A coordination polymer nanobelt (CPNB)-based aptasensor for sulfadimethoxine

Biosensors and Bioelectronics 33 (2012) 113–119

Contents lists available at SciVerse ScienceDirect

Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios

A coordination polymer nanobelt (CPNB)-based aptasensor for sulfadimethoxine Kyung-Mi Song, Euiyoung Jeong, Weejeong Jeon, Hunho Jo, Changill Ban ∗ Department of Chemistry, Pohang University of Science and Technology, San 31, Hyoja-dong, Pohang, Gyungbuk 790-784, South Korea

a r t i c l e

i n f o

Article history: Received 3 November 2011 Received in revised form 9 December 2011 Accepted 16 December 2011 Available online 29 December 2011 Keywords: Sulfadimethoxine ssDNA aptamer Coordination polymer nanobelts Fluorescence Aptasensor

a b s t r a c t A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5 -GAGGGCAACGAGTGTTTATAGA-3 ), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO3 and 4,4 -bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10 ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products. © 2011 Elsevier B.V. All rights reserved.

1. Introduction The use of antibiotics as prophylactic and therapeutic agents for microbial infections is growing rapidly in recent years (Su et al., 2011). However, this practice can lead to side effects, such as chemical poisoning and allergic reactions, when antibiotic residues in the food chain are transferred to humans (Fernandez et al., 2010). Therefore, a maximum residue limit (MRL) has been established for several antibiotics in milk and other food products by the governments of many countries (Kim et al., 2010). Moreover, systems for monitoring antibiotic residues to improve food safety in the food industry have also been required (Su et al., 2011). Sulfadimethoxine is a widely used antibacterial agent of the sulfonamide class and is employed almost exclusively for the treatment of coccidiosis in many species. Previous studies have used a variety of methods, including high-performance liquid chromatography (HPLC), capillary electrophoresis (CE), and enzyme-linked immunosorbent assay (ELISA), to measure sulfadimethoxine levels (Cliquet et al., 2003; Fuh and Chu, 2003; Kishida and Furusawa, 2001; Kishida, 2007; Maudens et al., 2004; Sangjarusvichai et al., 2009; Sun et al., 2009). Although HPLC is the most commonly used method because it offers high sensitivity and high selectivity, it requires expensive and elaborate instrumentation and is not suitable for analyzing large numbers of samples (Wang et al., 2007). CE also requires expensive equipment, and immunoassays, such as ELISA, can be

∗ Corresponding author. Tel.: +82 54 279 2127; fax: +82 54 279 3399. E-mail address: [email protected] (C. Ban). 0956-5663/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.bios.2011.12.034

limited in practice due to their dependence on the surrounding environment (Wei and Wang, 2011). As a result, there is a demand for a more accurate and economical method to detect the amount of residual antibiotics present in food. Aptamers, which bind to target molecules with high affinity and specificity, have been studied extensively as bio-probes for small molecules, proteins, and cells (Cho et al., 2009; Famulok, 1999; Levy-Nissenbaum et al., 2008; Zhou et al., 2010). Aptamers for several antibiotics have been investigated and applied to the sensing system using various methods such as gold nanoparticle-based colorimetry, electrochemical impedance spectroscopy, and surface plasmon resonance (SPR) spectroscopy (Bonel et al., 2011; de-losSantos-Alvarez et al., 2009; Deng et al., 2009; Li et al., 2009a,b, 2011; Pavlov et al., 2004; Wang et al., 2009, 2010). Herein, we report on sulfadimethoxine-specific ssDNA aptamers developed by the magnetic bead-based SELEX technique. To manufacture the sensing system for sulfadimethoxine, coordination polymers were selected as sensing platforms among diverse nano-materials such as gold nanoparticles (AuNPs), carbon nanotubes (CNTs), graphene oxide (GO), polymer nanobelts, and coordination polymers (Chhabra et al., 2009; Habenicht and Prezhdo, 2008; Huang et al., 2011; Liu et al., 2011; Luo et al., 2011; Olek et al., 2006). Coordination polymers are a class of organic–inorganic hybrid materials. More specifically, these polymers are inorganic structures containing metal cation centers linked by organic bridging ligands that have a strong binding affinity for oligonucleotides via strong ␲–␲ stacking interactions and that are able to quench fluorophores (James, 2003; Spokoyny et al., 2009; Sun et al., 2005). These valuable features enable the design of a highly sensitive and selective detection method

114

K.-M. Song et al. / Biosensors and Bioelectronics 33 (2012) 113–119

for target molecules. In this work, we developed a CPNB-based aptasensor using a FAM-labeled aptamer and demonstrated that it was a remarkably effective sensing strategy for detecting sulfadimethoxine. 2. Materials and methods 2.1. Immobilization of sulfadimethoxine on magnetic beads Sulfadimethoxine was immobilized on M-280 tosylactivated magnetic beads as previously described (Song et al., 2011). Briefly, 30 mg of magnetic beads were incubated with 20 ␮mol (6.6 mg) of sulfadimethoxine in borate buffer (0.1 M borate, 0.67 M (NH4 )2 SO4 ) at 37 ◦ C for 20 h, and the incubated magnetic beads were rinsed twice with phosphate buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2 HPO4 , 1.4 mM KH2 PO4 , pH 7.4). The supernatant containing non-reacted sulfadimethoxine was then collected via separation by a magnetic stand, and its UV absorbance was measured at 270 nm to calculate the proportion of sulfadimethoxine immobilized on the beads (Chichiro et al., 1982; Queiroz et al., 2001). Next, the amount of immobilized sulfadimethoxine was established by subtracting the non-reacted amount from the initial amount of the antibiotic, based on the UV-spectroscopic quantification (Fig. S1). Afterwards, the sulfadimethoxine-immobilized beads were stored in 1500 ␮L of PBS at 4 ◦ C. 2.2. In vitro selection for the sulfadimethoxine-specific aptamers The library of synthetic ssDNA oligonucleotides was designed to include random sequences of the central 40 nucleotides: 5 CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3 . The following primers were used for the amplification and ssDNA generation of the selected ssDNAs during the selection process: F-primer (5 -CACCTAATACGACTCACTATAGCGGA-3 ) and B-primer (5 -biotin-GCAAGCTTGTTCGAGCCAG-3 ). The 500 pmol library was prepared by re-annealing for 3 min at 90 ◦ C and immediately placing it in 100 ␮L of binding buffer (20 mM Tris–HCl, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2 , pH 8.0) at 4 ◦ C for 1 h. The SELEX was performed using sulfadimethoxine-immobilized magnetic beads, and each round of the SELEX was accomplished by an iterative process of selection and amplification (Song et al., 2011). Two milligrams of sulfadimethoxine-immobilized magnetic beads and sulfadimethoxine-free magnetic beads were used as the targets for positive and negative selection, respectively. The prepared ssDNA library was shake-incubated with the sulfadimethoxine-free beads for 1 h for the negative selection. The unbound ssDNAs that were separated from the sulfadimethoxinefree beads were collected via magnetic separation, and they were subsequently used as the new library for the positive selection. The sulfadimethoxine-immobilized beads and the new library were mixed and incubated with shaking at room temperature for 1 h. The incubated magnetic beads were washed twice with 100 ␮L of wash buffer (20 mM Tris–HCl, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2 , 0.01% Tween 20, pH 8.0) to remove ssDNAs that were not bound to sulfadimethoxine, and the ssDNAs bound to sulfadimethoxine were eluted with 100 ␮L of 20 mM NaOH. The eluted ssDNAs were amplified by PCR using pfu polymerase and the previously described primers. The amplified biotin-dsDNAs were added to the streptavidin-coated magnetic beads, and the ssDNAs were generated in a basic condition for the next round of the positive selection. The amount of ssDNA at the end of each round was measured by UV–VIS spectroscopy (Biochrom Libra S22 spectrometer). After the 13th round, the PCR products of the selected ssDNAs were cloned into a pENTR/TOPO-vector, and the ligation products were transformed into TOP10 cells,

Fig. 1. The sequences of the ssDNAs, S1–S13, selected by in vitro selection. The common sequences are underlined in each ssDNA sequence.

as recommended by the manufacturer (Invitrogen, TOPO TA Cloning Kit). The clones were purified with a mini-prep kit (GeneAll, South Korea), and the inserted ssDNAs were sequenced (COSMO Genetech, South Korea). The secondary structures of the identified ssDNAs were predicted using the Mfold program (http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form). 2.3. Fluorescence binding assay of selected aptamers for sulfadimethoxine Whereas FAM-labeled ssDNAs (S1–S13; 90 mer) were obtained by amplification with the FAM-modified F-primer, FAM-labeled Su11 and Su13 ssDNAs were prepared by chemical synthesis from bionics. The FAM-ssDNA was added to 0.2 mg of the sulfadimethoxine-immobilized beads in 100 ␮L of binding buffer. Next, the mixed solution was shaken at room temperature for 1 h and washed with the washing buffer, which consisted of binding buffer plus 0.01% Tween 20. The FAM-ssDNA bound to sulfadimethoxine was eluted with 20 mM NaOH, and the amount of each eluted FAM-ssDNA sample was measured by the fluorescence intensity of the solution at 520 nm (exc = 494 nm) using a 1420 Victor multi-label counter from Perkin–Elmer (USA). With respect to the concentrations of the FAM-ssDNA, the dissociation constant (Kd ) of the ssDNA was determined by a nonlinear regression analysis using Origin v6.1 (Cho et al., 2010). 2.4. Synthesis of the CPNBs and preparation of the milk sample The CPNBs were synthesized using a pyridine moiety (Luo et al., 2011). One milliliter of 0.2 M AgNO3 , which was dissolved in distilled water, and 2 mL of 0.1 M 4,4 -bipyridine, which was dissolved in ethanol, were mixed and stirred at room temperature. The resulting white precipitates were gathered by centrifugation, washed three times with distilled water, and stored in 3 mL of distilled water. The milk was purchased from a local supermarket. After removing a layer of fat, 2 mL of the milk was blended with 2 mL of distilled water for 10 min. After adding 7 mL of ethyl acetate, the solution was vigorously shaken by vortexing for an additional 15 min. A clear supernatant was obtained from this solution by centrifugation at 4 ◦ C for 15 min at 5000 rpm. Next, 7 mL of ethyl acetate were added to the remaining sample, and the same shaking and centrifuging procedures were repeated. The ethyl acetate was then removed from the collected supernatant by a gentle nitrogen blow-down

K.-M. Song et al. / Biosensors and Bioelectronics 33 (2012) 113–119

115

Fig. 2. (a) The fluorescence intensities at 520 nm, which represent the binding amounts of each ssDNA aptamer candidate, S1–S13, to sulfadimethoxine. (b) The fluorescence intensities at 520 nm showing the binding of the Su11 and Su13 ssDNAs to sulfadimethoxine. The Su11 and Su13 ssDNAs are shortened ssDNAs that contain the binding portions of the original S11 and S13 sequences, respectively. (c) The conserved secondary structures of the Su11 and Su13 aptamers, which contain a ‘GAG’ in the loop region and ‘GC-AT-AT’ base pairs in the stem region.

at 40 ◦ C. After this extraction, the final precipitate was dissolved in distilled water, and sulfadimethoxine was added to the milk sample. 2.5. The CPNBs-based assay for detecting sulfadimethoxine Sulfadimethoxine was dissolved in two types of solvents: distilled water and milk. After 400 ␮L of each sulfadimethoxine

solution was incubated at room temperature for 1 h with the 200 nM FAM-ssDNA aptamer in the binding buffer (final 495 ␮L), 5 ␮L of synthetic CPNBs (final 1.0% (v/v)) was added. After an additional 30 min incubation with shaking, the agglomerated CPNBs with the adsorbed FAM-ssDNA aptamer were removed by centrifugation for 5 min at 13,000 rpm. The amount of the remaining FAM-ssDNA aptamer in the supernatant was represented as the fluorescence intensity measured by the fluorescence analyzer. In

Fig. 3. A schematic illustration of the CPNB-based aptasensor using fluorescence quenching to detect sulfadimethoxine. The binding of the FAM-Su13 aptamer to sulfadimethoxine does not produce an interaction with the CPNBs; however, in the absence of sulfadimethoxine, the fluorescence of the FAM-Su13 aptamer is quenched due to its adsorption on the CPNBs.

116

K.-M. Song et al. / Biosensors and Bioelectronics 33 (2012) 113–119

addition, a comparative study with other antibiotics, including kanamycin, ampicillin, streptomycin, chloramphenicol, tetracycline, sulfaquinoxaline, and sulfathiazole, was performed following the same method described above. 3. Results and discussion 3.1. Selection of sulfadimethoxine-specific aptamers Various techniques have been employed in SELEX such as affinity chromatography, CE, magnetic beads, and other methods to more easily and rapidly search for target-specific aptamers (Berezovski et al., 2006; Gopinath, 2007; Levesque et al., 2007; Misono and Kumar, 2005; Ravelet et al., 2006; Stoltenburg et al., 2005; Tok and Fisher, 2008). Because the magnetic beads-based strategy is widely known as the simplest method, it was utilized in this work to immobilize the target molecule sulfadimethoxine. Sulfadimethoxine, with an amine functional group, was immobilized on the tosyl-activated magnetic beads under basic conditions via cross-linking. The degree of immobilization was determined by UV-spectroscopic quantification, which showed that 40 nmol of sulfadimethoxine were present on 1 mg of the magnetic beads (Fig. S1). Synthetic ssDNA, which contained 40 nucleotides of random sequences, was used as the initial library. A negative selection using sulfadimethoxine-free beads was performed prior to the selection processes. Next, the ssDNAs that did not bind to the bead surface were used as the library for the first round of the positive selections. The progresses of the selections were monitored through the binding affinity percentage, which was calculated as the proportion of eluted ssDNA from the total ssDNA library added in each round. After the 13th round, the binding affinity percentage was not further improved, and the selected ssDNAs in this round were identified. A total of 13 ssDNA aptamer candidates were obtained (S1–S13). Fig. 1 shows the sequences of the random region of each ssDNA, which included a fixed 31-mer at the front and a fixed 19-mer at the back. These regions were necessary to bind the primers. All ssDNA aptamers contained some common sequences such as ‘GGA’, ‘GAG’, ‘CTT’, and ‘TCC’ depicted in Fig. 1. Further selection was performed using these 13 ssDNAs to determine which ssDNA aptamer had the highest binding affinity for sulfadimethoxine. 3.2. Optimization of sulfadimethoxine-specific aptamers A fluorescence binding assay was applied to each ssDNA to compare their binding affinity to sulfadimethoxine. The sulfadimethoxine-immobilized magnetic beads were used to assess the binding affinity of each aptamer candidate to sulfadimethoxine, and individual 5 -FAM labeled ssDNAs were prepared by PCR amplification with the FAM-modified F-primer. The FAM-ssDNA-bound sulfadimethoxine was separated via the beads’ magnetic property and quantified by the fluorescence intensity measurements at 520 nm (exc = 494 nm). As shown in Fig. 2(a), the fluorescence intensities of the S11 and S13 ssDNAs were higher than the others. In other words, the S11 and S13 ssDNAs had a higher affinity for sulfadimethoxine than the other ssDNAs. Their predicted secondary structure and sequence analysis strongly supports the results of the fluorescence binding assay. Only S11 and S13 ssDNAs shared conserved sequences in a major part—‘GAG’ sequences in the loop portion and ‘GC-AT-AT’ base pairs in the stem portion (Figs. 2(c) and S2)—indicating that these regions may be critical motifs for their binding affinity for sulfadimethoxine. Based on the conserved structure and the expected binding model (see Section 3.4), the S11 and S13 ssDNAs were shortened

Fig. 4. (a) The fluorescence emission spectra of the solutions containing the FAMSu13 aptamer and various concentrations of the CPNBs. The fluorescence of the FAM-Su13 aptamer is quenched due to the adsorption of the aptamer on the CPNBs. (b) The fluorescence emission spectra obtained by adding sulfadimethoxine into solutions containing the FAM-Su13 aptamer and the CPNBs. (c) Fluorescence intensity at 520 nm of the solution containing the FAM-Su13 aptamer, sulfadimethoxine, and the CPNBs versus the concentration of sulfadimethoxine from 0 ng/mL to 500 ng/mL.

to 22-mers, while the major stem-loop structure in the original 90-mers was maintained (Su11: GTTAGATGGGAGGTCATATAGC, Su13: GAGGGCAACGAGTGTTTATAGA). The binding affinities of these shortened ssDNAs were identical to the original 90-mer ssDNAs, as determined by fluorescence measurements (Fig. 2(b)). The Kd values of the Su11 and Su13 ssDNAs to sulfadimethoxine were 150 nM and 84 nM, respectively (Fig. S3). Therefore, Su11 and Su13 were regarded as optimized forms with high affinities for sulfadimethoxine, and the Su13 aptamer was chosen as the probe for the further detection study due to its low Kd value.

K.-M. Song et al. / Biosensors and Bioelectronics 33 (2012) 113–119

117

Fig. 5. (a) The structures of sulfadimethoxine, sulfaquinoxaline, and sulfathiazole. The dashed circles on the structures show a sulfonamide group connected to a phenylamine, which are located in the same region in all three structures. (b) The fluorescence intensity at 520 nm of the solution containing the FAM-Su13 aptamer, the CPNBs, and various antibiotics. 1: sulfadimethoxine, 2: kanamycin, 3: ampicillin, 4: streptomycin, 5: chloramphenicol, 6: tetracycline, 7: sulfaquinoxaline, 8: sulfathiazole, 9: no antibiotics (control). (c) The predicted binding model of sulfadimethoxine to the ‘GA’ sequences on the Su11 and Su13 aptamers.

3.3. Fluorescence quenching effect between the aptamer and the CPNBs It has been well described that the coordination-induced assembly between AgNO3 and 4,4 -bipyridine is constructed on both sides of 4,4 -bipyridine due to coordination between the unshared electron pair of the nitrogen atom and the Ag+ ion (Luo et al., 2011). The assembly can be organized into multi-layer nanobelts because of the strong ␲–␲ interactions between each individual nanobelt (Fig. S4). An advantage of these CPNBs is that they are easily and rapidly formed by simply mixing the reactants at room temperature. Fig. 3 illustrates a sulfadimethoxine-sensing system based on the strong ␲–␲ interaction between the aromatic rings of the CPNBs and the DNA bases of the ssDNA. The FAM-labeled aptamer is adsorbed onto the CPNBs, and its fluorescence is quenched due to the photo-induced electron transfer between the excited fluorophore and the nitrogens in the CPNBs (Zhang et al., 2011). However, the specific binding of the FAM-aptamer with sulfadimethoxine diminishes the extent of the adsorption of the aptamer onto the CPNBs, and the extent of the quenching is less than that of the FAM-aptamer without sulfadimethoxine. These

differences in fluorescence intensity will make it possible to detect sulfadimethoxine in solution. To determine the optimized ratio between the CPNBs and the Su13 aptamer, the quenching efficiencies for concentrations between 0.2% (v/v) and 3.0% of each CPNB were measured in 500 ␮L of the binding buffer, which contained 200 nM of the FAM-aptamer (Fig. 4(a)). When more than 2.0% of the CPNBs were added to the solution, the fluorescence intensity of FAM virtually disappeared, and the fluorescence of these solutions was not recovered by the addition of sulfadimethoxine. Therefore, 1.0% of the CPNBs were chosen to detect sulfadimethoxine because it showed a relatively high quenching efficiency for the FAM-modified aptamer and a detectable change in fluorescence intensity following the addition of sulfadimethoxine (Fig. S5). 3.4. Quantitative detection of sulfadimethoxine using the CPNB-based aptasensor and the specificity test for sulfadimethoxine As mentioned above, the fluorescence intensity of the FAMaptamer increases in the presence of sulfadimethoxine as compared with its absence. The fluorescence emission spectra of

118

K.-M. Song et al. / Biosensors and Bioelectronics 33 (2012) 113–119

the solutions containing the FAM-Su13 aptamer, sulfadimethoxine, and the CPNBs were collected for concentrations of sulfadimethoxine ranging from 10 to 1000 ng/mL. There was a concentrationdependent increase in fluorescence intensity (Fig. 4(b)). In particular, the intensity values at 520 nm exponentially increased in proportion to the concentration of sulfadimethoxine (Fig. 4(c)). As a result, the LOD was determined to be 10 ng/mL of sulfadimethoxine in distilled water. To apply the proposed CPNB-based method to a real situation, the aptasensor must be shown to specifically detect the desired target, sulfadimethoxine. For verifying its specificity, the ability of the CPNB-aptasensor to detect other antibiotics such as kanamycin, ampicillin, streptomycin, chloramphenicol, tetracycline, sulfaquinoxaline, and sulfathiazole was tested. Among these, sulfaquinoxaline and sulfathiazole are chemically related to sulfadimethoxine because they contain identical chemical structures, ‘H2 N–C6 H6 –S( O)2 –’, a sulfonyl group connected to phenylamine (Fig. 5(a)). Fig. 5(b) displays the histogram for the fluorescence intensities of each solution in the presence of each antibiotic. The solution containing sulfadimethoxine showed an increase in fluorescence intensity (1st bar in Fig. 5(b)) compared to the control (absence of antibiotics; 9th bar in Fig. 5(b)) due to the interaction between the antibiotic and the aptamer. However, for the solutions containing the other antibiotics, there were no significant increases of fluorescence intensity compared to the control (2nd–8th bars in Fig. 5(b)). These results clearly indicate that the Su13 aptamer has a high specificity for sulfadimethoxine. In addition, the fact that the derivatives did not bind to the Su13 aptamer allows for the prediction of the binding pattern between the oligonucleotide and sulfadimethoxine. Because sulfaquinoxaline and sulfathiazole contain the same sulfonamide and phenylamine moieties as sulfadimethoxine and did not bind to the Su13 aptamer, it is expected that the Su13 aptamer may interact with the opposite side of the phenylamine group in sulfadimethoxine. A possible binding model between the conserved sequence in the loop region and sulfadimethoxine is represented in Fig. 5(c). The dimethoxypyridine portion of sulfadimethoxine can form multiple hydrogen bonds with both G and A residues on the conserved loop portion. Therefore, the aptasensor can specifically recognize sulfadimethoxine via these hydrogen bonds. 3.5. Quantitative detection of sulfadimethoxine in milk using the CPNB-based aptasensor The effectiveness of the CPNB-based method to detect sulfadimethoxine was further validated using a real sample that was treated with several antibiotics during the animal husbandry and agriculture process. After the sample was prepared by extraction with ethyl acetate, various concentrations of sulfadimethoxine ranging from 10 ng/mL to 500 ng/mL were added to the extracted milk sample. The fluorescence of each solution was measured following the incubation of these samples with CPNB aptasensor. Then, the fluorescence at 520 nm was plotted against the concentration of sulfadimethoxine, and the plot displayed a result similar to the distilled water case. As shown in Fig. 6, the fluorescence intensity was lineally proportional to the concentration of sulfadimethoxine when converted to a logarithmic scale. The LOD was 10 ng/mL. Interestingly, the fluorescence intensity at low concentrations of sulfadimethoxine in milk was higher than in distilled water. This result shows that the aptamer–sulfadimethoxine interaction can be interfered by other components in the milk when the concentration of the target molecule is low. Despite this undesired phenomenon, the milk sample data was lineally fitted with high accuracy. This result indicates that the CPNB-based method can also effectively detect sulfadimethoxine in a real sample with sufficient sensitivity.

Fig. 6. The linear fit of the fluorescence intensity at 520 nm of the solution containing the FAM-Su13 aptamer, sulfadimethoxine, and the CPNBs versus the concentration of sulfadimethoxine in milk (line) or distilled water (dash) on a logarithmic scale from 10 ng/mL to 500 ng/mL.

4. Conclusion In this work, aptamers specific to sulfadimethoxine were selected and identified for use as biosensor probes. The Su11 and Su13 aptamers have relatively high affinities for sulfadimethoxine (Kd , Su11 = 150 nM; Kd , Su13 = 84 nM) compared to other 11 candidates that were identified and tested. It is predicted that the actual binding is performed by the interaction between the ‘GA’ sequence of the aptamer and the side chain of sulfadimethoxine. This prediction is supported by the specificity test using the related antibiotics, sulfaquinoxaline and sulfathiazole. The CPNBs, which are pyridine-based polymers, were synthesized by mixing AgNO3 and 4,4 -bipyridine and were subsequently used as aptasensors. Using the fluorescence quenching effect of the FAM-modified aptamer, the proposed CPNB-based aptasensor showed high sensitivity for sulfadimethoxine dissolved in milk or in distilled water and had an LOD of 10 ng/mL. Thus, this method could be used to test for sulfadimethoxine residue in food products because its LOD is far below the MRL (100 ng/mL in Korea, 100 ng/mL in USA, 50 ng/mL in Japan). Moreover, this method was shown to detect only sulfadimethoxine with high specificity relative to the other antibiotics tested. In addition, the CPNB-based aptasensor may be an effective sensing platform for antibiotics other than sulfadimethoxine. Acknowledgments This work was supported by the National Research Foundation of Korea (NRF-20100019914, 20110013431) and by KOSEF through the Center for Electro-Photo Behaviors in Advanced Molecular Systems (20110007166). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bios.2011.12.034. References Berezovski, M.V., Musheev, M.U., Drabovich, A.P., Jitkova, J.V., Krylov, S.N., 2006. Nat. Protoc. 1, 1359–1369. Bonel, L., Vidal, J.C., Duato, P., Castillo, J.R., 2011. Biosens. Bioelectron. 26, 3254–3259. Chhabra, R., Sharma, J., Wang, H., Zou, S., Lin, S., Yan, H., Lindsay, S., Liu, Y., 2009. Nanotechnology 20, 485201. Chichiro, V.E., Arzamastsev, A.P., Trius, N.V., Suranova, A.V., Sadchikova, N.P., 1982. Pharm. Chem. J. 15, 681–686. Cho, E.J., Lee, J.W., Ellington, A.D., 2009. Annu. Rev. Anal. Chem. 2, 241–264.

K.-M. Song et al. / Biosensors and Bioelectronics 33 (2012) 113–119 Cho, M., Xiao, Y., Nie, J., Stewart, R., Csordas, A.T., Oh, S.S., Thomson, J.A., Soh, H.T., 2010. Proc. Natl. Acad. Sci. U.S.A. 107, 15373–15378. Cliquet, P., Cox, E., Haasnoot, W., Schacht, E., Goddeeris, B.M., 2003. Anal. Chim. Acta 494, 21–28. de-los-Santos-Alvarez, N., Lobo-Castanon, M.J., Miranda-Ordieres, A.J., TunonBlanco, P., 2009. Biosens. Bioelectron. 24, 2547–2553. Deng, C., Chen, J., Nie, L., Nie, Z., Yao, S., 2009. Anal. Chem. 81, 9972–9978. Famulok, M., 1999. Curr. Opin. Struct. Biol. 9, 324–329. Fernandez, F., Hegnerova, K., Piliarik, M., Sanchez-Baeza, F., Homola, J., Marco, M.P., 2010. Biosens. Bioelectron. 26, 1231–1238. Fuh, M.S., Chu, S.Y., 2003. Anal. Chim. Acta 499, 215–221. Gopinath, S.C., 2007. Anal. Bioanal. Chem. 387, 171–182. Habenicht, B.F., Prezhdo, O.V., 2008. Phys. Rev. Lett. 100, 197402. Huang, Y., Zhao, S., Liang, H., Chen, Z.F., Liu, Y.M., 2011. Chemistry 17, 7313–7319. James, S.L., 2003. Chem. Soc. Rev. 32, 276–288. Kim, D.M., Rahman, M.A., Do, M.H., Ban, C., Shim, Y.B., 2010. Biosens. Bioelectron. 25, 1781–1788. Kishida, K., Furusawa, N., 2001. J. Chromatogr. A 937, 49–55. Kishida, K., 2007. Food Chem. 101, 281–285. Levy-Nissenbaum, E., Radovic-Moreno, A.F., Wang, A.Z., Langer, R., Farokhzad, O.C., 2008. Trends Biotechnol. 26, 442–449. Levesque, D., Beaudoin, J.D., Roy, S., Perreault, J.P., 2007. Biochem. J. 403, 129–138. Li, F., Zhang, J., Cao, X., Wang, L., Li, D., Song, S., Ye, B., Fan, C., 2009a. Analyst 134, 1355–1360. Li, L., Li, B., Qi, Y., Jin, Y., 2009b. Anal. Bioanal. Chem. 393, 2051–2057. Liu, M., Zhao, H., Chen, S., Yu, H., Zhang, Y., Quan, X., 2011. Biosens. Bioelectron. 26, 4111–4116. Li, Y., Qi, H., Gao, C., Zhang, C., 2011. Biosens. Bioelectron. 26, 2733–2736. Luo, Y., Liao, F., Lu, W., Chang, G., Sun, X., 2011. Nanotechnology 22, 195502.

119

Maudens, K., Zhang, G.F., Lambert, W.E., 2004. J. Chromatogr. A 1047, 85–92. Misono, T.S., Kumar, P.K., 2005. Anal. Biochem. 342, 312–317. Olek, M., Busqen, T., Hilgendorff, M., Giersiq, M., 2006. J. Phys. Chem. B 110, 12901–12904. Pavlov, V., Xiao, Y., Shlyahovsky, B., Willner, I., 2004. J. Am. Chem. Soc. 126, 11768–11769. Queiroz, A.C., Santos, J.D., Monteiro, F.J., Gibson, I.R., Knowles, J.C., 2001. Biomaterials 22, 1393–1400. Ravelet, D., Grosset, C., Peyrin, E., 2006. J. Chromatogr. A 1117, 1–10. Sangjarusvichai, H., Dungchai, W., Siangproh, W., Chailapakul, O., 2009. Talanta 79, 1036–1041. Song, K.M., Cho, M., Jo, H., Min, K., Jeon, S.H., Kim, T., Han, M.S., Ku, J.K., Ban, C., 2011. Anal. Biochem. 415, 175–181. Spokoyny, A.M., Kim, D., Sumrein, A., Mirkin, C.A., 2009. Chem. Soc. Rev. 38, 1218–1227. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2005. Anal. Bioanal. Chem. 383, 83–91. Su, P., Liu, N., Zhu, M., Ning, B., Liu, M., Yang, Z., Pan, X., Gao, Z., 2011. Talanta 85, 1160–1165. Sun, L., Chen, L., Sun, X., Du, X., Yue, Y., He, D., Xu, H., Zeng, Q., Wang, H., Ding, L., 2009. Chemosphere 77, 1306–1312. Sun, X., Dong, S., Wang, E., 2005. J. Am. Chem. Soc. 127, 13102–13103. Tok, J.B., Fisher, N.O., 2008. Chem. Commun. 28, 1883–1885. Wang, J., Munir, A., Zhou, H.S., 2009. Biosens. Bioelectron. 25, 124–129. Wang, X., Li, K., Shi, D., Xiong, N., Jin, X., Yi, J., Bi, D., 2007. J. Agric. Food Chem. 55, 2072–2078. Wang, Z., Duan, N., Hun, X., Wu, S., 2010. Anal. Bioanal. Chem. 398, 2125–2132. Wei, Z., Wang, J., 2011. Anal. Chim. Acta 694, 46–56. Zhang, Y., Wang, L., Tian, J., Li, H., Luo, Y., Sun, X., 2011. Langmuir 27, 2170–2175. Zhou, J., Battig, M.R., Wang, Y., 2010. Anal. Bioanal. Chem. 398, 2471–2480.