Angelman chromosome region (15q11–q13) and refined localization of the SNRPN gene

GENOMICS

18,546-552 (1993)

A Complete YAC Contig of the Prader-Willi/Angelman Chromosome Region (1Sq11-q13) and Refined Localization of the SNRPN Gene APIWAT MUTIRANGURA, *,1 ARUMUGAM JAYAKUMAR, * JAMES S. SUTCLIFFE, *,t MITSUYOSHI NAKAO, *,t MARY JANE McKINNEY, * KARIN BUITING,:j: BERNHARD HORSTHEMKE,:j: ARTHUR L. BEAUDET, *,t A. CRAIG CHINAULT, * AND DAVID H. LEDBETTER*,2 *Institute for Molecular Genetics and Human Genome Center, tHoward Hughes Medical Institute, Baylor College of Medicine, Houston, Texas 77030; and t-Institut fur Humangenetik, UniversitatskJinikum Essen, Germany Received May 27, 1993; revised August 7, 1993

Since a previous report of a partial Y AC contig of the Prader-Willi/Angelman chromosome region (15qllq13), a complete contig spanning approximately 3.5 Mb has been developed. Y ACs were isolated from two human genomic libraries by PCR and hybridization screening methods. Twenty-three sequence-tagged sites (STSs) were mapped within the contig, a density of ~ 1 per 200 kb. Overlaps between Y AC clones were identified by Alu-PCR dot-blot analysis and confirmed by STS mapping or hybridization with ends of Y AC inserts. The gene encoding small nuclear ribonucleoprotein-associated peptide N (SNRPN), recently identified as a candidate gene for Prader-Willi syndrome, was localized within this contig between markers PW71 and TD3-21. Loci mapped within and immediately flanking the Prader-Willi/ Angelman chromosome region contig are ordered as follows: cen-IR39-ML34IR4-3R-TD189-1-PW71-SNRPN-TD3-21-LS6-1GABRB3,D15S97-GABRA5-IRIO-I-CMWl-tel. This Y AC contig will be a useful resource for more detailed physical mapping of the region, for generation of new DNA markers, and for mapping or cloning candidate genes for the Prader-Willi and Angelman syndromes. © 1993 Academic Press, Inc.

INTRODUCTION

Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are distinct mental retardation disorders caused by a lack of paternal (PWS) or maternal (AS) contributions of chromosome 15qll-q13 resulting from deletion or uniparental disomy (Nicholls et at., 1989a,b; I Present address: Department of Anatomy, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand. 2 To whom correspondence should be addressed at present address: National Center for Human Genome Research, Bldg. 49, Rm. 4A38, 9000 Rockville Pike, Bethesda, MD 20892. Telephone: (301 )4022011. Fax: (301)402-2440.

0888-7543/93 $5.00 Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

546

Knoll et at., 1989; Malcolm et at., 1991; Robinson et at., 1991; Mascari et at., 1992). These two disorders have thus become a model for the study of genomic imprinting in human genetic disease and are the focus of efforts to identify the maternally imprinted (inactivated) gene(s) responsible for PWS and paternally imprinted gene(s) responsible for AS. Development of a Y AC contig covering the 3- to 4- Mb critical region will facilitate the isolation of additional DNA markers and genes that may play a role in the pathophysiology of these disorders. Previous molecular analysis of PWS and AS patients largely relied on a limited number of genetic markers, most of which are conventional restriction fragment length polymorphisms demonstrating low polymorphic content. Deletion detection with these markers frequently necessitated the use of quantitative Southern blot analysis (Nicholls et at., 1989a; Robinson et at., 1991). Several new anonymous DNA probes have recently been mapped to this region, including PW71 (D15S63) (Buiting et at., 1990), LS6-1 (D15S113) (Kuwano et at., 1992a), and D15S97 (NIH/CEPH Collaborative Mapping Group, 1992), a dinucleotide repeat polymorphism with heterozygosity >70%. Genes identified in this region include two 'Y-aminobutyric acid receptor subunit genes, GABRB3 (Wagstaff et at., 1991) and GABRA5 (Knoll et at., 1993), and a small nuclear ribonucleoprotein polypeptide N (SNRPN) (Ozcelik et at., 1992). SNRPN was mapped within the smallest critical region for PWS (and excluded from the AS region), is highly expressed in brain, and was shown to be maternally imprinted in the mouse (Ozcelik et at., 1992; Leff et at., 1992; Cattanach et at., 1992). These observations make SNRPN an excellent candidate gene for involvement in the pathophysiology of PWS. We previously reported the isolation of 51 YACs from two human Y AC libraries identified by nine anonymous DNA markers and the GABRB3 gene (Kuwano et at., 1992a,b). An -l-Mb YAC contig was developed covering the proximal portion of the PWS/ AS region. This

Y AC CONTIG OF THE PWS/ AS CHROMOSOME REGION

contig was represented by a minimum of 5 Y ACs and indicated the order of markers in the region to be cenML34-IR4-3R-189-1-PW71-tel. The distal portion of the PWSj AS chromosome region was not complete, however and further "walks" from YACs corresponding to probes TD3-21, LS6-1, and GABRB3 were required. We now report a complete contig for the PWSj AS chromosome region and the localization of SNRPN to specific Y ACs within the contig. MATERIALS AND METHODS DNA probes and previously isolated YACs. Table 1 lists the chromosome 15 markers and genes that were previously utilized to isolate YACs in the PWS/ AS chromosome region (Kuwano et al., 1992a). In addition to these nine DNA markers and one gene, two new genes and one additional polymorphic marker were used in this study. GABRA5 (-y-aminobutyric acid receptor subunit (5) is a gene recently reported to map distal to GABRB3 within the PWS/ AS region (Knoll et al., 1993). SNRPN was recently mapped to the PWS critical region but excluded from the AS region (Ozcelik et al., 1992). D15S97 is a dinucleotide repeat polymorphism mapped to the proximal portion of 15q by genetic linkage analysis (NIH/CEPH Collaborative Mapping Group, 1992). YAC library screening and characterization. Human Y AC libraries were obtained from Dr. Maynard Olson (Burke et al., 1987) and from the Centre d'Etude du Polymorphism Humaine (CEPH) (Albertsen et aI., 1990), hereafter referred to as the St. Louis and CEPH libraries, respectively. Libraries were screened by one of two methods: PCR screening as described by Green and Olson (1990) in most cases, with the final positive colony identification performed by a PCR-based matrix pooling strategy (Kwiatowski et al., 1990), or by hybridization to Y AC filters. A few Y ACs reported previously were identified by a hybridization screening method as described (Kuwano et aI., 1992a). Alu- PCR was performed on each isolated YAC to detect chimerism and identify overlaps with previously isolated YACs. Two Alu primers, PDJ34, 5'-TGAGC(C/T)(G/ A)(A/T)GAT(C/T)(G/ A)(C/ T)(G/A) CCA(C/T)TGCACTCCAGCCTG-3' (Breukel et al., 1990), and 2484, 5'-AGGAGTGAGCCACCGCACCCAGCC-3' (Kuwano et al., 1992a), were used in separate amplifications for each Y AC, and the products were pooled. Combined product for each Y AC was labeled by the random primer method and used as a probe on an Alu-PCR dotblot panel of single chromosome hybrids to identify chimerism as previously described (Banfi et aI., 1992). Labeled product was also simultaneously hybridized to an Alu-PCR dot-blot panel of all YACs previously isolated in the region to detect overlaps among Y ACs as previously described (Kuwano et al., 1992a). Isolation of YAC ends, sequence-tagged site (STS) development, and contig construction. Y AC ends were isolated by Alu-vector PCR (Nelson et al., 1989) or, alternatively, by vectorette PCR (Riley et aI., 1990). Isolated YAC ends were digested with EcoRI and the insert fragments were separated on 1% low-melting agarose gels in TBE, visualized by ethidium bromide staining, and excised from the gel for use as probes. These fragments were labeled with 32p as above and hybridized to a somatic cell hybrid mapping panel to confirm localization to chromosome 15 as well as to a Southern blot filter of YACs from the PWS/ AS critical region to identify overlaps. Ends that were shown to map to chromosome 15 but did not overlap any existing Y ACs from the region were subcloned into pBluescriptII SK- (Stratagene) and sequenced. Oligonucleotide primers were designed for STSs and were synthesized on an Applied Biosystems DNA synthesizer (Model 380B). STSs were tested on existing YAC DNAs and were used for further Y AC library screening. A polymorphic STS near TDI89-1, identifying a dinucleotide repeat polymorphism from Y AC 307 A12, was generated as follows; YACadapt fragments were generated from 307 A12 essentially as described (Sutcliffe et aI., 1992). Briefly, the intact YAC was isolated from a preparative pulsed-field gel and digested in molten agarose

547

with Sau3AI. Purified DNA was ligated to linker adapters and PCR amplified to produce a pool of fragments ranging from 150 bp to 2 kb. A library of YAC fragments was produced by shot-gun cloning the PCR product into BamHI-digested pBluescriptII SK- following Sau3AI digestion to remove linker adapters. Following transformation, replica filters were prepared by standard procedures (Sambrook et aI., 1989), and colonies were screened for CA repeats using 32P_la_ be led poly(dA-dC) ·poly(dG-dT) (Pharmacia). Once isolated, sequencing was performed on positive colonies, and this sequence information was used to generate primers. STS mapping of SNRPN and D15S97. An STS was developed from the 5' flanking region of SNRPN based on the published sequence (Schmauss et aI., 1992). The primer sequences utilized were 5'-CAGGTAGTGACTTGTCAGGAGGAT-3' and 5'-CTGGAGTGCAGTGGCACGATCTG-3', which generated a single product of 618 bp. For the dinucleotide repeat polymorphic marker D15897, primer sequences used were 5'-TCTCCCTCCAATAATGTGAC-3' and 5'TGAGTCAATGATTGAAATTACTG-3', generating a product of approximately 178 bp (NIH/CEPH Collaborative Mapping Group, 1992; Dr. A. Bowcock, Dallas, pers. comm., 1993). PCR reactions were performed in a total volume of 20 III using 25 ng of DNA from each YAC in the contig with the following concentrations: 200 11M each of the dNTPs, 10 mM Tris-HCI, pH 8.4, 50 mM KCI, 1.2 mM MgCI 2 , and 0.5 unit of AmpliTaq DNA polymerase (Perkin-Elmer-Cetus). The final primer concentration was 0.4 11M for both markers. For each PCR reaction, initial denaturation was at 95°C for 4 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C (DI5S97) or 67°C (SNRPN) for 1 min, extension at 72°C for 2 min, and a final extension at 72°C for 7 min. The PCR products were then analyzed on a 1.5% agarose gel. PFGE and conventional Southern blot analysis. High-molecularweight YAC DNA for size determination by pulsed-field gel electrophoresis (PFGE) was isolated in agarose plugs (Schwartz and Cantor, 1984; van Ommen and Verkerk, 1986). PFGE was performed using the LKB Pulsaphor as previously described (Ledbetter et al., 1990). Conventional Southern blot analysis was also performed by standard methods using 2 IIg ofY AC DNA, digestion with EcoRI or PstI, electrophoresis on a 1 % agarose gel, and transfer to a nylon membrane. These blots were used for hybridizations with isolated Y AC ends to identify overlaps with existing YAC in the contig. FISH interphase mapping. Because of an inconsistency between previous probe ordering based on interphase mapping by FISH and data obtained from YAC overlaps and position within the contig, additional interphase mapping experiments were conducted with YACs corresponding to probes PW71, TD3-21, LS6-1, and GABRB3. Each experiment involved hybridization of three Y ACs simultaneously using a multicolor labeling strategy described previously (Kuwano et al.. 1992a). Briefly, one clone was labeled with biotin and detected with FITC (green), a second clone was labeled with digoxigenin and detected with rhodamine (red), and a third clone was labeled and detected with both biotin-FITC and digoxigenin-rhodamine (yelloworange). Slides were counterstained with DAPI and visualized with a triple-bandpass filter set (Zeiss) allowing simultaneous detection of DAPI, FITC, and rhodamine. Each set of three probes tested was coded, and analysis was done in a blinded fashion. For each combination, > 100 interphase nuclei in which three discrete signals could be identified were scored as to which of the three probes was localized in the middle of the set.

RESULTS

Y AC Isolation, Characterization, and Contig Assembly We previously reported 51 YACs from 10 loci in the PWSj AS chromosome region, including one contig of ~1 Mb containing 4 of the loci (Kuwano et at., 1992a,b; Table 1). To complete the YAC contig for this region, additional STSs were generated from left (L) or right

548

MUTIRANGURA ET AL.

TABLE 1 Representative Y ACs Previously Reported (Kuwano et al., 1992a)" Locus

Probe

YAC J.D.

D15S18 D15S9

IR39 ML34

D15S11

IR4-3R

D15S13 D15S63

A156ElR TD189-1 PW71 B58C7R

D15SlO D15S113 GABRB3 D15S12

TD3-21 LS6-1 GABRB3 IRI0

A124A3 254B5 264A1 A156E1 71Bll 495Dl 307A12 B58C7 326F6 llHll 457B4 B230E3 A229A2 B25E9 93C9

D15S24

CMW1

B94H7

149A9 c

Size (kb)

Chimerism

260 370 245 250 700 360 360 125 370 480 325 b 250 250 150 200 300 220

No No No No No No No Yes No No No No No No No No No

a The identification (I.D.) numbers for YACs from the St. Louis library begin with letters (A, B), while those from the CEPH library begin with numbers. Chimerism status was determined by either FISH analysis or Alu-PCR dot-blot analysis of a monochromosomal hybrid panel as described (Kuwano et al., 1992a). b The size of YAC 457B4 has been reevaluated and is less than that originally reported (Kuwano et aI., 1992a). c The J.D. number for the IRlO Y AC 149A9 was previously reported incorrectly (Kuwano et aI., 1992a).

(R) end clones for 307A12L (189-1), B230E3R and L (TD3-21), A229A2R and L (LS6-1), and B25E9R (GABRB3) and from one new gene, GABRA5. Screening with these seven STSs identified a total of 32 new Y ACs from the CEPH library. YAC identification numbers and characterization data are presented in Table 2. For each locus, at least one nonchimeric Y AC of 300-700 kb was identified and used in subsequent contig development. Previous studies employed an Alu-PCR dot-blot technique to detect overlaps among Y ACs by hybridization of Alu-PCR products from each individual YAC to a filter containing the Alu-PCR products of all YACs in the region. Those experiments demonstrated a contig including (from the centromeric side) YACs 264Al, 495D1, A156E1, B58C7, 326F6, and 307 A12 and a probe order of ML34-4-3R-PW71-189-1. However, subsequent data showed an error in the ordering of PW71 and 189-1 based on positive hybridization of Alu-PCR products between A156E1 (4-3R) and B58C7 (PW71). STS and end hybridization data indicated that the correct order is ML34-4-3R-189-1-PW71 (Kuwano et al., 1992b). Since the Alu-PCR dot-blot technique can result in both false positive results due to presence of homologous sequences in Y ACs and false negative results due to the failure of Alu- PCR products to represent the entire Y AC including ends, overlaps among Y ACs are best established by STS content mapping (Green et al., 1991) and

by hybridization of Y AC end clones to a Southern blot of total Y AC DNA. A combination of STS analysis and end hybridization has established a complete Y AC contig from ML34 to GABRA5 (Fig. 1). End hybridizations confirmed overlaps previously identified between 254B5 and 264A1, 264A1 and 495D1, and 307A12 and 326F6. Overlaps were established by STS analysis or end hybridizations between Y ACs from (1) PW71 and TD3-21, (2) TD3-21 and LS6-1, (3) LS6-1 and GABRB3, and (4) GABRB3 and GABRA5. An STS from the right end of YAC 132D4 (TD3-21) identified several YACs from the PW71 Y AC end B58C7R, including 457B4 and llHll, establishing closure between PW71 and TD3-21. The interval between TD3-21 and LS6-1 was established as follows: STS screening from the right end of Y AC B230E3 identified 132D4, a Y AC completely containing B230E3, and 230H12. Screening with the right end of YAC A229A2 (LS6-1) identified YAC 142A2, a nonchimeric YAC of 520 kb. Alu-PCR dot-blot analysis suggested that this YAC overlapped with 230H12, and isolation and hybridization of the right end of 142A2 confirmed this result. For the interval between LS6-1 and GABRB3, a new YAC (378A12) was identified with the left end of A229A2, and two new YACs (520A9 and 49G3) were identified with the right end of B25E9 (Fig. 1; Table 2). Isolation and hybridization of the right end of 378A12 showed positive hybridization to 520A9, thus establishing a contig between these markers. For establishing the overlap between GABRA5 and GABRB3, a new YAC was identified by screening with the STS from GABRA5 (335B1). AluPCR dot-blot hybridization suggested an overlap of 335B1 with a YAC from GABRB3 (49G3). Isolation and hybridization of the left end of 49G3 confirmed this overlap and established the contig between GABRB3 and GABRA5. A gap of unknown size remains between the GABRA5 locus and IR10, but this region has recently been excluded from the AS critical region (Reis et al., 1993). These data establish a contig extending from ML34 to GABRA5 containing the entire PWS and AS critical regions. The contig can be represented by a minimum of 12 YACs, including 254B5, 495D1, 71Bll, 307A12, llHll, 132D4, 230H12, 142A2, 378A12, 520A9, 49G3, and 335Bl. A minimum estimate of the size of the contig is -3.5 Mb, based on the total size of a subset of nonoverlapping YACs within the contig (264A1, 71Bll, 326F6, 132D4, 142A2, 520A9, and 335B1). The contig contains 23 STSs, or -1 per 200 kb, with each Y AC containing 1-4 STSs. The marker order determined by the contig data is cen-IR39-ML34-IR4-3R-TD189-1-PW71-TD3-21LS6-1-GABRB3-GABRA5. The order of TD3-21 and LS6-1 is reversed from that previously suggested by interphase FISH analysis (Kuwano et at., 1992a). To clarify this inconsistency, FISH experiments were repeated for TD3-21 and LS6-1 along with their flanking markers.

549

YAC CONTIG OF THE PWSjAS CHROMOSOME REGION

TABLE 2 New STSs and YACs Identified in the Prader -Willi/Angelman Region a Locus D15S11 D15S13 D15S13 D15S10 D15S1O D15S1O D15S113 D15S113 GABRB3 GABRA5 D15S12

Probe

Size (bp)

STS

71B11L (lR4-3R) 307A12L (TDI89-1) 307A12 b (TDI89-1) 132D4R

GTCATGGTATAGGGTAGTCACTC GGACCAAAGCAGTATCTGAGG GAGTTAGTTTACTCTGATACCACAACTAG GAATATAGTGCATAACGCTAGTTGTATG CACAGCACAATTCACAATTGC CAATTGTGACAATGGCAAAATTGC GTGTCTCATTGTGGGTCTTTGA CAGCTTCTGGTCCACCACCCAA B230E3R CAGAAGGGAGAAATAGACAACTCAGC (TD3-21) CTGGAATTATAGGTGTGTGCCACC B230E3L GACTCACAGATTACTTAGAATTGTG (TD3-21) GCAGTCTATCTGTATAAAATGGAACAG GCTTCATAACTGATGAGCTG A229A2L (LS6-1) GCAGGAGGAGGAGCTACTAAGGAG A229A2R CAATTCCTGACATATAGTGGGTGC (LS6-1) CTGGGATTACAGGCATAAGCCAC GTGACAGAGCGAGACTTGTCTC B25E9R (GABRB3) CGATTGTATTAGAATGTCCAGCATC GABRA5' GTAGAATTTCCCTGTAAAGCAC GATGACTTACCCACCTTTATTC 149A9L TAGCAGCTCAGGAACCTTCAG (!RIO) CAGGGATAACCTGTCACTTGAG

YAC J.D.

198 218

71B11 (700 kb), 81B4 (345 kb), 210EIO, 438D9, 439D1O

194 198 304 170 159 214 165 286

132D4 (600 kb), 230H12 (520 kb), 182C8, 273A2, 399D3, 399G3, 463E2, 478H6, 525F4, 525F5 132D4 (600 kb), 273A2 (450 kb), 89G12, 162F4, 399D3 378A12 (375 kb), 218D8 142A2 (520 kb), 378A12 (375 kb), 81F6, 139BIO, 141A5, 174B7 49G3 (300 kb), 520A9 (350 kb), 119FIO, 123B2, 127D11, 128H7, 199A12 335B1 (480 kb)

135

a Y AC end clones isolated and sequenced during YAC "walking" are designated as the left (L) or right (R) end of the Y ACs from which they were derived. For each YAC screening, all isolated YAC identification (J.D.) numbers are given. YACs that were characterized and found to be nonchimeric are indicated in bold, and the size of the YAC determined by PFGE is shown in parentheses. b This STS represents a dinucleotide repeat polymorphism, TG ,6 , isolated from a YACadapt library generated from 307 A12 (see text). 'Primer sequences for the GABRA5 STS are from Knoll et al. (1993).

FISH Interphase Mapping A single nonchimeric Y AC clone was used for each locus, including PW71 (326F6), TD3-21 (B230E3), LS61 (A229A2), and GABRB3 (B25E3). For each experiment, one clone was labeled with biotin-FITC (green), the second clone was labeled with digoxigenin-rhodamine (red), and the third clone was labeled with both (yellow-orange) as previously described (Kuwano et ai., 1992a). For the combination PW71, TD3-21, and LS6-1, 162 interphase nuclei were analyzed and 52% showed TD3-21 to be located between the other two loci. The other two markers were centrally located in 25 and 23%

I "

I I I I I I

of cells. This result is consistent with the Y AC contig data, although it conflicts with our previous FISH results. For the combination TD3-21, LS6-1, and GABRB3, 115 interphase nuclei were analyzed and showed LS6-1 located between the other two loci in 58 % of cells. The other two markers were centrally located in 16 and 26% of cells. These data are again consistent with the Y AC contig data but conflict with our previous FISH results. Since the current FISH experiments utilized the same YACs for TD3-21 and LS6-1 as were used previously, the simplest explanation for these contradictory results is a sample mix-up in the YAC DNAs during the original FISH studies.

11Mb

FIG. 1. Summary of the PWSj AS chromosome region (15qll-qI3) incorporating 24 YACs, including a contig of 20 YACs that completely covers the minimal critical regions for PWS and AS as defined by analysis of patient deletions. The heavy, jagged lines represent the common deletion breakpoints previously shown to be highly consistent (contained within single YACs) for both PWS and AS syndromes (Kuwano et aI., 1992a). YACs are drawn approximately to scale as horizontal bars with the YAC identification number above the line. Land R indicate the left or right YAC end that has been isolated. Black circles indicate end clones or other probes that have been used as hybridization probes against Southern blots of YAC DNAs to identify overlaps. The open circles represent STSs that were tested by PCR on DNA from all YACs. Four gaps outside of the PWSjAS critical region are indicated. The minimum critical region for PWS, including probes PW71 and SNRPN, and the minimum critical region for AS, including probes TD3-21 and LS6-1, are shown below the Y AC map.

550

MUTIRANGURA ET AL.

Inclusion of D15S97 and SNRPN in the ordered set of markers for the entire region provides the following order: cen-IR39-ML34-4-3R-TD189-1-PW71-SNRPNTD3-21-LS6-1-GABRB3,D15S97-GABRA5-IR10CMW1-tel.

DISCUSSION

FIG. 2. PCR analysis of YACs in the PWSjAS YAC contig using the STS from the SNRPN gene. The PCR product was run on a 1 % agarose gel and stained with ethidium bromide. Total human DNA and H 2 0 were used as positive and negative controls, respectively. YACs llHll and 457B4 were positive, while all other YAC clones were negative.

Localization of D15S97 and SNRPN within the YAC Contig Availability of the YAC contig allowed rapid localization ofD15S97 and SNRPN. D15S97, a dinucleotide repeat polymorphism, was previously mapped to proximal 15q by close linkage to a CA dinucleotide repeat marker near the GABRB3 gene (NIHjCEPH Collaborative Mapping Group, 1992). Although initial genetic data indicated a 3-cM distance between these markers, subsequent analysis has shown no recombination (A. Bowcock, Dallas, pers. comm., 1993). PCR analysis ofYACs in the contig showed the marker to be present in B25E9 from GABRB3 and 49G3, 119F10, 123B2, 127Dll, and 199A12 from B25E9R. D15S97 and the GABRB3 STS are thus in close physical proximity, as both are contained within the 150-kb YAC, B25E9. The STS for GABRB3 is present in YAC 520A9, while D15S97 is not, suggesting that D15S97 is distal to this STS. Recent data show that the GABRB3 gene encompasses a large genomic region of 250 kb and that Y AC B25E9 covers only a portion of the 3' end of the gene (Sinnett et al., 1993). Thus, D15S97 is probably contained within the GABRB3 gene. SNRPN was previously mapped within the PWS critical region and excluded from the AS critical region (Ozcelik et al., 1992). Dosage analysis of PWS and AS deletion patients suggested a localization between probes TD189-1 and TD3-21, within the same interval as PW71. An STS was developed for SNRPN and PCR analysis showed the gene to be positive for YACs 457B4 and llHll (Fig. 2). Further analysis showed that the STS was positive for several additional Y ACs isolated from B58C7R, including 225D1, 309G7, and 471H7. SNRPN was not positive for YAC 326F6, a 370-kb clone containing both PW71 and TD189-1. This indicates that SNRPN is distal to PW71, as shown in Fig. 1.

As a first step toward identification of genes responsible for PWS and AS and understanding the mechanisms involved in the chromosome segregation errors and rearrangements that produce these disorders, a physical map of the chromosome region has been constructed at the level of overlapping Y AC clones. A total of 83 Y ACs were identified from nine anonymous DNA markers, two genes, and six YAC end clones used for "walking." On the proximal side, the contig includes a common, recurring deletion breakpoint contained within ML34 Y AC 254B5 (Fig. 1). Previous demonstration that the majority of both PWS and AS patient deletions lie within this 370-kb Y AC suggested a "hot spot" for chromosome breakage (Kuwano et al., 1992a). Distally, the contig extends to GABRA5, which maps telomeric to both GABRB3 and the dinucleotide repeat polymorphism D15S97. A gap of unknown size that contains a distal deletion breakpoint common in most PWS and AS patients lies between GABRA5 (335B1) and IR10 (93C9). However, recent deletion mapping of AS patients has excluded both the GABRB3 and the GABRA5 genes from the AS critical region (Reis et al., 1993). The common deletion in PWS and AS is visible only at a high-resolution cytogenetic level, so the deletion is probably on the order of 3 to 5 Mb in size. Since the contig currently represents a minimum of 3.5 Mb, the remaining gap must be relatively small. The order of DNA probes and genes within the contig can be unambiguously determined as follows: cen-IR39ML34-IR4-3R-TD189-1-PW71-SNRPN-TD3-21LS6-1-GABRB3,D15S97-GABRA5-IRlO-CMW1. There are two discrepancies between the present data and the original probe order (Kuwano et al., 1992a). First, the order of TD 189-1 and PW71 has been reversed (Kuwano et al., 1992b) as discussed above. This order is consistent with recent FISH interphase mapping data (Knoll et al., 1993) and with data from a PWS patient (PWS93) deleted for PW71 and distal markers but not for 189-1 (Robinson et al., 1991; W. Robinson, Dallas, pers. comm., 1993). The second discrepancy is in the ordering of TD3-21 and LS6-1. FISH interphase mapping data originally placed LS6-1 proximal to TD3-21 (Kuwano et al., 1992a), while the current data places LS6-1 distal to TD3-21. To clarify this discrepancy, FISH interphase mapping was repeated using YAC clones for PW71, TD3-21, LS6-1, and GABRB3. These experiments provided confirmation of the order derived from the Y AC contig and suggest that the original FISH order was in error, perhaps due to mislabeling or mix-up of the Y AC DNA samples during those experiments.

YAC CONTIG OF THE PWS/AS CHROMOSOME REGION

The size of the Y AC contig is estimated as a minimum of 3.5 Mb, based on the total size of seven nonoverlapping Y ACs within the contig. The contig completely contains the currently defined minimal critical regions for both PWS and AS. The AS critical region is defined as follows. Hamabe et at. (1991) reported a rare familial case of AS with a submicroscopic deletion. All individuals inheriting this deletion from a female displayed AS, whereas inheritance from a male produced a normal phenotype. This important family separates the critical regions for AS and PWS. Previous FISH analysis revealed a deletion of at least 650 kb, including Y AC clones for TD3-21, LS6-1, and GABRB3, but not PW71 or more proximal markers (Kuwano et at., 1992a). SNRPN also has been excluded from this deletion by dosage analysis (Ozcelik et al., 1992). The proximal boundary for the AS critical region is therefore between SNRPN and TD321. Although GABRB3 was originally considered a potential candidate gene for AS, recent studies on an AS patient with an unbalanced translocation in which GABRB3 was not deleted appear to exclude it (Reis et at., 1993). Therefore, the current AS critical region encompasses the interval between SNRPN and GABRB3, which is represented in the contig by YACs 457B4, 132D4, 230H12, 142A2, 378A12, and 520A9. Since familial AS segregates as an autosomal dominant paternally imprinted locus mapping to this same region of chromosome 15 (Wagstaff et at., 1992), the present data are consistent with the possibility that a single paternally imprinted gene contained within these Y ACs is mutated in the AS phenotype. The PWS critical region has been defined as follows. The familial AS case described above (Hamabe et at., 1991) excludes TD3-21, LS6-1, and GABRB3 from the PWS critical region. This is confirmed by an additional recent report of a PWS translocation patient whose deletion does not extend as far distally as TD3-21 (Knoll et at., 1993). Thus, the distal boundary of the PWS critical region is between SNRPN and TD3-21. For the proximal boundary, one PWS patient (PWS93) has been described whose deletion does not include ML34, IR4-3R, or TDI89-1, but does include PW71, SNRPN, and other distal markers (Robinson et at., 1991; Ozcelik et at., 1992; W. Robinson, Houston, pers. comm., 1993). Thus, the proximal boundary for PWS lies between markers TD189-1 and PW71 and is located within YAC 326F6. Therefore, the PWS critical region lies between markers TD189-1 and TD3-21 and is represented by three Y ACs, 326F6, 457B4, and 132D4. The single known gene within this interval, SNRPN, was recently described as a candidate gene for PWS based on its localization and the observation of maternal imprinting in mouse brain (Ozcelik et at., 1992; Leff et at., 1992; Cattanach et at., 1992). Prior mapping based on dosage analysis of PWS deletion patients showed SNRPN to be between markers TD189-1 and TD3-21, in the same interval as PW71 (Ozcelik et aI., 1992). Our data confirm this localization and refine it, demonstrating that SNRPN is distal to PW71. The two markers are physically close, as

551

they are both contained in YACs llHll (480 kb) and 457B4 (325 kb). The Y AC contig reported here provides reagents for isolation of additional genes that may playa role in PWS and AS. An example of oppositely imprinted genes in close proximity involves the insulin-like growth factor (Igf2) and H19 genes. In that case, Igf2 is maternally imprinted and H19 is paternally imprinted and both lie within 90 kb of each other on mouse chromosome 7 and within 200 kb of each other on human chromosome 11 (Zemel et al., 1992). This has led to speculation that oppositely imprinted genes may be paired in chromosomal regions and share a common regulatory element that provides a "switch" as to which gene is expressed on the paternal or maternal homologue (Zemel et al., 1992; Bartolomei and Tilghman, 1992). The critical regions for PWS and AS are adjacent to each other, and this same mechanism could apply. If this were true, an AS locus might be located in close proximity to SNRPN on the distal side (YACs llHll, 457B4, and 132D4). Since the distal boundary of PWS and proximal boundary of AS are both defined by the breakpoint in the familial AS case with microdeletion, localization of this breakpoint within the Y AC contig may further refine the position of the PWS and AS loci. ACKNOWLEDGMENTS This work was supported by grants from The National Institutes of Health (HD20619, HG00024, HG00210), The Beneficia Foundation, and the Texas Advanced Technology Program (0004949-071). A.L.B. is an Investigator at the Howard Hughes Medical Institute.

REFERENCES Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., LePaslier, D., and Cohen, D. (1990). Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc. Natl. Acad. Sci. USA 87: 42564260. Banfi, S., Ledbetter, S. A., Chinault, A. C., and Zoghbi, H. Y. (1992). An easy and rapid method for the detection of chimeric yeast artificial chromosome clones. Nucleic Acids Res. 20: 1814. Bartolomei, M. S., and Tilghman, S. M. (1992). Parental imprinting of mouse chromosome 7. Semin. Dev. Bioi. 3: 107-117. Breukel, C., Wijnen, J., Tops, C., Klift, H.v/d., Dauwerse, H., and Meera Khan, P. (1990). Vector-Alu PCR: A rapid step in mapping cosmids and YACs. Nucleic Acids Res. 18: 3097. Buiting, K., Neumann, M., Ludecke, H. J., Senger, G., Claussen, D., Antich, J., Passarge, E., and Horsthemke, B. (1990). Microdissection of the Prader-Willi syndrome chromosome region and identification of potential gene sequences. Genomics 6: 521-527. Burke, D. T., Carle, G. F., and Olson, M. V. (1987). Cloning of large exogenous DNA into yeast by means of artificial chromosome vectors. Science 236: 806-812. Cattanach, B. M., Barr, J. A., Evans, E. P., Burtenshaw, M., Beechey, C. V., Leff, S. E., Brannan, C. I., Copeland, N. G., Jenkins, N. A., and Jones, J. (1992). A candidate mouse model for Prader-Willi syndrome which shows an absence of Snrpn expression. Nature Genet. 2: 270-274. Green, E. D., Mohr, R. M., Idol, J. R., Jones, M., Buckingham, J. M., Deaven, L. L., Moyzis, R. K., and Olson, M. V. (1991). Systematic generation of sequence-tagged sites for physical mapping of human

552

MUTIRANGURA ET AL.

chromosomes: Application to the mapping of human chromosome 7 using yeast artificial chromosomes. Genomics 11: 548-564. Green, E. D., and Olson, M. V. (1990). Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213-1217. Hamabe, J., Kuroki, Y., Imaizumi, K, Sugimoto, T., Fukushima, Y., Yamaguchi, A., Izumikawa, Y., and Niikawa, N. (1991). DNA deletion and its parental origin in Angelman syndrome patients. Am. J. Med. Genet. 41: 64-68. Knoll, J. H. M., Nicholls, RD., Magenis, R E., Graham, Jr., LaLande, M., and Latt, S. A. (1989). Angelman and Prader-Willi syndromes share a common chromosome 15 deletion but differ in parental origin of the deletion. Am. J. Med. Genet. 32: 285-290. Knoll, J. H. M., Sinnett, D., Wagstaff, J., Glatt, K, Wilcox, A. S., Whiting, P. M., Wingrove, P., Sikela, J. M., and LaLande, M. (1993). FISH ordering of reference markers and of the gene for the ",5 subunit of the -y-aminobutyric acid receptor (GABRA5) within the Angelman and Prader-Willi syndrome chromosomal regions. Hum. Mol. Genet. 2: 183-189. Kuwano, A., Mutirangura, A., Dittrich, B., Buiting, K., Horsthemke, B., Saitoh, S., Niikawa, N., Ledbetter, S. A., Greenberg, F., Chinault, A. C., and Ledbetter, D. H. (l992a). Molecular dissection of the Prader-Willi/Angelman syndrome region (15ql1-13) by YAC cloning and FISH analysis. Hum. Mol. Genet. 1: 417-425. Kuwano, A., Mutirangura, A., Dittrich, B., Buiting, K., Horsthemke, B., Saitoh, S., Niikawa, N., Ledbetter, S. A., Greenberg, F., Chinault, A. C., and Ledbetter, D. H. (1992b). Molecular dissection of the Prader-Willi/Angelman syndrome region (l5qll-13) by YAC cloning and FISH analysis. Hum. Mol. Genet. 1: 784. Kwiatowski, T. J., Zoghbi, H. Y., Ledbetter, S. A., Ellison, K A., and Chinault, A. C. (1990). Rapid identification of yeast artificial chromosome clones by matrix pooling and crude lysate PCR Nucleic Acids Res. 17: 7191-7192. Ledbetter, S. A., Wallace, M. R, Collins, F. S., and Ledbetter, D. H. (1990). Human chromosome 17 NotI linking clones and their use in long-range restriction mapping of the Miller-Dieker chromosome region (MDCR) in 17p13.3. Genomics 7: 264-269. Leff, S. E., Brannan, C.I., Reed, M. L., Ozcelik, T., Francke, U., Copeland, N. G., and Jenkins, N. A. (1992). Maternal imprinting of the mouse Snrpn gene and conserved linkage homology with the human Prader-Willi syndrome region. Nature Genet. 2: 259-264. Malcolm, S., Clayton-Smith, J., Nichols, M., Robb, S., Webb, T., Armour, J. A. L., Jeffreys, A. J., and Pembrey, M. E. (1991). Uniparental paternal disomy in Angelman's syndrome. Lancet 337: 694-697. Mascari, M. J., Gottlieb, W., Rogan, P. K, Butler, M. G., Waller, D. A., Armour, J. A. L., Jeffreys, A. J., Ladda, R L., and Nicholls, RD. (1992). The frequency of uniparental disomy in Prader-Willi syndrome. N. Engl. J. Med. 326: 1599-1607. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R, Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686-6690. Nicholls, R D., Knoll, J. H., Glatt, K, Hersh, J. H., Brewster, T. D., Graham, J. M., Wurster-Hill, D., Wharton, R., and Latt, S. A. (1989a). Restriction fragment length polymorphisms within proxi-

mal 15q and their use in molecular cytogenetics and the PraderWilli syndrome. Am. J. Med. Genet. 33: 66-77. Nicholls, R D., Knoll, J. H. M., Butler, M. G., Karam, S., and LaLande, M. (1989b). Genetic imprinting suggested by maternal heterodisomy in non-deletion Prader-Willi syndrome. Nature 342: 281-285. NIH/CEPH Collaborative Mapping Group. (1992). A comprehensive genetic linkage map of the human genome. Science 258: 67-86. Ozcelik, T., Leff, S., Robinson, W., Donlon, T., LaLande, M., Sanjines, E., Schinzel, A., and Francke, U. (1992). Small nuclear ribonucleoprotein polypeptide N (SNRPN), an expressed gene in the Prader-Willi syndrome critical region. Nature Genet. 2: 265-269. Reis, A., Kunze, J., Ladanyi, L., Enders, H., Klein-Vogler, U., and Niemann, G. (1993). Exclusion of the GABA A receptor {33 subunit gene as the Angelman's syndrome gene. Lancet 341: 122-123. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R, Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887-2890. Robinson, W. P., Bottani, A., Yagang, X., Balakrishman, J., Binkert, F., Machler, M., Prader, A., and Schinzel, A. (1991). Molecular, cytogenetic, and clinical investigations of Prader-Willi syndrome patients. Am. J. Hum. Genet. 49: 1219-1234. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). "Molecular Cloning-A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schmauss, C., Brines, M. L., and Lerner, M. R (1992). The gene encoding the small nuclear ribonucleoprotein-associated protein N is expressed at high levels in neurons. J. Bioi. Chem. 267: 8521-8529. Schwartz, D. C., and Cantor, C. R (1984). Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37: 67-75. Sinnett, D., Wagstaff, J., Glatt, K, Woolf, E., Kirkness, E. J., and Lalande, M. (1993). High-resolution mapping of the -y-aminobutyric acid receptor subunit {33 and ",5 gene cluster on chromosome 15q11-q13, and localization of breakpoints in two Angelman syndrome patients. Am. J. Hum. Genet. 52: 1216-1229. Sutcliffe, J. S., Zhang, F., Caskey, C. T., Nelson, D. L., and Warren, S. T. (1992). PCR amplification and analysis of yeast artificial chromosomes. Genomics 13: 1303-1306. vanOmmen, G. J. B., and Verkerk, J. M. H. (1986). Restriction analysis of chromosomal DNA in a size range up to two million base pairs by pulsed field gradient electrophoresis. In "Human Genetic Diseases: A Practical Approach," pp. 113-117, IRL Press, Oxford. Wagstaff, J., Knoll, J. H. M., Fleming, J., Kirkness, E. F., Martin-Gallardo, A., Greenberg, F., Graham, J. M., Jr., Menninger, J., Ward, D., Venter, J. C., and LaLande, M. (1991). Localization of the gene encoding the GABA A receptor {33 subunit to the Angelman/PraderWilli region of human chromosome 15. Am. J. Hum. Genet. 49: 330-337. Wagstaff, J., Knoll, J. H. M., Glatt, K A., Shugart, Y. Y., Sommer, A., and LaLande, M. (1992). Maternal but not paternal transmission of 15qll-13-linked nondeletion Angelman syndrome leads to phenotypic expression. Nature Genet. 1: 291-294. Zemel, S., Bartolomei, M. S., and Tilghman, S. M. (1992). Physical linkage of two mammaliam imprinted genes, H19 and insulin-like growth factor 2. Nature Genet. 2: 61-64.