) U. Flucke, B.B. Tops, P.J. van Diest, P.J. Slootweg, Desmoid-type fibromatosis of the head and neck region in the paediatric population: a clinicopathological and genetic study seven cases, Histopathol. 64 (2014) 769–776. 8) N. Said-Al-Naief, R. Fernandes, P. Louis, W. Bell, G.P. Siegal, Desmoplastic fibroma of the jaw: a case report and review of literature, Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 101 (2006) 82–94.
10
9) Y. Takahashi, T. Kono, K. Ono, K. Kawano, Aggressive fibromatosis of the mandibular region: A report of an infant case, J. Jpn. Stomatol. Soc. 61 (2012) 337–343.
10) A. Kawahara, H. Harada, H. Abe, T. Yamaguchi, T. Taira, K. Nakashima, H.
Mihashi, J. Akiba, M. Kage, Nuclear β-catenin expression in basal cell adenomas of salivary gland, J. Oral Pathol. Med. 40 (2011) 460–466.
11) T.L. Ng, A.M. Gown, T.S. Barry, M.C. Cheang, A.K. Chan, D.A. Turbin, F.D. Hsu, R.B. West, T.O. Nielsen, Nuclear beta-catenin in mesenchymal tumors, Mod. Pathol. 18 (2005) 68–74. 12) J.R. Goldblum, J.A. Fletcher, Desmoid-type fibromatosis, in: C.D. Fletcher, J.A. Bridge, P.C. Hogendoorn, F. Mertens (Eds.), WHO classification of tumours of soft tissue and bone, Lyon, IARC Press, 2013, pp. 72–73. 13) E.I. Hauben, G. Jundt, A.M. Cleton-Jansen, A. Yavas, H.M. Kroon, E. Van Marck, P.C. Hogendoorn, Desmoplastic fibroma of bone: an immunohistochemical study including beta-catenin expression and mutational analysis for beta-catenin, Hum. Pathol. 36 (2005) 1025–1030.
11
14) U. Flucke, H. Coleman, Desmoplastic fibroma, in: A.K. El-Nagger, J.K. Chan, J.R. Grandis, T. Takata, P.J. Slootweg (Eds.), WHO classification of head and neck tumours, Lyon, IARC Press, 2016, p. 250.
12
Figure Legends
(A)
(B)
13
(C)
14
(D) Figure 1. Pre-operative images. A. The patient’s left jaw is swollen and the mandible slightly deviates to the right. B. The panoramic radiograph shows a multilocular translucent tumor in the left mandible.
C, D. Magnetic resonance imaging demonstrates that the mass in the mandible expanded into surrounding soft tissue focally. It is isodense with skeletal muscle in T1WI and slightly hyperintense in T2WI.
15
(A)
(B)
16
(C) Figure 2. Histopathological findings from resected specimen. A. The tumor proliferated in fascicles. There is abundant collagenous stroma in the background. Cellularity is low. B. The tumor cells show uniform spindle-shaped nuclei with pale chromatin. There are no mitotic figures. C. Imunohistochemically, beta-catenin proteins accumulate in the nuclei of tumor cells.
17
Figure 3. DNA sequencing result of CTNNB1.
The black arrow shows the position of the point mutation. A to G transition at codon 41 of CTNNB1 is detected.
18
Table 1. Primers APC primer1-F
ACCTTCATCTAATGCCAAGAGG
APC primer1-R
GTCTGCTGGATTTGGTTCTAGG
APC primer2-F
TTGGAACTAGGTCAGCTGAAGA
APC primer2-R
ATGGTTTGTCCAGGGCTATCT
APC primer3-F
GCATTATAAGCCCCAGTGATCT
APC primer3-R
TGCTCTGATTCTGTTTCATTCC
APC primer4-F
ATAATGCCTCCAGTTCAGGAAA
APC primer4-R
AACTAACATGCTTTTGGGGTTG
CTNNB1 primer1-F
ATGGGTCATATCACAGATTC
CTNNB1 primer1-R
TGACTTTCAGTAAGGCAATG
19