- Email: [email protected]
A compound heterozygous mutation of CYP27A1 gene in a Taiwanese patient with cerebrotendinous xanthomatosis
J Orthop Sci (2011) 16:825–827 DOI 10.1007/s00776-011-0072-0
CASE REPORT
A compound heterozygous mutation of CYP27A1 gene in a Taiwanese patient with cerebrotendinous xanthomatosis Wen-Chau Chen • Kuo-Chen Wu • Chih-Hsiung Hu Tai-Chang Chern • I-Ming Jou
•
Received: 15 February 2010 / Accepted: 31 October 2010 / Published online: 7 May 2011 Ó The Japanese Orthopaedic Association 2011
Introduction Cerebrotendinous xanthomatosis (CTX, OMIM: 213700) is a rare inherited autosomal recessive lipid storage disorder with multiple system involvement. The disease is caused by mutations in the gene encoding sterol 27-hydroxylase (CYP27A1), leading to a block in bile synthesis, with accumulation of substrates for this enzyme, including cholesterol, resulting in an increase in the conversion of cholesterol to cholestanol. Clinically, CTX is characterized by tendon xanthomas, juvenile cataracts, premature atherosclerosis, and progressive neurological deficits [1]. We report the mutation analysis of a Taiwanese patient with CTX involving only the Achilles tendon.
Case report A 42-year-old woman presented with large mass in both Achilles tendons of [20 years’ duration. The mass was
W.-C. Chen Department of Emergency Medicine, College of Medicine, National Cheng-Kung University and Hospital, Tainan, Taiwan K.-C. Wu Department of Orthopaedics, Kuo’s General Hospital, Tainan, Taiwan W.-C. Chen C.-H. Hu I.-M. Jou (&) Department of Orthopedics, College of Medicine, National Cheng-Kung University and Hospital, 138 Sheng-Li Road, Tainan, Taiwan e-mail: [email protected] T.-C. Chern Chern Tai-Chang’s Orthopaedics Clinic, Ping-Tong, Taiwan
elastic and not tender, and had enlarged gradually and caused pain when walking for 10 years prior to presentation. Pain often subsided after rest. She had undergone biopsy at a regional hospital, and a benign lesion was diagnosed. Due to increasing mass size, she presented to our hospital for surgical intervention. Physical examination showed a left Achilles tendon mass 4 9 2 cm and a right Achilles tendon mass 1 9 1 cm. She had no mental retardation or cognitive impairment. Cataract and ataxia were absent. Her family had no similar disorder (Fig. 1). Laboratory investigations showed a normal full-blood count, erythrocyte sedimentation rate, serum electrolytes, and liver and renal function tests. Serum triglyceride (103 mg/ dl) and cholesterol (146 mg/dl) were normal, as was highdensity lipoprotein (HDL) cholesterol (52 mg/dl). Serum cholestanol level was elevated (2.75 mg/dl; normal value \1 mg/dl). Magnetic resonance imaging demonstrated fusiform enlargement involving the Achilles tendons bilaterally (Fig. 2). The patient received an en bloc excision of the masses. The specimen grossly presented fatty yellow infiltration into the Achilles tendon (Fig. 2). Histopathology revealed many cholesterol clefts surrounded by foreign-body giant cells and mononuclear cell infiltration, consistent with xanthoma. Due to the normal cholesterol level and bilateral Achilles tendon xanthoma, CTX was suspected. Genomic DNA was extracted from peripheral blood of the patient and her sons with informed consent and approval from Ethics Committee of National Cheng-Kung University Hospital. DNA samples were then subjected to mutation screening by amplification of segments of the CYP27A1 gene using primers synthesized on the basis of intronic sequences (Table 1). Direct DNA sequencing of CYP27A1 demonstrated a compound heterozygous mutation in the proband, 206delC in exon 2, and 310C[T (R104W) in
123
826
exon 2 (mutations were detected when DNA sequencing was performed with cloning) (Fig. 3). The former is a novel mutation, whereas the latter has been previously reported in a Japanese family [2]. The sons are all carriers (Fig. 1).
Fig. 1 Family pedigree. Solid symbols affected individuals, open symbols unaffected, squares male, circles female
Fig. 2 Magnetic resonance imaging demonstrated fusiform enlargement involving the Achilles tendons bilaterally. The specimen grossly presented fatty yellow infiltration into the Achilles tendon
123
W.-C. Chen et al.
Discussion We report an adult CTX patient with an atypical presentation (absence of cataracts and neurologic disability). The diagnosis of CTX was confirmed by molecular study of the CYP27A1 gene, which showed a novel mutation, 206delC, in exon 2. The second mutation was 310C[T (R104W) in exon 2, already described in a patient in Japan [2]. A phenotypic variant due to specific CYP27A1 gene mutations cannot be ruled out [3]. Guyant-Marechal et al. [4] reported a 53-year-old man with an unusual CTX phenotype involving xanthomas from adolescence but no mental retardation and development of a progressive neuropsychiatric disorder beginning at age 44 that was suggestive of frontotemporal dementia. He had no cataract or ataxia. Our patient needs further follow-up for other signs of neurologic deterioration. CTX is an underdiagnosed disease. The phenotype is often incomplete. Tendon xanthomas are one of the clinical hallmarks of CTX, usually presenting in the second or third decade of life, in most cases before neurologic symptoms. Early diagnosis is crucial because treatment with chenodeoxycholic acid reverses metabolic abnormalities and prevents or improves neurologic dysfunction. We suggest that even if ataxia or premature cataract are absent,
CYP27A1 gene mutation in CTX
827
Table 1 Polymerase chain reaction (PCR) primers for amplification of CYP27A1 from genomic DNA Exon
Forward (50 ? 30 )
Backward (50 ? 30 )
Product size
AT (°C)
1
GTCTAGCTGGCCTTTGCTCG
GCTGAGTTCCTGCAGCCTTC
483
55
2
CTCATTTGCTCTTGTGTAGC
CTATTCTGCCGGTTATCCAC
393
50
3, 4
CTTCAGGGTGAGAAGATCTC
CATGATCTCCAAGGACCAAG
737
50
5
CAGCTATTTGCTACATCCTG
CAAGCCCTCTATTTTCCTTC
703
50
6, 7
CACATTTTGCATACACCCAC
CAGCATGAATGCCTCTCTTC
597
50
8, 9
GCTTCCTCTTCCCCAAGAAC
CTCATCTGAGACATGGCAGC
677
55
AT annealing temperature
Fig. 3 A compound heterozygous mutation in exon 2 was detected in the CYP27A1. a Mutant allele revealed 206delC, b normal control, c cloning the mutant allele, d mutant allele revealed 310C[T (R104W), e normal control, f cloning the mutant allele
diagnosis of CTX should be considered in patients with tendon xanthomas despite normal or only slightly elevated levels of plasma cholesterol. Mutation analysis can help confirm the diagnosis. Acknowledgments We thank the family members for their participation in the study and agreement to publish their data. This work was supported mainly by grant NCKUH 96-075 from the National Cheng Kung University Hospital, Taiwan, Republic of China.
2. Nakashima N, Sakai Y, Sakai H, Yanase T, Haji M, Umeda F, Koga S, Hoshita T, Nawata H. A point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis. J Lipid Res. 1994;35:663–8. 3. Moghadasian MH. Cerebrotendinous xanthomatosis: clinical course, genotypes and metabolic backgrounds. Clin Invest Med. 2004;27:42–50. 4. Guyant-Marechal L, Verrips A, Girard C, Wevers RA, Zijlstra F, Sistermans E, Vera P, Campion D, Hannequin D. Unusual cerebrotendinous xanthomatosis with fronto-temporal dementia phenotype. Am J Med Genet. 2005;139A:114–7.
References 1. Moghadasian MH, Salen G, Frohlich JJ, Scudamore CH. Cerebrotendinous xanthomatosis: a rare disease with diverse manifestations. Arch Neurol. 2002;59:527–9.
123
CASE REPORT
A compound heterozygous mutation of CYP27A1 gene in a Taiwanese patient with cerebrotendinous xanthomatosis Wen-Chau Chen • Kuo-Chen Wu • Chih-Hsiung Hu Tai-Chang Chern • I-Ming Jou
•
Received: 15 February 2010 / Accepted: 31 October 2010 / Published online: 7 May 2011 Ó The Japanese Orthopaedic Association 2011
Introduction Cerebrotendinous xanthomatosis (CTX, OMIM: 213700) is a rare inherited autosomal recessive lipid storage disorder with multiple system involvement. The disease is caused by mutations in the gene encoding sterol 27-hydroxylase (CYP27A1), leading to a block in bile synthesis, with accumulation of substrates for this enzyme, including cholesterol, resulting in an increase in the conversion of cholesterol to cholestanol. Clinically, CTX is characterized by tendon xanthomas, juvenile cataracts, premature atherosclerosis, and progressive neurological deficits [1]. We report the mutation analysis of a Taiwanese patient with CTX involving only the Achilles tendon.
Case report A 42-year-old woman presented with large mass in both Achilles tendons of [20 years’ duration. The mass was
W.-C. Chen Department of Emergency Medicine, College of Medicine, National Cheng-Kung University and Hospital, Tainan, Taiwan K.-C. Wu Department of Orthopaedics, Kuo’s General Hospital, Tainan, Taiwan W.-C. Chen C.-H. Hu I.-M. Jou (&) Department of Orthopedics, College of Medicine, National Cheng-Kung University and Hospital, 138 Sheng-Li Road, Tainan, Taiwan e-mail: [email protected] T.-C. Chern Chern Tai-Chang’s Orthopaedics Clinic, Ping-Tong, Taiwan
elastic and not tender, and had enlarged gradually and caused pain when walking for 10 years prior to presentation. Pain often subsided after rest. She had undergone biopsy at a regional hospital, and a benign lesion was diagnosed. Due to increasing mass size, she presented to our hospital for surgical intervention. Physical examination showed a left Achilles tendon mass 4 9 2 cm and a right Achilles tendon mass 1 9 1 cm. She had no mental retardation or cognitive impairment. Cataract and ataxia were absent. Her family had no similar disorder (Fig. 1). Laboratory investigations showed a normal full-blood count, erythrocyte sedimentation rate, serum electrolytes, and liver and renal function tests. Serum triglyceride (103 mg/ dl) and cholesterol (146 mg/dl) were normal, as was highdensity lipoprotein (HDL) cholesterol (52 mg/dl). Serum cholestanol level was elevated (2.75 mg/dl; normal value \1 mg/dl). Magnetic resonance imaging demonstrated fusiform enlargement involving the Achilles tendons bilaterally (Fig. 2). The patient received an en bloc excision of the masses. The specimen grossly presented fatty yellow infiltration into the Achilles tendon (Fig. 2). Histopathology revealed many cholesterol clefts surrounded by foreign-body giant cells and mononuclear cell infiltration, consistent with xanthoma. Due to the normal cholesterol level and bilateral Achilles tendon xanthoma, CTX was suspected. Genomic DNA was extracted from peripheral blood of the patient and her sons with informed consent and approval from Ethics Committee of National Cheng-Kung University Hospital. DNA samples were then subjected to mutation screening by amplification of segments of the CYP27A1 gene using primers synthesized on the basis of intronic sequences (Table 1). Direct DNA sequencing of CYP27A1 demonstrated a compound heterozygous mutation in the proband, 206delC in exon 2, and 310C[T (R104W) in
123
826
exon 2 (mutations were detected when DNA sequencing was performed with cloning) (Fig. 3). The former is a novel mutation, whereas the latter has been previously reported in a Japanese family [2]. The sons are all carriers (Fig. 1).
Fig. 1 Family pedigree. Solid symbols affected individuals, open symbols unaffected, squares male, circles female
Fig. 2 Magnetic resonance imaging demonstrated fusiform enlargement involving the Achilles tendons bilaterally. The specimen grossly presented fatty yellow infiltration into the Achilles tendon
123
W.-C. Chen et al.
Discussion We report an adult CTX patient with an atypical presentation (absence of cataracts and neurologic disability). The diagnosis of CTX was confirmed by molecular study of the CYP27A1 gene, which showed a novel mutation, 206delC, in exon 2. The second mutation was 310C[T (R104W) in exon 2, already described in a patient in Japan [2]. A phenotypic variant due to specific CYP27A1 gene mutations cannot be ruled out [3]. Guyant-Marechal et al. [4] reported a 53-year-old man with an unusual CTX phenotype involving xanthomas from adolescence but no mental retardation and development of a progressive neuropsychiatric disorder beginning at age 44 that was suggestive of frontotemporal dementia. He had no cataract or ataxia. Our patient needs further follow-up for other signs of neurologic deterioration. CTX is an underdiagnosed disease. The phenotype is often incomplete. Tendon xanthomas are one of the clinical hallmarks of CTX, usually presenting in the second or third decade of life, in most cases before neurologic symptoms. Early diagnosis is crucial because treatment with chenodeoxycholic acid reverses metabolic abnormalities and prevents or improves neurologic dysfunction. We suggest that even if ataxia or premature cataract are absent,
CYP27A1 gene mutation in CTX
827
Table 1 Polymerase chain reaction (PCR) primers for amplification of CYP27A1 from genomic DNA Exon
Forward (50 ? 30 )
Backward (50 ? 30 )
Product size
AT (°C)
1
GTCTAGCTGGCCTTTGCTCG
GCTGAGTTCCTGCAGCCTTC
483
55
2
CTCATTTGCTCTTGTGTAGC
CTATTCTGCCGGTTATCCAC
393
50
3, 4
CTTCAGGGTGAGAAGATCTC
CATGATCTCCAAGGACCAAG
737
50
5
CAGCTATTTGCTACATCCTG
CAAGCCCTCTATTTTCCTTC
703
50
6, 7
CACATTTTGCATACACCCAC
CAGCATGAATGCCTCTCTTC
597
50
8, 9
GCTTCCTCTTCCCCAAGAAC
CTCATCTGAGACATGGCAGC
677
55
AT annealing temperature
Fig. 3 A compound heterozygous mutation in exon 2 was detected in the CYP27A1. a Mutant allele revealed 206delC, b normal control, c cloning the mutant allele, d mutant allele revealed 310C[T (R104W), e normal control, f cloning the mutant allele
diagnosis of CTX should be considered in patients with tendon xanthomas despite normal or only slightly elevated levels of plasma cholesterol. Mutation analysis can help confirm the diagnosis. Acknowledgments We thank the family members for their participation in the study and agreement to publish their data. This work was supported mainly by grant NCKUH 96-075 from the National Cheng Kung University Hospital, Taiwan, Republic of China.
2. Nakashima N, Sakai Y, Sakai H, Yanase T, Haji M, Umeda F, Koga S, Hoshita T, Nawata H. A point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis. J Lipid Res. 1994;35:663–8. 3. Moghadasian MH. Cerebrotendinous xanthomatosis: clinical course, genotypes and metabolic backgrounds. Clin Invest Med. 2004;27:42–50. 4. Guyant-Marechal L, Verrips A, Girard C, Wevers RA, Zijlstra F, Sistermans E, Vera P, Campion D, Hannequin D. Unusual cerebrotendinous xanthomatosis with fronto-temporal dementia phenotype. Am J Med Genet. 2005;139A:114–7.
References 1. Moghadasian MH, Salen G, Frohlich JJ, Scudamore CH. Cerebrotendinous xanthomatosis: a rare disease with diverse manifestations. Arch Neurol. 2002;59:527–9.
123