- Email: [email protected]
A comparison of two extraction methods for the detection of Enteroviruses in raw sludge
Journal of Virological Methods 200 (2014) 1–5
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A comparison of two extraction methods for the detection of Enteroviruses in raw sludge Sihem Jebri a , Fatma Hmaied a,∗ , Francisco Lucena b , Marià Eugenià Saavedra b , Mariem Yahya a , Moktar Hamdi c a Unité de Microbiologie et de Biologie Moléculaire, Centre National des Sciences et Technologies Nucléaires, Technopôle de Sidi Thabet, 2020 Sidi Thabet, Tunisia b Barcelona University, Department of Microbiology, Diagonal 645, 08028 Barcelona, Spain c Tunis Carthage University, Institut National Sciences Appliquées de Tunis, Laboratoire Ecologie Technologie Microbienne, BP 676, 1080 Tunis, Tunisia
a b s t r a c t Article history: Received 29 October 2013 Received in revised form 17 January 2014 Accepted 24 January 2014 Available online 3 February 2014 Keywords: Enteroviruses Sludge Somatic coliphages F-specific RNA phages qRT-PCR Viral extraction
The aim of this study was to compare two viral extraction methods for the detection of naturally occurring Enteroviruses in raw sludge. The first method (M1) is based on an ultracentrifugation step. In the second one (M2), viral RNA was extracted directly after viral elution from suspended solids. Genomes of enteroviruses were quantified by a quantitative real time PCR (qRT-PCR) in sludge samples. Somatic coliphages and F-specific RNA phages, considered as viral indicators of enteric viruses in sludge, were enumerated by the double layer agar technique. Results showed that direct assay of RNA extraction yielded higher genomic copies of enteric viruses (with an average of 5.07 Log10 genomic copies/100 mL). After the ultracentrifugation assay in the second method, genomic copies number decreases (with an average of 4.39 Log10 genomic copies/100 mL). This can be explained by an eventual concentration of inhibitors existing in sludge samples. Phages enumeration results showed their presence in all sludge samples with an average of (5.69 Log10 PFU/100 mL) for somatic coliphages and (4 Log10 PFU/100 mL) for F-specific RNA phages. This emphasizes the use of somatic coliphages as viral indicators for enteroviruses in environmental samples and especially in raw sludge samples in wastewater treatment plants prior to agricultural use. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Waterborne pathogens, including viruses and protozoa, are excreted at high concentrations in feces of infected individuals. They are transmitted primarily through the fecal–oral route by consumption of contaminated food or water or directly by personto-person transmission. These pathogens are invariably present in sewage water and sewage sludge and are not removed efficiently by sewage treatment. Sludges derived from wastewater treatment are biologically unstable substances containing numerous pathogenic microorganisms such as enteric viruses. They also consist of organic matter that can be used as agricultural fertilizer. Sludges must be virologically tested prior to spreading by the counting of infectious enterovirus particles. Numerous studies have documented the presence of enteroviruses in sludge (Craun, 1984). Those viruses are shed in large quantities and disseminate widely in the environment
∗ Corresponding author. Tel.: +216 71537410; fax: +216 71537555. E-mail address: [email protected] (F. Hmaied). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.018
representing a potential risk to human health, mainly due to their stability under adverse conditions (Bosch et al., 2008) and low numbers are able to initiate infection in humans. Commonly used methods for enteroviruses detection in environmental samples relies on inoculation of specific cell cultures. This procedure is very time consuming and expensive (Sobsey, 1982). Furthermore, many of these viral agents cannot be cultivated (Binn et al., 1984). Therefore, the polymerase chain reaction PCR), a low cost and faster detection method, has come into use (Rotbart, 1990; Abbaszadegan et al., 1999; Pillai et al., 1991; Dubois et al., 1997). Real time reverse transcription PCR (qRT-PCR) allowing quantitative detection of RNA viruses has improved environmental virology surveys due to its sensitivity, specificity and ability to detect quickly a wide group of viruses in environmental samples (Bofill-Mas et al., 2006; De Paula et al., 2007; Girones et al., 2010). This technique is applicable to the detection of low titers of viruses in complex environmental samples such as sewage sludge. Numerous methods have been described for extracting enteric viruses from sewage sludges (Scheuerman et al., 1986; Schwartzbrod and Mathieu, 1986; Shimohara et al., 1986; Safferman et al., 1988; Stetler et al., 1992; Straub et al., 1994a,b;
2
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
Mignotte-Cadiergues et al., 1999). Typical environmental sample extraction procedures developed to purify virions are not always compatible with reverse transcription polymerase reaction (RT-PCR). To determine the efficiency of such methods, a representative virus is chosen and seeded into sludge samples, and then tested. Basically, all available procedures have been evaluated using samples spiked with known viruses. It is known that the recovery efficiency recorded with experimentally contaminated water decrease dramatically when the method is applied to naturally occurring viruses in environmental samples. This may be due to the fact that spiking microbes (or other particles) into sludges does not mimic exactly the in vivo situation, since it does not take account of microbes included in matrix the sludge flocks. To the best of our knowledge, no systematic study has been reported the effect of ultracentrifugation method on naturally occurring Enterovirus detection by qRT-PCR in raw sludge. The aim of the current study was to compare two extraction methods of viruses eluted from sludges: The first method includes an ultracentrifugation step for viral concentration prior to RNA extraction for qRT-PCR amplification, in the second one viral RNA was directly extracted and quantified. Otherwise, somatic coliphages and F specific RNA phages share similar morphological characteristics with enteric viruses. Thus, they are used as surrogates or process indicators of the efficiency of treatment processes to remove pathogenic viruses (Tanji et al., 2002; Arraj et al., 2005; Nappier et al., 2006) present in high numbers in environmental matrices. Titers of these phages have been determined in the present work to evaluate the effectiveness of sludge treatment processes. 2. Material and methods 2.1. Sewage sludge samples Raw sludge samples were collected from an urban medium charge wastewater treatment plant (WWTP) in North Tunisia. Treatment is based on activated sludge process in all plants; its influents are mainly domestic sewage. Viral extraction was performed within 48 h of sample collection. 2.2. Samples conditioning and viral elution The applied method for the elution of viruses from sludge samples is adapted from the one reported by the United States Environmental Protection Agency standards (USEPA, 2003). Conditioning of sludge binds un-adsorbed viruses present in the liquid matrix to the sludge solids using AlCl3 and varying samples pH. 2.3. Viral extraction Viruses were extracted from samples using the two methods M1 and M2. Each extraction experiment was done in triplicate. M1: 42 mL of the concentrated eluate of sludge samples were concentrated as described (Puig et al., 1994). Briefly, samples were centrifuged at high speed (110,000 × g for 1 h at 4 ◦ C) to pellet viral particles together with suspended material. The pellet was eluted with 0.25 N glycine buffer (pH 9.5), and suspended solids were
separated by centrifugation at 12,000 × g for 20 min. Viruses were concentrated finally by ultracentrifugation (110,000 × g for 1 h at 4 ◦ C), re-suspended in 1 mL of PBS, and stored at −80 ◦ C. M2: The eluate was filtered through a 0.22 m pore size membrane (Millex-GS, SLGS0250S, Molsheim, France), collected as virus concentrate and stored at −80 ◦ C prior to RNA extraction. 2.4. Viral genome detection 2.4.1. Viral RNA extraction RNA was extracted from 140 L concentrate with QiAamp viral RNA kit (Qiagen, Netherlands) according to the manufacturer’s instructions. 2.4.2. Real-time PCR amplification PCR protocols for Enteroviruses’ detection and quantification, as well as the target region on the genome and length of the amplicon generated are shown in Table 1. The primers and probes sequences used to amplify and detect viral genomes targeted the conserved sequences at 5 un-transcribed region of Enteroviral genome (5 UTR). To avoid false-positive results, quality control measures such as using separate rooms were adopted and each set of amplifications included two negative controls: double-distilled sterile water after RNA extraction procedure, and a negative sample (mineral water) and one positive control Coxsackievirus CB3 RNA. The quantitative RT-PCR was performed in a final volume of 25 mL by using the RNA UltrasenseTM One-step Quantitative RT-PCR System (Invitrogen, California, USA) kit. Reaction mix containing 1 g of RNA template, 0.2 M primers, and 0.1 M probe were submitted to the following cycling conditions: reverse transcription step at 50 ◦ C for 30 followed by a hot start denaturing step at 94 ◦ C for 15 , and then 45 cycles of denaturation at 94 ◦ C for 15 , annealing at 60 ◦ C for 30 , and elongation at 72 ◦ C for 30 . All reactions were performed on the Step OneTM Real-Time PCR System (Applied Biosystems, California, USA). Amplification data were collected and analyzed using Sequence Detection Software version 1.0 (Applied Biosystems, California, USA). The detection method was validated with standard curves (11-fold successive dilutions of standard viral stock, n = 10). The standard curve is created by plotting the log number of enteroviral particles versus their corresponding cycle threshold (CT) value to create a best fit line through these points. The CT value is inversely related to the viral particles. The numbers of RNA copies present in each sample are estimated by comparing the sample CT value to standard curve. The final concentration were then adjusted based on the volume of nucleic acids analyzed and were expressed as genome copies (GC) per mL and per g of sludge sample analyzed. The number of GC is defined as the average of the data in triplicate obtained. The GC values are extrapolated to the number of enteroviruses GC in each sample. 2.4.3. Enterovirus qRT-PCR standard curve Standard curve is generated by transforming E. coli JM109 cells (Promega, Wisconsin, USA) with a pGEM-T Easy plasmid (Promega, Wisconsin, USA) containing a 155 bp sequence of a single copy of enteroviral 5 UTR insert. Colonies are selected and screened by conventional PCR to evaluate the presence of the vector containing the
Table 1 Enteroviruses primer sets and probe for qRT-PCR. Primer/probe name Entero F Entero 2R Entero S Tm : melting temperature.
Sequence (5 –3 ) TCCTCCGGCCCCTGAATGCG ATGTCACCATAAGCAGCCA 6FAMCGGAACCGACTACTTTGGGTGTC-BHQ-1
%GC 70 48 57
Tm
References ◦
64.8 C 54.2 ◦ C 65–70 ◦ C
Hwang et al. (2007) Nijhuis et al. (2002)
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
3
Fig. 2. Standard curve generated with successive dilutions of standard viral stock.
3. Results 3.1. Enterovirus qRT-PCR standard curve Fig. 1. Electrophoresis gel of conventional PCR to evaluate the presence of the vector containing the insert in transformed E. coli JM109 colonies; L (DNA ladder 100 pb); PC (positive control); NC (negative control); 1 and 2 (assayed colonies with PCR).
insert (Fig. 1). The vector is purified from the positive colonies using the Qiagen plasmid purification midikit (Qiagen, Netherlands) following the manufacturer’s instructions. The concentration of the vector construct is quantified by spectrophotometer. The number of GC/mL of the stock prepared for each gene is calculated. Serial decimal dilutions are made in TE buffer to prepare the standard curve for qRT-PCR. The standard dilutions are then aliquoted and stored at −80 ◦ C until use. Three replicates of each dilution are added to each reaction.
2.5. Somatic coliphages and F-RNA phages enumeration
The standard curve is created by plotting the log number of enteroviral particles versus their corresponding cycle threshold (CT) value to create a best fit line through these points. The CT value is inversely related to the viral particles (Fig. 2). Run acceptability is defined as a correlation coefficient (R2 ), in the 10 times, standard’s R2 ranged between 0.97 and 0.98. 3.2. Viral extraction methods statistics Results from the detected GC by qRT-PCR from raw sewage when submitted to enteroviral extraction methods are represented in a box plot (showing the median values) Fig. 3. The titer of Enteroviruses existing in collected sludge samples varied from the detection limit threshold 2.8 Log10 (PFU/100 mL) to 5.1 Log10 (PFU/100 mL) for M1, M2 yielded titers ranging between 4.7 Log10 (PFU/100 mL) and 5.3 Log10 (PFU/100 mL). Direct assay based method (M2) yielded significantly (p = 0.0029) higher GC than M1 including centrifugation step (Table 2). Extreme values were detected with M1 showing values under threshold detection limit.
Bacteriophages were isolated from activated sludge using the beef extract elution technique as described by Guzman et al. (2007). Phages were counted by plaque assay using their bacterial host. Plaque forming units (PFU) of somatic coliphages were counted by the double agar layer technique on strain WG5 of E. coli following the ISO 10705-1 standard (2000). F-specific RNA bacteriophages PFU numbers were determined on strain WG49 of Salmonella typhimurium, following the ISO 10705-1 standard (1995). Nalidixic acid and ampicillin were added to soft agar to prevent growth of background bacteria present in the sludge samples. The Petri plates were incubated at 37 ◦ C for up to 18 h prior to plaque enumeration.
2.6. Statistical analysis Experiments were carried out in triplicate with the six samples. Statistical analysis was performed using the Statgraphics statistical analysis software package (Statgraphics Plus 5.1; StatPoint, Virginia, USA). Some data were plotted as boxes and whiskers. This plotting provides a summary statistics using five numbers: the minimum, the maximum, the median, the 25th percentile and the 75th percentile.
Fig. 3. Box plot of Log10 enteroviral genomic copies extracted by the two methods (p = 0.0029).
4
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
Table 2 Descriptive statistics of viral concentration methods for naturally occurring Enterovirus detection by qRT-PCR from raw sludge samples.
M1 M2 a b c d
Meana
S.E. meanb
S. deviationc
Varianced
Skewness
Kurtosis
4.39E0 5.07E0
2.03E−1 5.32E−2
8.62E−1 2.25E−1
0.744 0.051
−1.31 −0.17
−0.03 −1.67
In Log10 GC/100 mL. Standard error of the mean in Log10 GC/100 mL. Standard deviation in Log10 GC/100 mL; in (Log10 GC/100 mL)2 . In (Log10 GC/100 mL)2 .
Fig. 4. Box plot of Log10 PFU/100 mL of enumerated somatic coliphages (SOMCPH) and F-specific RNA phages (FRNAPH).
3.3. Phages enumeration Sludge samples contain high numbers of somatic coliphages ranging between 4.8 Log10 PFU/100 mL and 6.3 Log10 PFU/100 mL. F-specific RNA phages titers were about 2 Logs lower than those of somatic coliphages, ranging between 3.2 Log10 PFU/100 mL and 4.9 Log10 PFU/100 mL (Fig. 4). The abundance of somatic coliphages in tested samples shows similar variations to F-specific RNA phages abundance. 4. Discussion The basic steps in virological analysis of water are sampling, concentration, decontamination and removal of inhibitors, and specific virus detection. Viral extraction is a particularly critical step since the viruses may be present in such low numbers that concentration of the water samples is indispensable to reduce the volume to be assayed to a few milliliters or even microliters (Bosch et al., 2011). A good viral extraction method should fulfill several requirements: it should be technically simple, fast, provide high virus recoveries, be adequate for a wide range of enteric viruses, provide a small volume of concentrate, and be inexpensive. No single method meets all these requirements. Sludge is a complex matrix containing many organic compounds and suspended solids that must be expulsed with viral extraction method. US-EPA suggested the ultracentrifugation at high speed as a concentration step for viral recovery from sludge samples. The purpose of this study was to evaluate two extraction methods for Enterovirus detection in sludge samples. Method M1 is based on ultracentrifugation step after a viral elution prior to viral RNA extraction while method M2 performed with the ultracentrifugation step and consists in a direct assay for viral RNA extraction
after viral elution from sludge samples. Generally speaking, the statistical analysis shows that method M2 generated higher recovery rates of viral genomes than method M1. Surprisingly, the ultracentrifugation step decreases viral particles recovery in naturally occurring samples. This study, to the best of our knowledge, is the first to compare these two methods of viral extraction from sludge sample and to prove the inhibitory effect of ultracentrifugation on the extraction of naturally occurring viruses in raw sludge. These findings suggest that a direct assay could be more accurate for genomic studies especially qRT-PCR quantification of enteric viruses, while ultracentrifugation could prove useful for infectivity studies. In fact, an ultracentrifugation step would concentrate both viral particles and inhibitors existing in environmental matrix like sludge samples which interfere with molecular methods for the detection of viruses in environmental samples. Additionally, proteins and carbohydrates can bind to nucleotides and magnesium ions, making them unavailable to the polymerase (Schwabb et al., 1995). However, it has to be considered that the direct method may not fulfill the requirement of samples with lower viral concentrations, as it may be the case of viruses in treated sludges. In fact, the loss in viral genomic copies number noticed with ultracentrifugation might be compensated by viral particles concentration when applied to lower viral titers. Somatic coliphages (Kott et al., 1974), F-specific RNA bacteriophages (Havelaar et al., 1984) and bacteriophages infecting Bacteroides fragilis (Jofre et al., 1986) have been suggested as model microorganisms for water quality assessment (Kott et al., 1974; Havelaar et al., 1984; Jofre et al., 1986; IAWPRC, 1991). Bacteriophages have several advantages as model organisms. Firstly, the methods are cheap, simple to perform and rapid. In fact, results for somatic coliphages are available after 4–6 h. Secondly, phenomena like “stress”, “injury”, or “reactivation”, which lead frequently to misinterpretation of environmental data on bacterial indicators, are greatly reduced. Finally, sample analysis may be delayed after collection, since reduction in the number of bacteriophages is presumed to be low when the sample is stored at −20 ◦ C according to data on the persistence of bacteriophages in the environment (Lasobras et al., 1999; Duran et al., 2002). In this study, high titers of somatic coliphages were detected by the double layer agar technique in all sludge samples. F-specific RNA phages were also present in all samples but with 2 Log10 PFU/100 mL lower concentrations. Results showed that somatic coliphages were detected in concentrations comparable to those of genomes of Enteric viruses. In fact, they are recognized as conservative indicators for fecal viruses when evaluating sludge treatment processes. Thus they could be used as surrogates of Enteric viruses. They are also used to determine the potential exposure to microbial pathogens from sewage sludges (Ahmed and Sorensen, 1995; Pillai et al., 1996; Arraj et al., 2005; Heinonen-Tanski et al., 2009; Wu et al., 2010; Rouch et al., 2011). Further studies are required to establish the correlation between coliphages and Enteric viruses. 5. Conclusion This study is the first to the best of our knowledge to evaluate the effect of viral extraction method based on ultracentrifugation from
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
raw sludge samples. It highlights the decreasing viral recovery after an ultracentrifugation step according to a standardized method assayed on naturally occurring enteroviruses in sludge samples. The standardized virological assays must take onto consideration the complexity of environmental matrices. Furthermore, the recovery efficiency recorded with experimentally contaminated sludge decrease when the method is applied to naturally occurring viruses in raw samples. This study emphasizes also the use of somatic coliphages as viral indicators for enteroviruses in environmental samples and especially in raw sludge samples in wastewater treatment plants prior to agricultural use. Disclosure statement We disclose any actual or potential conflict of interest including any financial, personal or other relationships with other people or organizations within three (3) years of beginning the work submitted that could inappropriately influence our work. Acknowledgments This research was carried out within the framework of, the European Union (ROUTES-FP7-ENV-2010-265156), the Generalitat de Catalunya (2009-SGR-01043), and 3-PCI-Tunisia Spanish Agency for International Cooperation for Development (AECID), it was also supported by Centre National des Sciences et Technologies Nucléaires. References Abbaszadegan, M., Stewart, P., Le Chevalier, M., 1999. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, 444–449. Ahmed, A.U., Sorensen, D.L., 1995. Kinetics of pathogen destruction during storage of dewatered biosolids. Water Environ. Res. 67, 143–150. Arraj, A., Bohatier, J., Laveran, H., Traore, O., 2005. Comparison of bacteriophage and enteric virus removal in pilot scale activated sludge plants. J. Appl. Microbiol. 98, 516–524. Binn, L.N., Lemon, S.M., Marchwicki, R.H., Redfield, R.R., Gates, N.L., Bancroft, W.H., 1984. Primary isolation and serial passage of hepatitis A strains in primate cell cultures. J. Clin. Microbiol. 20, 28–33. Bofill-Mas, S., Albinana-Gimenez, N., Clemente-Casares, P., Hundesa, A., Rodri-guezManzano, J., Allard, A., Calvo, M., Girones, R., 2006. Quantification and stability of human adenovirus and polyomavirus JCPyV in wastewater matrices. Appl. Environ. Microbiol. 72, 7894–7896. Bosch, A., Guix, S., Sano, D., Pintó, R.M., 2008. New tools for the study and direct surveillance of viral pathogens in water. Curr. Opin. Biotechnol. 19, 295–301. Bosch, A., Sanchez, G., Abbaszadegan, M., Carducci, A., Guix, S., Le Guyader, F.S., Netshikweta, R., Pintó, R.M., van der Poel, W.H.M., Rutjes, S., 2011. Analytical methods for virus detection in water and food. Food Anal. Methods 4, 4–12. Craun, G.F., 1984. Health aspects of groundwater pollution. In: Bitton, G., Gerba, C.P. (Eds.), Groundwater Pollution Microbiology. John Wiley & Sons, Inc., New York, pp. 135–179. De Paula, V.S., Diniz-Mendes, L., Villar, L.M., Luz, S.L.B., Silva, L.A., Jesus, M.S., Da Silva, N.M.V.S., Gaspar, A.M.C., 2007. Hepatitis A virus in environmental water samples from the Amazon Basin. Water Res. 41, 1169–1176. Dubois, E., Le Guyader, F., Haugarreau, L., Kopecka, M., Pommepuy, M., 1997. Molecular epidemiological survey of rotaviruses in sewage by reverse transcriptase seminested PCR and restriction fragment length polymorphism assay. Appl. Environ. Microbiol. 63, 1794–1800. Duran, A.E., Muniesa, M., Méndez, X., Valero, F., Lucena, F., Jofre, J., 2002. Removal and inactivation of indicator bacteriophages in fresh waters. J. Appl. Microbiol. 92, 338–347. Girones, R., Ferrus, M.A., Alonso, J.L., Rodriguez-Manzano, J., Calgua, B., Correa, A.B., Hundesa, A., Carratala, A., Bofill-Mas, S., 2010. Molecular detection of pathogens in water – the pros and cons of molecular techniques. Water Res. 44, 4325–4339.
5
Guzman, C., Jofre, J., Blanch, A.R., Lucena, F., 2007. Development of a feasible method to extract somatic coliphages from sludge, soil and treated biowaste. J. Virol. Methods 144 (1–2), 41–48. Havelaar, A.H., Hogeboom, W.M., Pot, R., 1984. F-specific RNA bacteriophages in sewage; methodology and occurrence. Water Sci. Technol. 17, 645–655. Heinonen-Tanski, H., Reponen, T., Koivunen, J., 2009. Airborne enteric coliphages and bacteria in sewage treatment plants. Water Res. 43, 2558–2566. Hwang, Y.C., Leong, O.M., Chen, W., Yates, M.V., 2007. Comparison of a reporter assay and immunomagnetic separation real-time reverse transcription-PCR for the detection of enteroviruses in seeded environmental water samples. Appl. Environ. Microbiol. 73, 2338–2340. IAWPRC, 1991. Bacteriophages as model viruses in water quality control. Water Res. 25, 529–545. Jofre, J., Bosch, A., Lucena, F., Girones, R., Tartera, C., 1986. Evaluation of Bacteroides fragilis bacteriophages as indicators of the virological quality of water. Water Sci. Technol. 18, 167–173. Kott, Y., Roze, N., Sperber, S., Betzer, N., 1974. Bacteriophages as viral pollution indicators. Water Res. 8, 165–171. Lasobras, J., Dellundé, J., Jofre, J., Lucena, F., 1999. Occurrence and levels of phages proposed as surrogate indicators of enteric viruses in different types of sludges. J. Appl. Microbiol. 86, 723–729. Mignotte-Cadiergues, B., Maul, A., Schwartzbrod, L., 1999. Comparative study of techniques used to recover viruses from residual urban sludge. J. Virol. Methods 78, 71–80. Nappier, S.P., Aitken, M.D., Sobsey, M.D., 2006. Male-specific coliphages as indicators of thermal inactivation of pathogens in biosolids. Appl. Environ. Microbiol. 72, 2471–2475. Nijhuis, M., Van Maarseveen, N., Schuurman, R., Verkuijlen, S., De Vos, M., Hendriksen, K., Van Loon, A.M., 2002. Rapid and sensitive routine detection of all members of the genus enterovirus in different clinical specimens by real-time PCR. J. Clin. Microbiol. 40, 3666–3670. Pillai, S.D., Josephson, K.L., Baily, R.L., Gerba, C.P., Pepper, I.L., 1991. Rapid method for processing soil samples for polymerase chain reaction amplification of specific gene sequences. Appl. Environ. Microbiol. 57, 2285–2286. Pillai, S.D., Widmer, K.W., Dowd, S.E., Ricke, S.C., 1996. Occurrence of airborne bacteria and pathogen indicators during land application of sewage sludge. Appl. Environ. Microbiol. 62, 296–299. Puig, M., Jofre, J., Lucena, F., Allard, A., Wadell, G., Girones, R., 1994. Detection of adenoviruses and enteroviruses in polluted waters by nested PCR amplification. Appl. Environ. Microbiol. 60, 2963–2970. Rotbart, H.A., 1990. Diagnosis of enteroviral meningitis with the polymerase chain reaction. J. Pediatr. 117, 85–89. Rouch, D.A., Mondal, T., Pai, S., Glauche, F., Fleming, V.A., Thurbon, N., Blackbeard, J., Smith, S.R., Deighton, M., 2011. Microbial safety of air-dried and rewetted biosolids. J. Water Health 9, 403–414. Safferman, R.S., Rohr, M.E., Goyke, T., 1988. Assessment of recovery efficiency of beef extract reagents for concentrating viruses from municipal waste-water sludge solids by the organic flocculation procedure. Appl. Environ. Microbiol. 54, 309–316. Scheuerman, P.R., Farrah, S.R., Bitton, G., 1986. Development of a method for the recovery of enteroviruses from aerobically digested wastewater sludges. Water Res. 20, 15–19. Schwabb, K.J., De Leon, R., Sobsey, M.D., 1995. Concentration and purification of beef extract mock eluates from water samples for the detection of enteroviruses, hepatitis A and Norwalk virus by reverse transcription PCR. Appl. Environ. Microbiol. 61, 531–537. Schwartzbrod, L., Mathieu, C., 1986. Virus recovery from waste-water treatment plant sludges. Water Res. 20, 1011–1013. Shimohara, E., Nashida, M., Kaneko, M., 1986. Studies of procedures for recovery of viruses from activated-sludge. Water Sci. Technol. 18, 149–156. Sobsey, M.D., 1982. Quality of currently available methodology for monitoring viruses in the environment. Environ. Int. 7, 39–51. Stetler, R.E., Morris, M.E., Safferman, R.S., 1992. Processing procedures for recovering enteric viruses from waste-water sludges. J. Virol. Methods 40, 67–75. Straub, T.M., Pepper, I.L., Abbaszadegan, M., Gerba, C.P., 1994a. A method to detect enteroviruses in sewage sludge-amended soil using the PCR. Appl. Environ. Microbiol. 60, 1014–1017. Straub, T.M., Pepper, I.L., Gerba, C.P., 1994b. Detection of naturally-occurring enteroviruses and hepatitis-a virus in undigested and anaerobically digested sludge using the polymerase chain-reaction. Can. J. Microbiol. 40, 884–888. Tanji, Y., Mizoguchi, K., Yoichi, M., Morita, M., Hori, K., Unno, H., 2002. Fate of coliphage in a wastewater treatment process. J. Biosci. Bioeng. 94, 172–174. USEPA 625/R92/013, 2003. Control of pathogens and vector attraction in sewage sludge, Cincinnati, OH. Wu, J.L., Li, H.T., Huang, X., 2010. Indigenous somatic coliphage removal from a real municipal wastewater by a submerged membrane bioreactor. Water Res. 44, 1853–1862.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A comparison of two extraction methods for the detection of Enteroviruses in raw sludge Sihem Jebri a , Fatma Hmaied a,∗ , Francisco Lucena b , Marià Eugenià Saavedra b , Mariem Yahya a , Moktar Hamdi c a Unité de Microbiologie et de Biologie Moléculaire, Centre National des Sciences et Technologies Nucléaires, Technopôle de Sidi Thabet, 2020 Sidi Thabet, Tunisia b Barcelona University, Department of Microbiology, Diagonal 645, 08028 Barcelona, Spain c Tunis Carthage University, Institut National Sciences Appliquées de Tunis, Laboratoire Ecologie Technologie Microbienne, BP 676, 1080 Tunis, Tunisia
a b s t r a c t Article history: Received 29 October 2013 Received in revised form 17 January 2014 Accepted 24 January 2014 Available online 3 February 2014 Keywords: Enteroviruses Sludge Somatic coliphages F-specific RNA phages qRT-PCR Viral extraction
The aim of this study was to compare two viral extraction methods for the detection of naturally occurring Enteroviruses in raw sludge. The first method (M1) is based on an ultracentrifugation step. In the second one (M2), viral RNA was extracted directly after viral elution from suspended solids. Genomes of enteroviruses were quantified by a quantitative real time PCR (qRT-PCR) in sludge samples. Somatic coliphages and F-specific RNA phages, considered as viral indicators of enteric viruses in sludge, were enumerated by the double layer agar technique. Results showed that direct assay of RNA extraction yielded higher genomic copies of enteric viruses (with an average of 5.07 Log10 genomic copies/100 mL). After the ultracentrifugation assay in the second method, genomic copies number decreases (with an average of 4.39 Log10 genomic copies/100 mL). This can be explained by an eventual concentration of inhibitors existing in sludge samples. Phages enumeration results showed their presence in all sludge samples with an average of (5.69 Log10 PFU/100 mL) for somatic coliphages and (4 Log10 PFU/100 mL) for F-specific RNA phages. This emphasizes the use of somatic coliphages as viral indicators for enteroviruses in environmental samples and especially in raw sludge samples in wastewater treatment plants prior to agricultural use. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Waterborne pathogens, including viruses and protozoa, are excreted at high concentrations in feces of infected individuals. They are transmitted primarily through the fecal–oral route by consumption of contaminated food or water or directly by personto-person transmission. These pathogens are invariably present in sewage water and sewage sludge and are not removed efficiently by sewage treatment. Sludges derived from wastewater treatment are biologically unstable substances containing numerous pathogenic microorganisms such as enteric viruses. They also consist of organic matter that can be used as agricultural fertilizer. Sludges must be virologically tested prior to spreading by the counting of infectious enterovirus particles. Numerous studies have documented the presence of enteroviruses in sludge (Craun, 1984). Those viruses are shed in large quantities and disseminate widely in the environment
∗ Corresponding author. Tel.: +216 71537410; fax: +216 71537555. E-mail address: [email protected] (F. Hmaied). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.018
representing a potential risk to human health, mainly due to their stability under adverse conditions (Bosch et al., 2008) and low numbers are able to initiate infection in humans. Commonly used methods for enteroviruses detection in environmental samples relies on inoculation of specific cell cultures. This procedure is very time consuming and expensive (Sobsey, 1982). Furthermore, many of these viral agents cannot be cultivated (Binn et al., 1984). Therefore, the polymerase chain reaction PCR), a low cost and faster detection method, has come into use (Rotbart, 1990; Abbaszadegan et al., 1999; Pillai et al., 1991; Dubois et al., 1997). Real time reverse transcription PCR (qRT-PCR) allowing quantitative detection of RNA viruses has improved environmental virology surveys due to its sensitivity, specificity and ability to detect quickly a wide group of viruses in environmental samples (Bofill-Mas et al., 2006; De Paula et al., 2007; Girones et al., 2010). This technique is applicable to the detection of low titers of viruses in complex environmental samples such as sewage sludge. Numerous methods have been described for extracting enteric viruses from sewage sludges (Scheuerman et al., 1986; Schwartzbrod and Mathieu, 1986; Shimohara et al., 1986; Safferman et al., 1988; Stetler et al., 1992; Straub et al., 1994a,b;
2
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
Mignotte-Cadiergues et al., 1999). Typical environmental sample extraction procedures developed to purify virions are not always compatible with reverse transcription polymerase reaction (RT-PCR). To determine the efficiency of such methods, a representative virus is chosen and seeded into sludge samples, and then tested. Basically, all available procedures have been evaluated using samples spiked with known viruses. It is known that the recovery efficiency recorded with experimentally contaminated water decrease dramatically when the method is applied to naturally occurring viruses in environmental samples. This may be due to the fact that spiking microbes (or other particles) into sludges does not mimic exactly the in vivo situation, since it does not take account of microbes included in matrix the sludge flocks. To the best of our knowledge, no systematic study has been reported the effect of ultracentrifugation method on naturally occurring Enterovirus detection by qRT-PCR in raw sludge. The aim of the current study was to compare two extraction methods of viruses eluted from sludges: The first method includes an ultracentrifugation step for viral concentration prior to RNA extraction for qRT-PCR amplification, in the second one viral RNA was directly extracted and quantified. Otherwise, somatic coliphages and F specific RNA phages share similar morphological characteristics with enteric viruses. Thus, they are used as surrogates or process indicators of the efficiency of treatment processes to remove pathogenic viruses (Tanji et al., 2002; Arraj et al., 2005; Nappier et al., 2006) present in high numbers in environmental matrices. Titers of these phages have been determined in the present work to evaluate the effectiveness of sludge treatment processes. 2. Material and methods 2.1. Sewage sludge samples Raw sludge samples were collected from an urban medium charge wastewater treatment plant (WWTP) in North Tunisia. Treatment is based on activated sludge process in all plants; its influents are mainly domestic sewage. Viral extraction was performed within 48 h of sample collection. 2.2. Samples conditioning and viral elution The applied method for the elution of viruses from sludge samples is adapted from the one reported by the United States Environmental Protection Agency standards (USEPA, 2003). Conditioning of sludge binds un-adsorbed viruses present in the liquid matrix to the sludge solids using AlCl3 and varying samples pH. 2.3. Viral extraction Viruses were extracted from samples using the two methods M1 and M2. Each extraction experiment was done in triplicate. M1: 42 mL of the concentrated eluate of sludge samples were concentrated as described (Puig et al., 1994). Briefly, samples were centrifuged at high speed (110,000 × g for 1 h at 4 ◦ C) to pellet viral particles together with suspended material. The pellet was eluted with 0.25 N glycine buffer (pH 9.5), and suspended solids were
separated by centrifugation at 12,000 × g for 20 min. Viruses were concentrated finally by ultracentrifugation (110,000 × g for 1 h at 4 ◦ C), re-suspended in 1 mL of PBS, and stored at −80 ◦ C. M2: The eluate was filtered through a 0.22 m pore size membrane (Millex-GS, SLGS0250S, Molsheim, France), collected as virus concentrate and stored at −80 ◦ C prior to RNA extraction. 2.4. Viral genome detection 2.4.1. Viral RNA extraction RNA was extracted from 140 L concentrate with QiAamp viral RNA kit (Qiagen, Netherlands) according to the manufacturer’s instructions. 2.4.2. Real-time PCR amplification PCR protocols for Enteroviruses’ detection and quantification, as well as the target region on the genome and length of the amplicon generated are shown in Table 1. The primers and probes sequences used to amplify and detect viral genomes targeted the conserved sequences at 5 un-transcribed region of Enteroviral genome (5 UTR). To avoid false-positive results, quality control measures such as using separate rooms were adopted and each set of amplifications included two negative controls: double-distilled sterile water after RNA extraction procedure, and a negative sample (mineral water) and one positive control Coxsackievirus CB3 RNA. The quantitative RT-PCR was performed in a final volume of 25 mL by using the RNA UltrasenseTM One-step Quantitative RT-PCR System (Invitrogen, California, USA) kit. Reaction mix containing 1 g of RNA template, 0.2 M primers, and 0.1 M probe were submitted to the following cycling conditions: reverse transcription step at 50 ◦ C for 30 followed by a hot start denaturing step at 94 ◦ C for 15 , and then 45 cycles of denaturation at 94 ◦ C for 15 , annealing at 60 ◦ C for 30 , and elongation at 72 ◦ C for 30 . All reactions were performed on the Step OneTM Real-Time PCR System (Applied Biosystems, California, USA). Amplification data were collected and analyzed using Sequence Detection Software version 1.0 (Applied Biosystems, California, USA). The detection method was validated with standard curves (11-fold successive dilutions of standard viral stock, n = 10). The standard curve is created by plotting the log number of enteroviral particles versus their corresponding cycle threshold (CT) value to create a best fit line through these points. The CT value is inversely related to the viral particles. The numbers of RNA copies present in each sample are estimated by comparing the sample CT value to standard curve. The final concentration were then adjusted based on the volume of nucleic acids analyzed and were expressed as genome copies (GC) per mL and per g of sludge sample analyzed. The number of GC is defined as the average of the data in triplicate obtained. The GC values are extrapolated to the number of enteroviruses GC in each sample. 2.4.3. Enterovirus qRT-PCR standard curve Standard curve is generated by transforming E. coli JM109 cells (Promega, Wisconsin, USA) with a pGEM-T Easy plasmid (Promega, Wisconsin, USA) containing a 155 bp sequence of a single copy of enteroviral 5 UTR insert. Colonies are selected and screened by conventional PCR to evaluate the presence of the vector containing the
Table 1 Enteroviruses primer sets and probe for qRT-PCR. Primer/probe name Entero F Entero 2R Entero S Tm : melting temperature.
Sequence (5 –3 ) TCCTCCGGCCCCTGAATGCG ATGTCACCATAAGCAGCCA 6FAMCGGAACCGACTACTTTGGGTGTC-BHQ-1
%GC 70 48 57
Tm
References ◦
64.8 C 54.2 ◦ C 65–70 ◦ C
Hwang et al. (2007) Nijhuis et al. (2002)
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
3
Fig. 2. Standard curve generated with successive dilutions of standard viral stock.
3. Results 3.1. Enterovirus qRT-PCR standard curve Fig. 1. Electrophoresis gel of conventional PCR to evaluate the presence of the vector containing the insert in transformed E. coli JM109 colonies; L (DNA ladder 100 pb); PC (positive control); NC (negative control); 1 and 2 (assayed colonies with PCR).
insert (Fig. 1). The vector is purified from the positive colonies using the Qiagen plasmid purification midikit (Qiagen, Netherlands) following the manufacturer’s instructions. The concentration of the vector construct is quantified by spectrophotometer. The number of GC/mL of the stock prepared for each gene is calculated. Serial decimal dilutions are made in TE buffer to prepare the standard curve for qRT-PCR. The standard dilutions are then aliquoted and stored at −80 ◦ C until use. Three replicates of each dilution are added to each reaction.
2.5. Somatic coliphages and F-RNA phages enumeration
The standard curve is created by plotting the log number of enteroviral particles versus their corresponding cycle threshold (CT) value to create a best fit line through these points. The CT value is inversely related to the viral particles (Fig. 2). Run acceptability is defined as a correlation coefficient (R2 ), in the 10 times, standard’s R2 ranged between 0.97 and 0.98. 3.2. Viral extraction methods statistics Results from the detected GC by qRT-PCR from raw sewage when submitted to enteroviral extraction methods are represented in a box plot (showing the median values) Fig. 3. The titer of Enteroviruses existing in collected sludge samples varied from the detection limit threshold 2.8 Log10 (PFU/100 mL) to 5.1 Log10 (PFU/100 mL) for M1, M2 yielded titers ranging between 4.7 Log10 (PFU/100 mL) and 5.3 Log10 (PFU/100 mL). Direct assay based method (M2) yielded significantly (p = 0.0029) higher GC than M1 including centrifugation step (Table 2). Extreme values were detected with M1 showing values under threshold detection limit.
Bacteriophages were isolated from activated sludge using the beef extract elution technique as described by Guzman et al. (2007). Phages were counted by plaque assay using their bacterial host. Plaque forming units (PFU) of somatic coliphages were counted by the double agar layer technique on strain WG5 of E. coli following the ISO 10705-1 standard (2000). F-specific RNA bacteriophages PFU numbers were determined on strain WG49 of Salmonella typhimurium, following the ISO 10705-1 standard (1995). Nalidixic acid and ampicillin were added to soft agar to prevent growth of background bacteria present in the sludge samples. The Petri plates were incubated at 37 ◦ C for up to 18 h prior to plaque enumeration.
2.6. Statistical analysis Experiments were carried out in triplicate with the six samples. Statistical analysis was performed using the Statgraphics statistical analysis software package (Statgraphics Plus 5.1; StatPoint, Virginia, USA). Some data were plotted as boxes and whiskers. This plotting provides a summary statistics using five numbers: the minimum, the maximum, the median, the 25th percentile and the 75th percentile.
Fig. 3. Box plot of Log10 enteroviral genomic copies extracted by the two methods (p = 0.0029).
4
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
Table 2 Descriptive statistics of viral concentration methods for naturally occurring Enterovirus detection by qRT-PCR from raw sludge samples.
M1 M2 a b c d
Meana
S.E. meanb
S. deviationc
Varianced
Skewness
Kurtosis
4.39E0 5.07E0
2.03E−1 5.32E−2
8.62E−1 2.25E−1
0.744 0.051
−1.31 −0.17
−0.03 −1.67
In Log10 GC/100 mL. Standard error of the mean in Log10 GC/100 mL. Standard deviation in Log10 GC/100 mL; in (Log10 GC/100 mL)2 . In (Log10 GC/100 mL)2 .
Fig. 4. Box plot of Log10 PFU/100 mL of enumerated somatic coliphages (SOMCPH) and F-specific RNA phages (FRNAPH).
3.3. Phages enumeration Sludge samples contain high numbers of somatic coliphages ranging between 4.8 Log10 PFU/100 mL and 6.3 Log10 PFU/100 mL. F-specific RNA phages titers were about 2 Logs lower than those of somatic coliphages, ranging between 3.2 Log10 PFU/100 mL and 4.9 Log10 PFU/100 mL (Fig. 4). The abundance of somatic coliphages in tested samples shows similar variations to F-specific RNA phages abundance. 4. Discussion The basic steps in virological analysis of water are sampling, concentration, decontamination and removal of inhibitors, and specific virus detection. Viral extraction is a particularly critical step since the viruses may be present in such low numbers that concentration of the water samples is indispensable to reduce the volume to be assayed to a few milliliters or even microliters (Bosch et al., 2011). A good viral extraction method should fulfill several requirements: it should be technically simple, fast, provide high virus recoveries, be adequate for a wide range of enteric viruses, provide a small volume of concentrate, and be inexpensive. No single method meets all these requirements. Sludge is a complex matrix containing many organic compounds and suspended solids that must be expulsed with viral extraction method. US-EPA suggested the ultracentrifugation at high speed as a concentration step for viral recovery from sludge samples. The purpose of this study was to evaluate two extraction methods for Enterovirus detection in sludge samples. Method M1 is based on ultracentrifugation step after a viral elution prior to viral RNA extraction while method M2 performed with the ultracentrifugation step and consists in a direct assay for viral RNA extraction
after viral elution from sludge samples. Generally speaking, the statistical analysis shows that method M2 generated higher recovery rates of viral genomes than method M1. Surprisingly, the ultracentrifugation step decreases viral particles recovery in naturally occurring samples. This study, to the best of our knowledge, is the first to compare these two methods of viral extraction from sludge sample and to prove the inhibitory effect of ultracentrifugation on the extraction of naturally occurring viruses in raw sludge. These findings suggest that a direct assay could be more accurate for genomic studies especially qRT-PCR quantification of enteric viruses, while ultracentrifugation could prove useful for infectivity studies. In fact, an ultracentrifugation step would concentrate both viral particles and inhibitors existing in environmental matrix like sludge samples which interfere with molecular methods for the detection of viruses in environmental samples. Additionally, proteins and carbohydrates can bind to nucleotides and magnesium ions, making them unavailable to the polymerase (Schwabb et al., 1995). However, it has to be considered that the direct method may not fulfill the requirement of samples with lower viral concentrations, as it may be the case of viruses in treated sludges. In fact, the loss in viral genomic copies number noticed with ultracentrifugation might be compensated by viral particles concentration when applied to lower viral titers. Somatic coliphages (Kott et al., 1974), F-specific RNA bacteriophages (Havelaar et al., 1984) and bacteriophages infecting Bacteroides fragilis (Jofre et al., 1986) have been suggested as model microorganisms for water quality assessment (Kott et al., 1974; Havelaar et al., 1984; Jofre et al., 1986; IAWPRC, 1991). Bacteriophages have several advantages as model organisms. Firstly, the methods are cheap, simple to perform and rapid. In fact, results for somatic coliphages are available after 4–6 h. Secondly, phenomena like “stress”, “injury”, or “reactivation”, which lead frequently to misinterpretation of environmental data on bacterial indicators, are greatly reduced. Finally, sample analysis may be delayed after collection, since reduction in the number of bacteriophages is presumed to be low when the sample is stored at −20 ◦ C according to data on the persistence of bacteriophages in the environment (Lasobras et al., 1999; Duran et al., 2002). In this study, high titers of somatic coliphages were detected by the double layer agar technique in all sludge samples. F-specific RNA phages were also present in all samples but with 2 Log10 PFU/100 mL lower concentrations. Results showed that somatic coliphages were detected in concentrations comparable to those of genomes of Enteric viruses. In fact, they are recognized as conservative indicators for fecal viruses when evaluating sludge treatment processes. Thus they could be used as surrogates of Enteric viruses. They are also used to determine the potential exposure to microbial pathogens from sewage sludges (Ahmed and Sorensen, 1995; Pillai et al., 1996; Arraj et al., 2005; Heinonen-Tanski et al., 2009; Wu et al., 2010; Rouch et al., 2011). Further studies are required to establish the correlation between coliphages and Enteric viruses. 5. Conclusion This study is the first to the best of our knowledge to evaluate the effect of viral extraction method based on ultracentrifugation from
S. Jebri et al. / Journal of Virological Methods 200 (2014) 1–5
raw sludge samples. It highlights the decreasing viral recovery after an ultracentrifugation step according to a standardized method assayed on naturally occurring enteroviruses in sludge samples. The standardized virological assays must take onto consideration the complexity of environmental matrices. Furthermore, the recovery efficiency recorded with experimentally contaminated sludge decrease when the method is applied to naturally occurring viruses in raw samples. This study emphasizes also the use of somatic coliphages as viral indicators for enteroviruses in environmental samples and especially in raw sludge samples in wastewater treatment plants prior to agricultural use. Disclosure statement We disclose any actual or potential conflict of interest including any financial, personal or other relationships with other people or organizations within three (3) years of beginning the work submitted that could inappropriately influence our work. Acknowledgments This research was carried out within the framework of, the European Union (ROUTES-FP7-ENV-2010-265156), the Generalitat de Catalunya (2009-SGR-01043), and 3-PCI-Tunisia Spanish Agency for International Cooperation for Development (AECID), it was also supported by Centre National des Sciences et Technologies Nucléaires. References Abbaszadegan, M., Stewart, P., Le Chevalier, M., 1999. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, 444–449. Ahmed, A.U., Sorensen, D.L., 1995. Kinetics of pathogen destruction during storage of dewatered biosolids. Water Environ. Res. 67, 143–150. Arraj, A., Bohatier, J., Laveran, H., Traore, O., 2005. Comparison of bacteriophage and enteric virus removal in pilot scale activated sludge plants. J. Appl. Microbiol. 98, 516–524. Binn, L.N., Lemon, S.M., Marchwicki, R.H., Redfield, R.R., Gates, N.L., Bancroft, W.H., 1984. Primary isolation and serial passage of hepatitis A strains in primate cell cultures. J. Clin. Microbiol. 20, 28–33. Bofill-Mas, S., Albinana-Gimenez, N., Clemente-Casares, P., Hundesa, A., Rodri-guezManzano, J., Allard, A., Calvo, M., Girones, R., 2006. Quantification and stability of human adenovirus and polyomavirus JCPyV in wastewater matrices. Appl. Environ. Microbiol. 72, 7894–7896. Bosch, A., Guix, S., Sano, D., Pintó, R.M., 2008. New tools for the study and direct surveillance of viral pathogens in water. Curr. Opin. Biotechnol. 19, 295–301. Bosch, A., Sanchez, G., Abbaszadegan, M., Carducci, A., Guix, S., Le Guyader, F.S., Netshikweta, R., Pintó, R.M., van der Poel, W.H.M., Rutjes, S., 2011. Analytical methods for virus detection in water and food. Food Anal. Methods 4, 4–12. Craun, G.F., 1984. Health aspects of groundwater pollution. In: Bitton, G., Gerba, C.P. (Eds.), Groundwater Pollution Microbiology. John Wiley & Sons, Inc., New York, pp. 135–179. De Paula, V.S., Diniz-Mendes, L., Villar, L.M., Luz, S.L.B., Silva, L.A., Jesus, M.S., Da Silva, N.M.V.S., Gaspar, A.M.C., 2007. Hepatitis A virus in environmental water samples from the Amazon Basin. Water Res. 41, 1169–1176. Dubois, E., Le Guyader, F., Haugarreau, L., Kopecka, M., Pommepuy, M., 1997. Molecular epidemiological survey of rotaviruses in sewage by reverse transcriptase seminested PCR and restriction fragment length polymorphism assay. Appl. Environ. Microbiol. 63, 1794–1800. Duran, A.E., Muniesa, M., Méndez, X., Valero, F., Lucena, F., Jofre, J., 2002. Removal and inactivation of indicator bacteriophages in fresh waters. J. Appl. Microbiol. 92, 338–347. Girones, R., Ferrus, M.A., Alonso, J.L., Rodriguez-Manzano, J., Calgua, B., Correa, A.B., Hundesa, A., Carratala, A., Bofill-Mas, S., 2010. Molecular detection of pathogens in water – the pros and cons of molecular techniques. Water Res. 44, 4325–4339.
5
Guzman, C., Jofre, J., Blanch, A.R., Lucena, F., 2007. Development of a feasible method to extract somatic coliphages from sludge, soil and treated biowaste. J. Virol. Methods 144 (1–2), 41–48. Havelaar, A.H., Hogeboom, W.M., Pot, R., 1984. F-specific RNA bacteriophages in sewage; methodology and occurrence. Water Sci. Technol. 17, 645–655. Heinonen-Tanski, H., Reponen, T., Koivunen, J., 2009. Airborne enteric coliphages and bacteria in sewage treatment plants. Water Res. 43, 2558–2566. Hwang, Y.C., Leong, O.M., Chen, W., Yates, M.V., 2007. Comparison of a reporter assay and immunomagnetic separation real-time reverse transcription-PCR for the detection of enteroviruses in seeded environmental water samples. Appl. Environ. Microbiol. 73, 2338–2340. IAWPRC, 1991. Bacteriophages as model viruses in water quality control. Water Res. 25, 529–545. Jofre, J., Bosch, A., Lucena, F., Girones, R., Tartera, C., 1986. Evaluation of Bacteroides fragilis bacteriophages as indicators of the virological quality of water. Water Sci. Technol. 18, 167–173. Kott, Y., Roze, N., Sperber, S., Betzer, N., 1974. Bacteriophages as viral pollution indicators. Water Res. 8, 165–171. Lasobras, J., Dellundé, J., Jofre, J., Lucena, F., 1999. Occurrence and levels of phages proposed as surrogate indicators of enteric viruses in different types of sludges. J. Appl. Microbiol. 86, 723–729. Mignotte-Cadiergues, B., Maul, A., Schwartzbrod, L., 1999. Comparative study of techniques used to recover viruses from residual urban sludge. J. Virol. Methods 78, 71–80. Nappier, S.P., Aitken, M.D., Sobsey, M.D., 2006. Male-specific coliphages as indicators of thermal inactivation of pathogens in biosolids. Appl. Environ. Microbiol. 72, 2471–2475. Nijhuis, M., Van Maarseveen, N., Schuurman, R., Verkuijlen, S., De Vos, M., Hendriksen, K., Van Loon, A.M., 2002. Rapid and sensitive routine detection of all members of the genus enterovirus in different clinical specimens by real-time PCR. J. Clin. Microbiol. 40, 3666–3670. Pillai, S.D., Josephson, K.L., Baily, R.L., Gerba, C.P., Pepper, I.L., 1991. Rapid method for processing soil samples for polymerase chain reaction amplification of specific gene sequences. Appl. Environ. Microbiol. 57, 2285–2286. Pillai, S.D., Widmer, K.W., Dowd, S.E., Ricke, S.C., 1996. Occurrence of airborne bacteria and pathogen indicators during land application of sewage sludge. Appl. Environ. Microbiol. 62, 296–299. Puig, M., Jofre, J., Lucena, F., Allard, A., Wadell, G., Girones, R., 1994. Detection of adenoviruses and enteroviruses in polluted waters by nested PCR amplification. Appl. Environ. Microbiol. 60, 2963–2970. Rotbart, H.A., 1990. Diagnosis of enteroviral meningitis with the polymerase chain reaction. J. Pediatr. 117, 85–89. Rouch, D.A., Mondal, T., Pai, S., Glauche, F., Fleming, V.A., Thurbon, N., Blackbeard, J., Smith, S.R., Deighton, M., 2011. Microbial safety of air-dried and rewetted biosolids. J. Water Health 9, 403–414. Safferman, R.S., Rohr, M.E., Goyke, T., 1988. Assessment of recovery efficiency of beef extract reagents for concentrating viruses from municipal waste-water sludge solids by the organic flocculation procedure. Appl. Environ. Microbiol. 54, 309–316. Scheuerman, P.R., Farrah, S.R., Bitton, G., 1986. Development of a method for the recovery of enteroviruses from aerobically digested wastewater sludges. Water Res. 20, 15–19. Schwabb, K.J., De Leon, R., Sobsey, M.D., 1995. Concentration and purification of beef extract mock eluates from water samples for the detection of enteroviruses, hepatitis A and Norwalk virus by reverse transcription PCR. Appl. Environ. Microbiol. 61, 531–537. Schwartzbrod, L., Mathieu, C., 1986. Virus recovery from waste-water treatment plant sludges. Water Res. 20, 1011–1013. Shimohara, E., Nashida, M., Kaneko, M., 1986. Studies of procedures for recovery of viruses from activated-sludge. Water Sci. Technol. 18, 149–156. Sobsey, M.D., 1982. Quality of currently available methodology for monitoring viruses in the environment. Environ. Int. 7, 39–51. Stetler, R.E., Morris, M.E., Safferman, R.S., 1992. Processing procedures for recovering enteric viruses from waste-water sludges. J. Virol. Methods 40, 67–75. Straub, T.M., Pepper, I.L., Abbaszadegan, M., Gerba, C.P., 1994a. A method to detect enteroviruses in sewage sludge-amended soil using the PCR. Appl. Environ. Microbiol. 60, 1014–1017. Straub, T.M., Pepper, I.L., Gerba, C.P., 1994b. Detection of naturally-occurring enteroviruses and hepatitis-a virus in undigested and anaerobically digested sludge using the polymerase chain-reaction. Can. J. Microbiol. 40, 884–888. Tanji, Y., Mizoguchi, K., Yoichi, M., Morita, M., Hori, K., Unno, H., 2002. Fate of coliphage in a wastewater treatment process. J. Biosci. Bioeng. 94, 172–174. USEPA 625/R92/013, 2003. Control of pathogens and vector attraction in sewage sludge, Cincinnati, OH. Wu, J.L., Li, H.T., Huang, X., 2010. Indigenous somatic coliphage removal from a real municipal wastewater by a submerged membrane bioreactor. Water Res. 44, 1853–1862.